ID: 1001068459

View in Genome Browser
Species Human (GRCh38)
Location 5:168560338-168560360
Sequence GAGGTTTGAAGGAGGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 1, 2: 5, 3: 82, 4: 531}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001068459 Original CRISPR GAGGTTTGAAGGAGGTGAGG GGG (reversed) Intronic
900970619 1:5990827-5990849 GAGGTTGGAAACAGGTGGGGAGG - Intronic
901122732 1:6908264-6908286 GAGGCGTGAAGGGAGTGAGGGGG - Intronic
901206221 1:7497340-7497362 GAGGTTTGGAGGATGGGATGGGG - Intronic
901448246 1:9320949-9320971 GAGATTTTAAGCAGGGGAGGGGG - Intronic
902507186 1:16946199-16946221 AAGGTCGGGAGGAGGTGAGGAGG - Intronic
902643101 1:17779241-17779263 GAATGTTGAAGGAGGTGAGAAGG - Intronic
902744002 1:18461000-18461022 CAGGCTTGAAGGATGTGAAGAGG - Intergenic
903189866 1:21650545-21650567 GAGGTAAGAAGGGGATGAGGAGG + Intronic
903363955 1:22794483-22794505 GAGGATTCAAGGAGGTGACTGGG - Intronic
903703656 1:25269006-25269028 GAGGATCCAGGGAGGTGAGGTGG + Intronic
904339036 1:29821289-29821311 GAGGTTTCCAGGAGTTGGGGTGG - Intergenic
904627421 1:31814859-31814881 GAGGCTTGCAGGAGTGGAGGAGG - Exonic
905241783 1:36586293-36586315 GAGGGGAGAAGGAGATGAGGTGG + Intergenic
905287012 1:36887689-36887711 GAGGTTGCAATGAGCTGAGGTGG + Intronic
905523876 1:38622124-38622146 GTGGTTTCATGGAGTTGAGGAGG - Intergenic
905812985 1:40926575-40926597 GAGGTTTTAAGGAGGGCAGAGGG + Intergenic
905851322 1:41277306-41277328 CAGCTTTGAAGGAGGAGAGTAGG + Intergenic
905875350 1:41428533-41428555 GAGATTTGATGGAGGAGAAGGGG - Intergenic
906061382 1:42951204-42951226 GTGGTATGAAGAAGGTGATGGGG + Intronic
906304356 1:44707087-44707109 GGGGGTTAAAGGAGGGGAGGTGG - Intronic
906710601 1:47927045-47927067 AAGGATTGATGGAGGTGAGTGGG + Intronic
906771872 1:48492389-48492411 GAGGTTTGAGTGTGGTGAGGAGG + Intergenic
906815573 1:48874877-48874899 AAGGTTGGAAGCAGGTAAGGTGG - Intronic
907116285 1:51971144-51971166 TAGGTTTGCTGGTGGTGAGGGGG - Intronic
907357586 1:53889304-53889326 GAGGTTTGAAAGAGGTGATGGGG + Exonic
907589005 1:55647737-55647759 GAGGTACGTGGGAGGTGAGGAGG + Intergenic
909395796 1:75169474-75169496 GAGGTGTGAATGAGGAGAGTGGG + Intergenic
910176636 1:84437904-84437926 GAGGATTGAAGAAGGGAAGGTGG + Intergenic
910285053 1:85544691-85544713 GAGGCTTGCAGGATGTGAGTTGG - Intronic
911151830 1:94603771-94603793 GAGTCCTGAATGAGGTGAGGAGG + Intergenic
912468965 1:109893600-109893622 GAGGCTTGAATGTGGTGAAGGGG + Intergenic
912720926 1:112019283-112019305 AAGGCTTGAAGGAGGTGAGGGGG - Intergenic
914704631 1:150160681-150160703 GAGGTTTGAGGAAGGAGAGGGGG - Intronic
915709311 1:157879234-157879256 GAGGTTAGAAATAGGAGAGGAGG - Intronic
916429125 1:164710747-164710769 GAGGGTTTAAGGAGGAGAGAGGG + Intronic
916438259 1:164796942-164796964 AAGGCTTGAGGGAAGTGAGGAGG + Intronic
917117442 1:171616599-171616621 CAGGTTTGAAGGAGGTGATCAGG + Intergenic
917329557 1:173868076-173868098 GAAGATTGAGGGAGGTTAGGGGG - Intronic
918107534 1:181427004-181427026 GAGATGTGAAGAAGCTGAGGTGG - Intronic
918386084 1:184009550-184009572 GAGGTTTAGAGGAAGTAAGGGGG - Intronic
919083421 1:192892235-192892257 GAGGTTTAAAACAGGTGAGATGG + Intergenic
919609089 1:199722802-199722824 GTGGTTTGTTGGAGGAGAGGAGG + Intergenic
919645445 1:200090118-200090140 GAGGTTGGAAAGAGTTGAGGGGG - Intronic
919737684 1:200963522-200963544 TTGGGTTGAAGGAGGTGGGGAGG - Intergenic
919749485 1:201028008-201028030 GAGGTTTAAATGAGGTAACGTGG + Intergenic
920215331 1:204358712-204358734 GAGGGTGGAAGGTGGTGGGGAGG - Intronic
920259364 1:204678526-204678548 GAGGTCTGGAGCTGGTGAGGAGG - Intronic
920966304 1:210704191-210704213 GAAGTCTGAAGGAAGGGAGGGGG + Intronic
921023218 1:211255568-211255590 GAGGTTTCAATGAGCTGAGATGG - Intergenic
921224603 1:213005790-213005812 GAGATTGGAATGAAGTGAGGGGG - Intronic
921228335 1:213043174-213043196 GAGGGTTGGGGGAGGTGGGGAGG + Intergenic
921372165 1:214435147-214435169 GAGCATTAAAGTAGGTGAGGGGG - Intronic
922176558 1:223202205-223202227 CAGGTGTGCAGGTGGTGAGGTGG + Intergenic
922574917 1:226655065-226655087 GAGGTGGGGAGGAGGGGAGGAGG + Intronic
923020394 1:230158992-230159014 GATGTTTGAAGTAGGTGAAGGGG + Intronic
923430039 1:233911103-233911125 AGGGTTTGTATGAGGTGAGGGGG + Intronic
924504503 1:244669089-244669111 GAGGTTTGTTGGAGGTTGGGAGG - Intronic
1063167144 10:3473752-3473774 GGGGTGAGTAGGAGGTGAGGAGG - Intergenic
1063606804 10:7529665-7529687 GAGGGTGGTAGGAGGTGGGGGGG + Intergenic
1063655602 10:7985441-7985463 AAGGCTTGATGAAGGTGAGGAGG - Intronic
1064243384 10:13650472-13650494 CAGGTTTGAAAGAGCTGCGGTGG - Intronic
1064648034 10:17480072-17480094 GTGGTTAGAAAGAGGTGAGGAGG - Intergenic
1066047930 10:31610594-31610616 GTGGTTTGAGGGAGTTGAGTTGG - Intergenic
1066461434 10:35615783-35615805 GAGGTTTGACTGAGGCCAGGAGG + Intergenic
1067203152 10:44192377-44192399 GAGGTTGGATGGTGGTGAGCAGG + Intergenic
1067835359 10:49635085-49635107 GAGTTAAGAAGGGGGTGAGGTGG - Intronic
1069619691 10:69829242-69829264 AGGGTTTGGAGGAGGTCAGGTGG - Intronic
1070000923 10:72376569-72376591 GAGGTTTCAATGAGCTGAGATGG + Intronic
1070565229 10:77598937-77598959 AAGGTCTGAAGAAGGTGGGGTGG + Intronic
1070601417 10:77868935-77868957 GATGTTAGAAGGAGGTGGGGAGG - Intronic
1070667868 10:78358288-78358310 GAGGTTGGAAGGGGGAGAGGGGG - Intergenic
1071943929 10:90619429-90619451 GAGGTTGGATTGATGTGAGGAGG - Intergenic
1072128184 10:92466295-92466317 AAGGCTAGAAGGATGTGAGGTGG - Intronic
1073116346 10:101093959-101093981 GAGGTGTGCAGGAGGGGTGGGGG + Intronic
1074307569 10:112292935-112292957 AAGATTTGGAGGAAGTGAGGAGG - Intronic
1074421943 10:113316880-113316902 GAGGGTACAAGGAGGGGAGGAGG + Intergenic
1074721441 10:116269258-116269280 GAGGTTCGAGGGAGGTGACTTGG - Intronic
1075527487 10:123198816-123198838 GAGGTGTGTGGGTGGTGAGGAGG + Intergenic
1075774268 10:124969850-124969872 TAAGGTTGAAGGAGGTGAGAAGG + Intronic
1075841122 10:125504598-125504620 GAAGGCTGAAAGAGGTGAGGAGG + Intergenic
1076499410 10:130924530-130924552 GGGGGTTGAAGGGTGTGAGGTGG - Intergenic
1076656315 10:132026060-132026082 GAGGTGAGAAGGAAGTGAGGTGG + Intergenic
1076899956 10:133333514-133333536 GAGGGTGGAAGGATCTGAGGGGG + Intronic
1077105766 11:842058-842080 GAGGTTTGCAGGACATGGGGTGG + Intronic
1077289156 11:1780885-1780907 CAGGTTTGAAGGAGGTGGAGAGG + Intergenic
1077706097 11:4487191-4487213 GAGGTTTGAATAAAGGGAGGAGG + Intergenic
1078719631 11:13872503-13872525 GAGGTTGGCAGGAGGTGATGGGG - Intergenic
1081486957 11:43538175-43538197 AAGGTTTGAGGGTGGTGAGGTGG - Intergenic
1081968633 11:47184300-47184322 GAGGTTTGAAGGAGAAGCAGAGG - Intronic
1082785772 11:57315656-57315678 GAGGATTGGGGGAGGTGTGGAGG - Intronic
1083414964 11:62519590-62519612 GAAGTTAGAAGGTGGTGAAGTGG - Exonic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083678282 11:64340083-64340105 GAGGATGCAGGGAGGTGAGGTGG + Intergenic
1083784305 11:64934982-64935004 GTGGCCTGAAGAAGGTGAGGAGG - Exonic
1083909465 11:65697592-65697614 GAGTTTGGGAGGAGGTGGGGAGG - Intergenic
1084128998 11:67119171-67119193 GAGGCCTGAAGGGGGTGGGGGGG + Intergenic
1085107662 11:73859733-73859755 GAGTTTTGAAGCAGGTAAGAGGG + Intronic
1085700806 11:78744396-78744418 GAAGTTTGAAAGAGGTGATCAGG - Intronic
1085856811 11:80184535-80184557 GAGCTTTGAAGGGGCTGAGGTGG - Intergenic
1086107166 11:83158053-83158075 TGGGTTGGAAGGAGGTGAAGGGG + Intronic
1087318064 11:96627896-96627918 GAGGTTTTAAGGATGAGAAGAGG + Intergenic
1087805596 11:102552139-102552161 GAGGTGAGATGGAGTTGAGGAGG + Intergenic
1088190831 11:107226424-107226446 AAGATTAGAAGGAGGTGAGAAGG - Intergenic
1088237794 11:107743620-107743642 GACCTCTGCAGGAGGTGAGGAGG + Intergenic
1088810850 11:113391090-113391112 GAGATTTGAAGGAAATGAAGGGG + Intronic
1088860053 11:113790781-113790803 GAGGTTGCAAGAAGGTGAAGGGG - Intergenic
1089326689 11:117662251-117662273 GAAGGCTGAAGCAGGTGAGGAGG + Intronic
1089442059 11:118525534-118525556 GGGGTTTGACGGAGGCGAGCAGG - Exonic
1089749026 11:120637121-120637143 GAGGAGGGAAGGAGGTGAGAGGG + Intronic
1089872268 11:121686163-121686185 GAGGGTGGAAGGAGATGGGGAGG - Intergenic
1089916476 11:122161780-122161802 AAGGTTGGAGGGAGGGGAGGTGG - Intergenic
1090444403 11:126751181-126751203 GTGGATTGAATGAGCTGAGGGGG - Intronic
1090837031 11:130461374-130461396 GAGGTTGGAATGAGATGAGCTGG + Intronic
1091013756 11:132030602-132030624 GAGATCTGAAGGAAGTGAAGAGG + Intronic
1091130517 11:133143115-133143137 GATGTTGGATGGATGTGAGGAGG + Intronic
1091320871 11:134648906-134648928 GAGGTTTAGATGAGGTCAGGAGG + Intergenic
1091536471 12:1414694-1414716 GAGGGTAAAAGGAGGTGGGGAGG - Intronic
1091688126 12:2578224-2578246 GAGGCCTGAAGGAGCTGAAGGGG + Intronic
1092344715 12:7705878-7705900 GAGGGCTGCGGGAGGTGAGGAGG + Intergenic
1092470136 12:8770802-8770824 GGTGTCTGAAGGGGGTGAGGTGG - Intronic
1093799031 12:23349445-23349467 GATGATTTAAGGAGGTTAGGAGG + Intergenic
1093844447 12:23951330-23951352 GAAGTTGGAAGGAGTGGAGGGGG - Intergenic
1094199571 12:27781848-27781870 GAGATTTGCAGGATGGGAGGGGG - Intronic
1095467531 12:42503767-42503789 AAGGTATAAAGAAGGTGAGGAGG - Intronic
1095576100 12:43741158-43741180 GAGGTTTGAAAGAGGTAGAGGGG + Intronic
1096185788 12:49579662-49579684 AAGACTTGAAGCAGGTGAGGAGG - Intronic
1096674794 12:53220717-53220739 GGGGTTGGAAGAAGGAGAGGAGG + Intronic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1097170361 12:57109560-57109582 GAGACTTGAAGGAGGAGAGGTGG + Intronic
1097233489 12:57525720-57525742 AGGGTCTGAAGGTGGTGAGGAGG - Exonic
1097458754 12:59833938-59833960 GTGGCTTAAAGGAGGTAAGGAGG - Intergenic
1097984462 12:65768685-65768707 ATGGTTTTAAGGGGGTGAGGGGG + Intergenic
1098209213 12:68145126-68145148 GAGGTTCAGAGGAGGTCAGGAGG - Intergenic
1099984425 12:89646551-89646573 GAGGTTTTAAAAAGGTGATGTGG + Intronic
1100087031 12:90923950-90923972 CAGATTTGAAAGAGATGAGGAGG + Intronic
1100137079 12:91566865-91566887 GAGAAGTGAAGGAGGGGAGGAGG - Intergenic
1100396419 12:94189820-94189842 GAGGTGTCAAGGAACTGAGGTGG + Intronic
1100447453 12:94674847-94674869 GAGAACTGAAGGAAGTGAGGGGG + Intergenic
1100822243 12:98442358-98442380 GAGGCTTGAAGTAGGAAAGGAGG - Intergenic
1100822535 12:98444817-98444839 GAGGCTTGAAGTAGGAAAGGAGG - Intergenic
1100827830 12:98491334-98491356 AAGGTGGGGAGGAGGTGAGGAGG - Intronic
1102204553 12:111081653-111081675 GAAGTTAGGATGAGGTGAGGAGG + Intronic
1102709510 12:114913906-114913928 CAGGTTTGAAGGTAGTAAGGGGG - Intergenic
1102911588 12:116718791-116718813 GAGCTTTAAAGGAAATGAGGAGG - Intronic
1103325203 12:120116008-120116030 GAGGTTTAAATGAGGTAAGTCGG - Intronic
1103397463 12:120619114-120619136 GAGGGCTGAAGGAGGAAAGGAGG - Intergenic
1103586878 12:121962792-121962814 GAGACTTGAAGAAAGTGAGGGGG + Intronic
1103644157 12:122377545-122377567 GATGTTTGAAGGGGTGGAGGGGG + Exonic
1104368946 12:128204882-128204904 GAGGTTAGGAGGAGGTGACCAGG + Intergenic
1104461831 12:128962545-128962567 CAGGTATGCAGGGGGTGAGGTGG + Intronic
1104934984 12:132359773-132359795 GAGGTTAGAACGTGGTGAGACGG - Intergenic
1105241616 13:18613864-18613886 GAGATTTGAAGGAGGTGAAATGG + Intergenic
1105386260 13:19932294-19932316 GAGGTTTAGAGGAAGTCAGGAGG + Intergenic
1106090721 13:26590994-26591016 GAGATTTGAAGGAGGTGTGAGGG + Intronic
1106214268 13:27680454-27680476 GAGGGATGAAGGAGATGAGCAGG + Intergenic
1106229311 13:27809566-27809588 CAGGTGTGGAGGAGTTGAGGAGG + Intergenic
1106239722 13:27901476-27901498 AAGGTTTAACGGGGGTGAGGAGG - Intergenic
1106315509 13:28589936-28589958 GAGATTGTAAGGAGGTCAGGGGG + Intergenic
1106400127 13:29421786-29421808 GAGCCCTGGAGGAGGTGAGGTGG + Intronic
1106830980 13:33582998-33583020 GTGGATTGGAGGAGATGAGGTGG - Intergenic
1107149080 13:37091161-37091183 GAGGTGGGAAGGCGGTGGGGAGG + Intergenic
1107977316 13:45702907-45702929 GAGTTTTGAAGGAGGAGATGGGG - Intronic
1108225198 13:48282259-48282281 GAGGTTTGGAGGACATGGGGAGG - Intergenic
1109558160 13:64008753-64008775 GACGTTTCAATGAGGTGGGGGGG - Intergenic
1109701400 13:66029594-66029616 GAGTATTGAGGGAGCTGAGGGGG - Intergenic
1110234761 13:73205121-73205143 GAGGAAGGAAGCAGGTGAGGAGG + Intergenic
1110682706 13:78335159-78335181 GAGGTGGGAAGTAGGAGAGGAGG - Intergenic
1111146680 13:84191158-84191180 GTGGTTAAAAGGAGGGGAGGAGG - Intergenic
1111474552 13:88727303-88727325 GAGGGTGGAAGGAGGAAAGGAGG - Intergenic
1111759068 13:92438787-92438809 TAGGTGTGAAGGAGGAAAGGAGG + Intronic
1112615599 13:101001888-101001910 GAGATTTGAATGTGGCGAGGAGG - Intergenic
1112807654 13:103180856-103180878 GACGCTTGGAGGAGCTGAGGTGG - Intergenic
1113120490 13:106919137-106919159 GGGGTTTGGAGGAACTGAGGTGG + Intergenic
1113514386 13:110881342-110881364 GAGGTTTACAGGAGGTGAGATGG - Intronic
1113782216 13:112983157-112983179 AGGGTTTGTTGGAGGTGAGGGGG + Intronic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1114747309 14:25163581-25163603 GAGGTTAGGGGGAGGTGAAGGGG - Intergenic
1115445805 14:33488139-33488161 GAGCTCTGAAGGAGGTAAGAAGG + Intronic
1115447988 14:33513883-33513905 AAGGTTTGAGAGGGGTGAGGTGG + Intronic
1115504668 14:34081737-34081759 GAGGTCTGAGGGAGGAAAGGTGG - Intronic
1115794621 14:36920552-36920574 GATGTTTAAAGGAGATGTGGTGG - Intronic
1115846663 14:37543118-37543140 GAGGATAGAATGAGGTGAGGTGG - Intronic
1116657232 14:47667656-47667678 GAGATCTGAAGGAGGTGAGTAGG - Intronic
1117429770 14:55645115-55645137 AATATTTGAAGGAGGTGGGGAGG + Intronic
1117878468 14:60281557-60281579 GAGATTTAATGGAGGTGAAGAGG - Intronic
1117992789 14:61451356-61451378 GAAGTTAGGAGGAGGTGAGGAGG + Intronic
1118293303 14:64546290-64546312 GAGGTTGCAGGGAGCTGAGGAGG - Intergenic
1118994346 14:70822729-70822751 GAGGAAGGAAGGAGGGGAGGAGG - Intergenic
1119193620 14:72701503-72701525 TAGGTTTGAAGGAGGGCAGGGGG - Intronic
1119600645 14:75974073-75974095 GAGGTTGCAATGAGCTGAGGTGG + Intronic
1119657175 14:76425509-76425531 GGGGGAGGAAGGAGGTGAGGAGG - Intronic
1120487152 14:85128335-85128357 AAGATTTTAAGGAGATGAGGAGG - Intergenic
1121007362 14:90498966-90498988 GTGGTTGGAAGGAAGTGAGGGGG + Intergenic
1122302533 14:100739144-100739166 GAGGGTGGAAGGAGATGGGGAGG - Intergenic
1122367599 14:101203372-101203394 GGAGCTTGGAGGAGGTGAGGTGG - Intergenic
1122464042 14:101918443-101918465 GGGGGATGAAGGGGGTGAGGGGG - Intronic
1122606147 14:102948445-102948467 GGGTTTGGAGGGAGGTGAGGGGG + Intronic
1122647068 14:103201922-103201944 GAAGTTTGCAGGAGGAGAGCAGG + Intergenic
1122672909 14:103385684-103385706 GAGTGGAGAAGGAGGTGAGGGGG + Exonic
1123026851 14:105429112-105429134 GAAGGCTGAGGGAGGTGAGGAGG - Intronic
1123489733 15:20771285-20771307 GAGATTTGAAGGAGGTGAAATGG - Intergenic
1123546232 15:21340372-21340394 GAGATTTGAAGGAGGTGAAATGG - Intergenic
1123987705 15:25659553-25659575 CAGCTTTGAATGAGGGGAGGTGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124649477 15:31464437-31464459 GAGTTCTGGAGGAGGAGAGGCGG - Intergenic
1124890317 15:33726312-33726334 GAGGTTTGGAGGTGGGGTGGAGG + Intronic
1124893423 15:33754515-33754537 AAGGCTTGAAGGAGATGAGGAGG - Intronic
1125241047 15:37576279-37576301 GAGATTTGAAGGGGGTTAGGGGG - Intergenic
1125677296 15:41509263-41509285 TGGGAGTGAAGGAGGTGAGGAGG + Intronic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1126565106 15:50088541-50088563 CAGATTTGAAAGAAGTGAGGCGG - Intronic
1126840547 15:52713695-52713717 GAGGCTTGGAGGAGGTGAGTGGG - Intergenic
1128377549 15:67088314-67088336 TTGGGTTGGAGGAGGTGAGGTGG + Intronic
1128614196 15:69096576-69096598 GAGGTTAGGAGGAGGAGGGGAGG + Intergenic
1129426436 15:75466868-75466890 GAGGTTTGAATGAGGCAGGGTGG + Exonic
1129644869 15:77420338-77420360 GAGGTTGGAAGGCAGAGAGGAGG - Intergenic
1130196179 15:81782266-81782288 GGGTTTTGAAGGAGCTGAGTCGG + Intergenic
1131002879 15:88952461-88952483 AAGATTTGATGAAGGTGAGGAGG - Intergenic
1131686033 15:94768504-94768526 GAGGGTGGAAGGAGAGGAGGGGG + Intergenic
1132107145 15:99071199-99071221 GGGGTGTGGAGCAGGTGAGGAGG + Intergenic
1202954559 15_KI270727v1_random:67588-67610 GAGATTTGAAGGAGGTGAAATGG - Intergenic
1133237131 16:4392597-4392619 GAGGTTGGATGGAGGGCAGGCGG + Intronic
1133459100 16:5971414-5971436 GAGGTTTCAAGGATGAAAGGAGG + Intergenic
1133530780 16:6653143-6653165 AAGGCTTGAAGGAAGTTAGGGGG - Intronic
1133562182 16:6960570-6960592 GAGTTTGGAAGGAGGTAAGAAGG - Intronic
1135042826 16:19131064-19131086 GAGCTTTGAAGGAGGGGTTGGGG - Intronic
1135122796 16:19781031-19781053 GAGGTTTGAAAAGGGTGGGGAGG + Intronic
1135481826 16:22827088-22827110 ATGATCTGAAGGAGGTGAGGAGG + Intronic
1135485575 16:22861898-22861920 CAGGTTTGAATGATGAGAGGAGG - Intronic
1136408506 16:30063691-30063713 GAGGGTTGAGGGAGGTGGGATGG - Intronic
1136417846 16:30114328-30114350 GGGGTTTGAATGAGATGAGGGGG + Exonic
1137704881 16:50528090-50528112 GAGGTTTCAGTGAGCTGAGGTGG - Intergenic
1137757404 16:50913555-50913577 GCTGCTGGAAGGAGGTGAGGGGG + Intergenic
1138399530 16:56734254-56734276 GAGATTTGAAGGAATTAAGGGGG + Intronic
1138455438 16:57118036-57118058 AAGGCTTGATGGAGGTGAGAGGG - Intronic
1138546997 16:57725836-57725858 GAGTCTTGAAGGAGCTGAGGAGG + Intronic
1138606937 16:58095572-58095594 TAGGTGAGAAGGAGGTGGGGTGG - Intergenic
1139854715 16:69971126-69971148 GAGGTTTAAATGAGAAGAGGAGG - Intergenic
1141027387 16:80561096-80561118 GAGGGTTGGAGGAGGTGTAGGGG - Intergenic
1141149307 16:81553041-81553063 GAGGAGTTAGGGAGGTGAGGTGG + Intronic
1141181256 16:81754425-81754447 GAGGTGGGGAGGAGGTGGGGAGG - Intronic
1141427814 16:83955087-83955109 GAGGATCAAAGGAGGTGATGCGG + Intronic
1141596574 16:85100565-85100587 GAGGTTTGATGCAGGTCAGAGGG - Intronic
1141620685 16:85235343-85235365 GAGGTGGGAGGGGGGTGAGGGGG - Intergenic
1141977942 16:87530135-87530157 GAGGTTTCAGTGAGGTGAGATGG + Intergenic
1142348832 16:89570720-89570742 GGGGATTGGAGGAGGTGAGCGGG + Intergenic
1142409236 16:89907827-89907849 GAGGGAGGAGGGAGGTGAGGTGG - Intronic
1143172899 17:4940323-4940345 GAGATTTGAAGGAGCGGCGGAGG + Exonic
1143635546 17:8162294-8162316 GAGGTTTGGAGGGGGTGCAGGGG + Exonic
1143918412 17:10311855-10311877 GGGGTTGGCAGGAGGAGAGGGGG + Intronic
1144147683 17:12414072-12414094 GAGGTTTGAGGCTGGTCAGGAGG + Intergenic
1146372713 17:32275421-32275443 GAGGTCGGAAGGAGGAGAAGGGG + Intronic
1148077326 17:44945839-44945861 GAGGTTGCAGGGAGCTGAGGTGG + Intronic
1149662510 17:58342310-58342332 GCAGATTGAGGGAGGTGAGGAGG + Intergenic
1149865383 17:60148651-60148673 GAGGCAGGAGGGAGGTGAGGGGG - Intergenic
1149910334 17:60560656-60560678 GAGGATGGAAGGAGGTGAGTGGG - Intergenic
1150298077 17:64025480-64025502 GGGGTCTGAAGGGGGTGAGAGGG - Intergenic
1151246464 17:72798731-72798753 TAGGTTTAGATGAGGTGAGGAGG - Intronic
1151311170 17:73293260-73293282 GAGGAATGAAGGAGGGGAGCTGG + Intronic
1152850292 17:82629957-82629979 TAGGGTGGGAGGAGGTGAGGAGG - Intronic
1152976559 18:226495-226517 GAGGTCTGAGGGAGGTGAGAAGG + Intronic
1153759018 18:8312288-8312310 GGGGTTTGGGGGAGGTGAGCTGG - Intronic
1154447342 18:14446042-14446064 GAGATTTGAAGGAGGTGAAATGG - Intergenic
1154988929 18:21581544-21581566 GAGGTTGCAATGAGGTGAGATGG + Intronic
1155923661 18:31630742-31630764 GAGGTTTGAATGTGGTGTGGTGG - Intronic
1156370226 18:36466323-36466345 GAGGTTTGCAGCAGGAGAAGGGG + Intronic
1158254484 18:55530530-55530552 GGGCTCTGAAGGAGGGGAGGTGG + Intronic
1158305800 18:56103852-56103874 GAGGAGGGAAGGAGGGGAGGGGG + Intergenic
1160400073 18:78603769-78603791 GAGGTCTGAGGGAGGTGCAGCGG - Intergenic
1160971134 19:1768262-1768284 GAGACTAGAAGGAGCTGAGGGGG + Intronic
1161113067 19:2480331-2480353 GAGGCTTGGGGGAGGTGGGGAGG + Intergenic
1161498002 19:4597962-4597984 GAGGGGTGAGGGAGGAGAGGGGG + Intergenic
1162217382 19:9147830-9147852 GAGATTTGGAGGGGGGGAGGGGG - Intronic
1162342309 19:10098849-10098871 CAGGGTGCAAGGAGGTGAGGTGG + Intronic
1163061221 19:14763724-14763746 GAGGAATGGAGGAGGAGAGGAGG - Intronic
1163759914 19:19130569-19130591 GGGATGTGAAGTAGGTGAGGTGG - Intronic
1163819505 19:19487901-19487923 TAGGCCTGAAAGAGGTGAGGAGG + Intronic
1163863055 19:19752333-19752355 GAGGAATGATGGAGGTGCGGGGG + Intergenic
1163911893 19:20203027-20203049 GAGGTTGCAGGGAGGTGAGATGG + Intergenic
1164626027 19:29728665-29728687 GAGGGCTGGAGGAGCTGAGGAGG - Intergenic
1164996830 19:32726691-32726713 GAGGATTGCTTGAGGTGAGGTGG + Intronic
1165420651 19:35720576-35720598 GAGGGGTGGAGGAGGTGAAGGGG - Exonic
1165542108 19:36500300-36500322 GAGGTTTGGAGGTGCTGAGAAGG - Intergenic
1166043098 19:40214938-40214960 GAGGTTCAGAGGAGGTGAGTGGG - Intronic
1166136326 19:40779125-40779147 GAGGGTGGTAGGAGGTGAAGAGG + Intronic
1166356520 19:42230512-42230534 GAGGTCTGGGGGAGGGGAGGGGG + Exonic
1166471736 19:43084091-43084113 GAGGATGGAGGGAGGTCAGGAGG + Intronic
1167154194 19:47728356-47728378 GAGTCTTGAAAGGGGTGAGGAGG - Intronic
1167278837 19:48554502-48554524 GAGGTTGGGGGGAGATGAGGAGG - Intronic
1167323502 19:48810800-48810822 GAGGCTTTAATGGGGTGAGGGGG - Intronic
1168357788 19:55713153-55713175 GGGATTTGAAGGTGGGGAGGAGG - Intronic
1168476270 19:56677660-56677682 GAGGTTTTGAGGAGGTGATTTGG - Intergenic
925019829 2:559544-559566 GAGATTTGAAGGAGGGGAAATGG + Intergenic
925204590 2:1995584-1995606 GAGGACTGAAGGAAGTGAGTGGG + Intronic
925675561 2:6357821-6357843 GAGGGCTTAAGGAGGTGATGAGG + Intergenic
925720442 2:6821538-6821560 GAGGCCTGCAGGAGCTGAGGGGG - Intergenic
926141368 2:10370488-10370510 GAGGCTTCAAGGAGCAGAGGAGG + Intronic
927196229 2:20549144-20549166 GAGGCTGGAAGGAGGTGATGAGG - Intergenic
927630812 2:24772420-24772442 GAGGTTTGCAGGTGATGAGGAGG + Intergenic
927836307 2:26401938-26401960 GAGGTCTGGAGGTGGTGCGGAGG + Exonic
928616081 2:33040843-33040865 GAGGTCTGAGGGAGGTTTGGTGG + Intronic
928755799 2:34524515-34524537 CAGGAATGAAGGGGGTGAGGGGG - Intergenic
928800613 2:35086176-35086198 GAGAGTTGTAGGAGGCGAGGTGG - Intergenic
929083430 2:38144798-38144820 CAGGTTTGGAGGAGGTGATGAGG - Intergenic
929363292 2:41121299-41121321 TTGGTTTGAAGGTGGGGAGGGGG - Intergenic
930705856 2:54504177-54504199 CAGGTTGGAAGGAGGGGAGGTGG - Intronic
931197248 2:60064340-60064362 GAGGGGTGGAGGAGGAGAGGAGG + Intergenic
931568376 2:63640957-63640979 AAGGTTAGTAGGAGGTTAGGAGG - Intronic
932354559 2:71058375-71058397 GGGGTTTGAAGGTGGAGAGGGGG + Intergenic
932628512 2:73318433-73318455 GAGAAGTGAGGGAGGTGAGGAGG - Intergenic
932698618 2:73977867-73977889 GAGATTGGAAGGAGGCCAGGAGG + Intergenic
933724270 2:85417909-85417931 GAGTTTGGGAGGGGGTGAGGAGG - Intronic
933767558 2:85720428-85720450 GAGATATAAAGGAGGTGAGGGGG + Intergenic
933909909 2:86930382-86930404 GGGGCTTGAAGGTGCTGAGGAGG + Intronic
934022817 2:87973006-87973028 GGGGCTTGAAGGTGCTGAGGAGG - Intergenic
934113222 2:88761572-88761594 TAGGTTTGGAGGAGTTGACGTGG - Intergenic
935250891 2:101259470-101259492 GAGTTCTGAAGGAGTAGAGGAGG + Intronic
935438056 2:103058140-103058162 GAGGTTTTAAGGAGTTGATGAGG + Intergenic
936410337 2:112252762-112252784 GGGACCTGAAGGAGGTGAGGGGG - Intronic
936523735 2:113228803-113228825 GAGGTATGAAGGACCTGGGGGGG - Intronic
936611700 2:114008188-114008210 AAAGGCTGAAGGAGGTGAGGGGG + Intergenic
937083337 2:119155989-119156011 GGGGTTGGGAGGAGGGGAGGAGG - Intergenic
938482741 2:131674828-131674850 GCGATTTGAAGGAGGTGAAATGG + Intergenic
938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG + Intergenic
939369716 2:141283428-141283450 GAGGTGGGGAGGTGGTGAGGTGG + Intronic
939975759 2:148715507-148715529 CAGGTTTGTTGGAGGTCAGGTGG + Intronic
940292769 2:152093863-152093885 GAGTTTTGGGGGAGGTTAGGAGG + Intronic
941442439 2:165555065-165555087 AAGACCTGAAGGAGGTGAGGAGG - Intronic
941576787 2:167242758-167242780 GAAGTTTGAAGTACGTCAGGTGG - Exonic
941588100 2:167384813-167384835 GAGGTTTTAAACAGGTGAGAGGG - Intergenic
942004220 2:171681376-171681398 GAGGTTGGAAACAGGGGAGGAGG + Intergenic
944323779 2:198379138-198379160 GATGTCTGAATAAGGTGAGGGGG - Intronic
944909033 2:204291117-204291139 AAGGTTTGAGGGAGGTGAGAAGG + Intergenic
945121639 2:206463311-206463333 GAGGTTTGAGTGATGCGAGGAGG + Intronic
945992244 2:216405836-216405858 GAGACCTGAAGGAGGAGAGGAGG - Intergenic
945997192 2:216447586-216447608 GAGGGAAGAAGTAGGTGAGGGGG + Intronic
946153602 2:217792692-217792714 GAGGGTTGGGGGAGGTGGGGAGG - Intergenic
946373441 2:219294521-219294543 GAGGGATGAAGGAGGGGAGACGG + Intronic
947420384 2:229937183-229937205 TGGTTTTTAAGGAGGTGAGGTGG - Intronic
947527305 2:230886532-230886554 GAGCTTTGAAGGTGGGGAAGAGG + Intergenic
948301379 2:236909650-236909672 GAGATTTGAGGGAGACGAGGTGG + Intergenic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948815333 2:240507503-240507525 GGGGTTTGAGGGTGGTGGGGTGG - Intronic
948855219 2:240727209-240727231 GAGGCTGGAAGGAGAGGAGGCGG + Intronic
949060000 2:241951261-241951283 GAGGTTTGTTGCAGGTGATGGGG + Intergenic
1168771174 20:417869-417891 GAGGGTTGAGGGAGGTGTTGCGG - Exonic
1169155724 20:3328033-3328055 GATGTTTGAATCAGCTGAGGAGG - Intronic
1169433101 20:5557117-5557139 GAGGGTTGAAGGTGGTGGGGTGG + Intronic
1169581312 20:7026355-7026377 GAGTGTTGGAGGAGGGGAGGTGG + Intergenic
1169867953 20:10219890-10219912 AAGCTATGCAGGAGGTGAGGAGG - Intronic
1170261556 20:14414227-14414249 CAGGTTTGGAGCAGGTCAGGGGG - Intronic
1170868065 20:20177855-20177877 AAGACCTGAAGGAGGTGAGGAGG + Intronic
1171428158 20:25061407-25061429 GACACCTGAAGGAGGTGAGGGGG - Intergenic
1172026913 20:31954826-31954848 GAAGTGTGGAGGAGATGAGGGGG + Intergenic
1172212573 20:33211377-33211399 GAGGTTGGAACAAGCTGAGGAGG - Intergenic
1172293057 20:33789861-33789883 GAGGTGTGGACGAGGTGTGGAGG + Intronic
1172332694 20:34086638-34086660 GGGCTTTGTAGCAGGTGAGGTGG - Intronic
1173104691 20:40122789-40122811 GAAGATTGAATGAGGGGAGGGGG - Intergenic
1173555250 20:43961264-43961286 GAGGTCTGGATGAGGTGTGGGGG + Intronic
1173810487 20:45952345-45952367 GCTGGTTGCAGGAGGTGAGGAGG + Exonic
1173856693 20:46254863-46254885 GAGGTTGGAATGAGCTGAGATGG + Intronic
1174058566 20:47816516-47816538 GATGTTGGAATGAGATGAGGAGG - Intergenic
1174217932 20:48931630-48931652 GAGATCTGAAGGAAGTGAGGGGG + Intronic
1174322608 20:49753908-49753930 GAGGTTTCAGTGAGCTGAGGTGG - Intergenic
1175160347 20:57003558-57003580 GAGGTTTGGAGGAGGGGAGGAGG + Intergenic
1175412053 20:58776922-58776944 GAGGCTTGGAGGAGATGAAGTGG - Intergenic
1175899041 20:62352807-62352829 TAGGCTGGCAGGAGGTGAGGTGG + Intronic
1176448851 21:6844621-6844643 GAGATTTGAAGGAGGTGAAATGG + Intergenic
1176827021 21:13709644-13709666 GAGATTTGAAGGAGGTGAAATGG + Intergenic
1177536623 21:22436589-22436611 GAAGTGTGAAGGAGTTGAGGAGG - Intergenic
1177643375 21:23872179-23872201 GAGGGTAGAAGGTGGTGAGGGGG + Intergenic
1178269879 21:31179651-31179673 GCGGTCTGAAGGAGGTAACGTGG + Intronic
1178952894 21:36999635-36999657 CAGACCTGAAGGAGGTGAGGTGG + Intergenic
1179937988 21:44617109-44617131 GGGGTGTGGAGGAGGTGAGCTGG - Intronic
1181483817 22:23218270-23218292 GAGGATTGCAGGAGGTGACCCGG + Intronic
1181859676 22:25808584-25808606 GAGATTAGATGGAGCTGAGGAGG - Intronic
1181997917 22:26897641-26897663 GAGGCTGGTGGGAGGTGAGGGGG + Intergenic
1182073491 22:27479188-27479210 GAGGCTTGAAAGAGGTGGAGGGG - Intergenic
1183086301 22:35489332-35489354 GAGCCTGGAAGGAGGTGGGGCGG + Intergenic
1183292198 22:37009782-37009804 GAGTCTTGAAGGAGGTGAAGAGG - Intergenic
1183354542 22:37351151-37351173 GAGGGGAGAAGGAGGAGAGGAGG - Intergenic
1183508031 22:38220207-38220229 GAGGTGTGGAGGGGGAGAGGAGG + Exonic
1183513048 22:38247028-38247050 GAGGTTTGAAGGTGGTCCAGTGG - Intronic
1183584045 22:38741838-38741860 GAGGCTTAGAGAAGGTGAGGAGG + Intronic
1183642683 22:39101687-39101709 GAGGTTGGCAGGGGGTGGGGGGG + Intronic
1183713829 22:39522011-39522033 GAGGTTGTAAGAAGGTGAAGGGG - Exonic
1183899047 22:40991356-40991378 GAGGTTTGAGGAAGGAGAGAGGG - Intergenic
1183934217 22:41252950-41252972 GACGTCTGCAGGAGGTGGGGAGG + Exonic
1185376570 22:50485359-50485381 AAGGTGTGAAGGAAGAGAGGAGG - Exonic
949313049 3:2721720-2721742 AAGACTTGAAGGAGGTGAGCAGG - Intronic
951553461 3:23897701-23897723 GATATTTGAAGGAGGTAAGGAGG - Intronic
953205180 3:40820834-40820856 GAGGTTGCAAGGAGCTGAGATGG + Intergenic
953695044 3:45151409-45151431 GAGGTATGTAGGAGGTTTGGAGG - Intergenic
953723062 3:45373185-45373207 GAGGTAGGAAGGGGGTGAGGAGG + Intergenic
954087978 3:48261304-48261326 AAGGCTTGAAGGAGGTGAGGAGG + Intronic
955298821 3:57757443-57757465 GCGTTTTAAAGGAGGTGATGGGG + Exonic
955609948 3:60746328-60746350 GATAATTGAAGGAGGTGGGGTGG + Intronic
956884538 3:73545879-73545901 GGGGTTGGTGGGAGGTGAGGGGG + Intronic
956889641 3:73599408-73599430 GTGGTTTCTAGGAGTTGAGGTGG + Intronic
957211271 3:77261640-77261662 CATGTGTGCAGGAGGTGAGGGGG + Intronic
958478563 3:94617178-94617200 GCTGATTGTAGGAGGTGAGGAGG + Intergenic
959021338 3:101190764-101190786 GAGGTTTGGAGGAGGTAAAGAGG + Intergenic
960231659 3:115235126-115235148 GAGGTTTGTAGGAGGTAAAATGG + Intergenic
960358710 3:116684549-116684571 GAGGTTGCAATGAGCTGAGGTGG - Intronic
961336455 3:126182766-126182788 GAGGTATGGAGCAGGAGAGGAGG + Intronic
962383467 3:134914793-134914815 TAGGTTTGAAGGACATGGGGAGG + Intronic
962831876 3:139149677-139149699 GAGACTTTAAGGAAGTGAGGGGG + Intronic
963018249 3:140846211-140846233 GAGATATGAAAGTGGTGAGGAGG + Intergenic
963308329 3:143679037-143679059 GGGGTGGGAAAGAGGTGAGGGGG + Intronic
963589101 3:147234070-147234092 GAGGATTAAAGTAGGCGAGGTGG + Intergenic
963810665 3:149773397-149773419 GAGGATCGAGGCAGGTGAGGGGG - Intronic
963971009 3:151429455-151429477 GAGGGTTGGAGGAGGAGAGAAGG + Intronic
964092642 3:152894394-152894416 GGGGTTTGGAGGAGGTGATTTGG + Intergenic
964211994 3:154238989-154239011 GAGGATTAGAGGAGGTGAGTTGG + Intronic
964585971 3:158302512-158302534 AAGGGTTGAAGGAGTGGAGGTGG + Intronic
965513628 3:169596998-169597020 GGGGTTGGAAGGAGGTGAAGAGG + Intronic
965796224 3:172441507-172441529 TGAGTTTGAAGCAGGTGAGGGGG - Intergenic
967558706 3:190892936-190892958 GTGTTTGGAAGGAGGTGAAGGGG + Intergenic
968132423 3:196199292-196199314 GAGTTTGGGAGGGGGTGAGGTGG - Intronic
968948584 4:3678569-3678591 GAGGAGTTGAGGAGGTGAGGAGG + Intergenic
968960516 4:3740920-3740942 GAGGGATGAAGCAGGGGAGGAGG + Intergenic
969402953 4:6968966-6968988 GTGGTTTGTTGGGGGTGAGGCGG + Intronic
969424353 4:7115580-7115602 GAGGTGAGGAGGAGGTGAGGTGG + Intergenic
969424356 4:7115591-7115613 GAGGTGAGGTGGAGGTGAGGAGG + Intergenic
969424359 4:7115602-7115624 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424362 4:7115613-7115635 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424364 4:7115624-7115646 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424370 4:7115646-7115668 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424373 4:7115657-7115679 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424375 4:7115668-7115690 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424381 4:7115690-7115712 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424384 4:7115701-7115723 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424386 4:7115712-7115734 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424392 4:7115734-7115756 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
970536731 4:17037680-17037702 GAGAGATGAAGGAGGAGAGGTGG + Intergenic
971169606 4:24219647-24219669 CATGTTTGGAGGAGGGGAGGAGG - Intergenic
972349319 4:38222051-38222073 CAGGTTTGAAGGAGTTGGTGGGG + Intergenic
972478738 4:39477905-39477927 GAGGTTGCAATGAGCTGAGGTGG + Intergenic
972547773 4:40096860-40096882 CAGGTTTGAAGGGGGTGATGAGG + Intronic
973207189 4:47574175-47574197 GGAGTTAAAAGGAGGTGAGGAGG - Intronic
973628613 4:52797528-52797550 GAGGGATGAGGGAAGTGAGGAGG + Intergenic
973946237 4:55958993-55959015 GAGGATTGATGGAGCTGTGGAGG + Intronic
974349475 4:60725506-60725528 GAAGTTTGAAGCAGATGATGAGG - Intergenic
974362410 4:60899349-60899371 GAGGTTTGAAGGAGGGCGGGAGG - Intergenic
976263674 4:83170266-83170288 GAGTTTTGAAGACGGTGAAGGGG - Intergenic
976753370 4:88473301-88473323 GAGGGAGGAAGGAGGGGAGGAGG - Intronic
977449374 4:97175508-97175530 GGTCTTTGAAGGAGGAGAGGGGG + Intergenic
977919218 4:102625183-102625205 GAGGAAGGAGGGAGGTGAGGAGG - Intergenic
980050085 4:128030789-128030811 GAGATTTGTGGGAGGTGAGGAGG - Exonic
980211666 4:129796251-129796273 GAGATTTGAAAGAGATGAAGTGG + Intergenic
981004090 4:139857360-139857382 CAGGTTTGAAGGGGGTGGGGTGG - Intronic
981212782 4:142128779-142128801 GATGTGTGGAGGAGGTGAGGGGG - Intronic
983018633 4:162646827-162646849 GATTGTTGAGGGAGGTGAGGAGG - Intergenic
983191572 4:164759970-164759992 AAGGCTTGAAGGAGGTAAGAGGG + Intergenic
983528139 4:168781571-168781593 GAGATTTGAGGGAGGTGAACAGG + Intronic
984975848 4:185229382-185229404 GAGGGTTGCTGGAGGTGAGGAGG + Intronic
986268196 5:6208613-6208635 GAGGCTAGAAGAAGGTGAGCAGG - Intergenic
987705077 5:21452734-21452756 AAGGTTACAAGGAGGAGAGGAGG - Intergenic
988908133 5:35810891-35810913 GAGGTGTGGAGGACTTGAGGAGG - Intronic
989396561 5:40963457-40963479 GAGGTTTGAGGGAAATGGGGAGG - Intronic
990004599 5:50931386-50931408 GAAGTTTGAAGGTGGGGATGGGG + Intergenic
990737608 5:58880993-58881015 GAAGTTTGGAGGAGGAGAGCAGG - Intergenic
991057528 5:62335669-62335691 GAGGTGAAAAGGTGGTGAGGAGG - Intronic
991372704 5:65936149-65936171 GAGGTCTGATGGAGGGGGGGTGG + Intronic
991494489 5:67214215-67214237 AAGGCCTGAAGGAGCTGAGGAGG + Intergenic
992554335 5:77888767-77888789 GAGGTTGCAATGAGCTGAGGAGG - Intergenic
992557263 5:77915984-77916006 GAGGCTTGAGGGAAGTGAAGTGG + Intergenic
992674516 5:79092329-79092351 GGGGATTGAGGGAGGTGGGGAGG - Intronic
992901093 5:81297264-81297286 GAGGGATCAGGGAGGTGAGGAGG - Intergenic
993166068 5:84356523-84356545 GAGATTTGAAGGAGATGTGATGG - Intronic
993515400 5:88827269-88827291 GAGATTTGTAGGAGGGAAGGAGG - Intronic
993664117 5:90673716-90673738 GGGGTTTTCAGGAGGTGATGAGG - Intronic
994163879 5:96587354-96587376 TAGGATTGAAGGTGGTTAGGTGG + Intronic
996381085 5:122863243-122863265 GGGACCTGAAGGAGGTGAGGGGG + Intronic
997264433 5:132486890-132486912 GAGGGTAGAAGGAGGTCAGCTGG - Intronic
997894559 5:137704515-137704537 GAGGTTTGGAGTTGGTGATGTGG - Intronic
998167131 5:139850627-139850649 GGGGTCTGTAGGAGGTGAGCAGG - Intronic
998726183 5:145017322-145017344 GAGGATTGAGGGAGCTCAGGAGG - Intergenic
998822184 5:146067095-146067117 GAAGGGTGGAGGAGGTGAGGCGG - Intronic
999279411 5:150355229-150355251 GTGGTTTGATTGAGGAGAGGAGG - Intergenic
999527391 5:152422410-152422432 GAGTTATCAAGGAGGTGAGAGGG + Intronic
1001031819 5:168268820-168268842 GAGGTTTGTTGGAGGGAAGGAGG + Intergenic
1001068459 5:168560338-168560360 GAGGTTTGAAGGAGGTGAGGGGG - Intronic
1001518299 5:172372799-172372821 GAGGTTTGAAGGGGTTGATGAGG - Intronic
1001890428 5:175333657-175333679 GAGGTTGCAATGAGCTGAGGTGG + Intergenic
1001913112 5:175537277-175537299 GAGGTGTGAAGGAGGGCAGAGGG - Intergenic
1002777560 6:341829-341851 GGCGTGTGAAGGAGCTGAGGAGG - Intronic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1003020411 6:2504752-2504774 GGGGTGTGGAGGAGATGAGGGGG - Intergenic
1003020419 6:2504773-2504795 GGGGTGTGGAGGAGATGAGGAGG - Intergenic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1003879284 6:10465694-10465716 GAGGTCTGAATGAGGGGAGGAGG + Intergenic
1004239118 6:13902682-13902704 GAGGATTGATGGAGCTCAGGAGG + Intergenic
1004356621 6:14934797-14934819 GGGGTTTGTGGGAGGTGTGGTGG - Intergenic
1004395337 6:15242950-15242972 GAGTTTTGAAGTAGGTGTAGGGG - Intergenic
1005108367 6:22250535-22250557 GATTTTTGAAGGGGATGAGGGGG - Intergenic
1005175181 6:23036547-23036569 GAGGCTTGAAGAAGATGCGGAGG + Intergenic
1005417705 6:25619338-25619360 AAGGTTTGGGGGAGGGGAGGGGG - Intronic
1005953430 6:30647518-30647540 CAGGTTTGAGGGCGGTCAGGCGG + Exonic
1006333575 6:33409454-33409476 TAGGTTTGGAGGAGGTGAAAAGG - Intronic
1007698581 6:43749880-43749902 GAGATCTGAAGGAAATGAGGGGG - Intergenic
1008194245 6:48498610-48498632 GAGAGTAGAAGCAGGTGAGGTGG - Intergenic
1008693025 6:54002206-54002228 GAGTTTTGAAAGAGATGAAGAGG - Intronic
1008920543 6:56839869-56839891 GCAGTTTGCAGGGGGTGAGGGGG + Intronic
1009411331 6:63368501-63368523 GAGGCTTGAAGGAGGGGAAGTGG - Intergenic
1009898226 6:69779452-69779474 GATGTTTGAGGGAGGGAAGGAGG + Intronic
1011499947 6:87976972-87976994 GAGGTGAGGAGGAGGTGAGGTGG - Intergenic
1012306542 6:97665577-97665599 GAGGTTAAGAGGCGGTGAGGAGG - Intergenic
1012416210 6:99016814-99016836 AAGACTTGAAGGAGGTGAAGGGG - Intergenic
1013064397 6:106669639-106669661 GATGTTTGAAGAAAGGGAGGGGG - Intergenic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1013489710 6:110634279-110634301 GAGGTTGCAGGGAGCTGAGGTGG - Intronic
1017117447 6:150991873-150991895 GAGCCTTGAAGAAGGTGAGAGGG + Intronic
1017260366 6:152378738-152378760 GAGGTGGGAAGGAGGGCAGGGGG - Intronic
1017488211 6:154921989-154922011 GAGAGTTGAATGAGGTGGGGTGG + Intronic
1018650148 6:165986292-165986314 GGGGTTGGATGGAGGGGAGGGGG + Intronic
1018839916 6:167509223-167509245 AGTGTGTGAAGGAGGTGAGGGGG - Intergenic
1019106150 6:169668538-169668560 GAGGTTTTAGGGACTTGAGGAGG - Intronic
1019223479 6:170493196-170493218 GAGAGGAGAAGGAGGTGAGGAGG + Intergenic
1019847377 7:3519133-3519155 GAGGGTTGAAGGAAGAGTGGGGG + Intronic
1021007391 7:15415476-15415498 GAGGTTTCAGGGAGCTGAGATGG + Intronic
1021384773 7:20015833-20015855 GAGGTTTGACTAAGGTGAAGAGG - Intergenic
1021612404 7:22471070-22471092 GAAGTTTGAAGAAGGAAAGGGGG - Intronic
1022227938 7:28382744-28382766 GTGGTTTGATGGGGGTGAGGGGG - Intronic
1022664262 7:32395472-32395494 TAGGATAGAAGGTGGTGAGGTGG + Intergenic
1022806244 7:33825272-33825294 GAGATTGGGAGGAGGTGAGCAGG + Intergenic
1022861308 7:34369739-34369761 GAGGGTTGCAGGAGGCGGGGTGG + Intergenic
1025117193 7:56268428-56268450 GAGGTGGGAAGGAGGAAAGGAGG - Intergenic
1025117198 7:56268444-56268466 GAGGAAGGAAGGAGGGGAGGTGG - Intergenic
1028937899 7:96486454-96486476 CAGGCTGGCAGGAGGTGAGGAGG + Intronic
1029344788 7:99970723-99970745 GATGTTTCAAGGATGTGGGGTGG - Intronic
1029370993 7:100150491-100150513 AAGGTTTGAGGGAAGAGAGGAGG + Intronic
1029432252 7:100539075-100539097 GAGGCCTGAAGGCGGTGGGGCGG + Intergenic
1029734217 7:102456609-102456631 GAGGGTTGGGGGATGTGAGGAGG - Exonic
1030896821 7:115070930-115070952 GAGGTTTGAAAGAGAGGAGAAGG - Intergenic
1031084218 7:117286468-117286490 GGGGGGAGAAGGAGGTGAGGAGG - Intronic
1031124939 7:117762974-117762996 AAGGCTTGAAGGAGGTGAACAGG - Intronic
1032412325 7:131705172-131705194 GGGGTTGGAAGGTGCTGAGGTGG + Intergenic
1033021096 7:137725043-137725065 GAGGTGAGAAGGGGATGAGGTGG + Intronic
1034155380 7:148952073-148952095 GAAGACTGGAGGAGGTGAGGAGG + Intergenic
1034273501 7:149814390-149814412 TAGCTTGGAGGGAGGTGAGGAGG + Intergenic
1034449731 7:151130853-151130875 GGGAGATGAAGGAGGTGAGGTGG - Intronic
1034701186 7:153097865-153097887 GACGTTTGATGGAGGAGAAGCGG + Intergenic
1035103469 7:156420689-156420711 GAGGTTTGAAGGGGGAGGTGGGG + Intergenic
1035214460 7:157354894-157354916 CAGGTATGTAGGAGGTGGGGAGG + Intronic
1035421085 7:158729537-158729559 GAGGGTTGGAGCAGGTGTGGAGG + Intergenic
1036686504 8:10914962-10914984 GAGATGTGCAGGAGGGGAGGCGG - Intronic
1037420660 8:18698493-18698515 GAGGTTTGAAGGTGGAGAAAGGG + Intronic
1038461324 8:27719815-27719837 GAGGTCTCAAAGAAGTGAGGAGG - Intergenic
1038981932 8:32769283-32769305 CGTGTGTGAAGGAGGTGAGGTGG + Intergenic
1039370017 8:36974802-36974824 AATGTTTGAAGTAGGTGTGGTGG + Intergenic
1039400256 8:37263086-37263108 GTGGTTTGAGGGAGCTGGGGAGG + Intergenic
1039819295 8:41122138-41122160 AGGGTTTGAAGGAGGTGGGCGGG + Intergenic
1040462462 8:47662072-47662094 GAGGTTCGGAGGAGGTGAGTAGG - Intronic
1041540680 8:58981619-58981641 AATGTTTGGAAGAGGTGAGGTGG - Intronic
1041876357 8:62691751-62691773 CAGGTTTCATGGAAGTGAGGAGG + Intronic
1042014070 8:64286958-64286980 GAGGTTTCAAGGAGAGTAGGAGG + Intergenic
1042298821 8:67252839-67252861 GATGATTGGAGGAGGTGGGGAGG - Intronic
1042825920 8:72979145-72979167 GTGGTTTGACTGAGGGGAGGAGG - Intergenic
1043745143 8:83865947-83865969 GAGATCTGAAGGAAGTGAGGAGG + Intergenic
1043823636 8:84898859-84898881 GAGGTTTGCAGGAGTTGTGGAGG - Intronic
1044108677 8:88244231-88244253 GTTGTTTGAAGTAGGTAAGGTGG - Intronic
1044838429 8:96317307-96317329 GTGGCTAGGAGGAGGTGAGGGGG - Intronic
1044847696 8:96398267-96398289 GAGGGTTGCAGGAAGTGGGGAGG + Intergenic
1045749940 8:105471625-105471647 GGGGTTTGAGGGTGGTGAGTTGG + Intronic
1045756565 8:105550206-105550228 GAGTTTTGAAGGAGGTAAGGTGG - Intronic
1047016186 8:120725645-120725667 GAGGATTGAAGGAAATGAGTTGG + Intronic
1047184414 8:122618995-122619017 AAGGTTTGAAGGAGAAGTGGGGG + Intergenic
1047235710 8:123040338-123040360 GAGATCTGAAGAAGGTTAGGAGG + Intronic
1047925530 8:129679176-129679198 GAGGCTCTAGGGAGGTGAGGTGG + Intergenic
1048072779 8:131039844-131039866 GAGATTTGAAGGAGTTGCGCAGG + Exonic
1048100384 8:131344254-131344276 GATGTTGGAAGGAGGTGTGATGG - Intergenic
1048822688 8:138394344-138394366 GGGGATTGAAGGAGATGATGTGG - Intronic
1049042747 8:140124743-140124765 GAAGTCTGAAGGCAGTGAGGTGG + Intronic
1049140187 8:140947526-140947548 GAGGATTTTAGGAGGTGGGGTGG - Intronic
1049575083 8:143386188-143386210 GAGGCTGGGAGGGGGTGAGGAGG - Intergenic
1049665631 8:143841340-143841362 GGGGCTTCGAGGAGGTGAGGCGG - Intergenic
1050024568 9:1320571-1320593 GAAGTTTGCAGGAGGGGAAGGGG - Intergenic
1053174984 9:35916123-35916145 GAGGGTTGGAGGTGGTGGGGAGG - Intergenic
1053199104 9:36140725-36140747 GAGATTTGGAGCAGGGGAGGGGG + Intronic
1053329187 9:37188546-37188568 GAGGGTAGGGGGAGGTGAGGGGG - Intronic
1056213728 9:84389115-84389137 CAGGTTTGCTGGGGGTGAGGTGG - Intergenic
1057238523 9:93387610-93387632 CAGGTGTTAGGGAGGTGAGGAGG - Intergenic
1057885300 9:98825074-98825096 GAGCATTGAATGAGATGAGGAGG + Intronic
1057890217 9:98864320-98864342 GAGGATTGAAGGAGGTGAGGGGG + Intergenic
1059334269 9:113558973-113558995 GAGGCTTGGAGGTGGTGGGGGGG + Intronic
1059729919 9:117046538-117046560 GAGGTTTAAAGGAAATGAGATGG - Intronic
1060230006 9:121819287-121819309 GAGGTTGGAAGGAAGGGAGCAGG + Intergenic
1060668374 9:125447228-125447250 GAAGAGTGAAGCAGGTGAGGAGG + Intronic
1060848015 9:126852596-126852618 GAGGCTTGAAGGAGGGCAGGGGG + Intergenic
1060893282 9:127201981-127202003 GAGGTGTGAGAGAGGAGAGGGGG + Intronic
1062525757 9:136977499-136977521 GAGGTGTGCAGGAGGAGCGGAGG - Exonic
1062650027 9:137570854-137570876 GAAGGTAGAAGGAGGTGAGAGGG - Intronic
1203520338 Un_GL000213v1:39896-39918 GAGATTTGAAGGAGGTGAAATGG - Intergenic
1185507015 X:639097-639119 GAGGCTCGTAGGAGGTGAGAGGG + Intronic
1185724927 X:2411961-2411983 GAGGAATGGAGAAGGTGAGGTGG + Intronic
1186206361 X:7204831-7204853 GAGGAAGGAAGGAGGGGAGGAGG - Intergenic
1186538601 X:10375544-10375566 GAGGTTTAAAGGAAAAGAGGTGG + Intergenic
1187820103 X:23278246-23278268 GAGGTTAGAGGGAGGAGAAGAGG - Intergenic
1188907118 X:35802307-35802329 GAGGATGGGAGGAGGAGAGGAGG - Exonic
1189348268 X:40258845-40258867 GTGGATTAAAGGAGTTGAGGTGG - Intergenic
1190276822 X:48904475-48904497 GAGGTTAGAGGGAGCAGAGGCGG + Exonic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1190391907 X:49940439-49940461 GAAGTTAGACGAAGGTGAGGAGG - Intronic
1191849435 X:65575088-65575110 GAGGGAGGAAGAAGGTGAGGGGG + Intergenic
1193033357 X:76923542-76923564 GAGATGTGAAGAAGGAGAGGAGG - Intergenic
1194266651 X:91761605-91761627 GAGTTTGGATGAAGGTGAGGAGG - Intergenic
1194750445 X:97678349-97678371 GAGGAAAGAAAGAGGTGAGGAGG + Intergenic
1195116448 X:101703690-101703712 GAGGTTTGGGGGAGGGGAGTGGG + Intergenic
1196742015 X:119033444-119033466 GTGGTTTGAAGGGGGTGAGCTGG - Intergenic
1197842424 X:130763206-130763228 GAGGTTTCAGGCAGGGGAGGGGG + Intronic
1198281958 X:135151180-135151202 GAAGTTTTAAGGAGGTGCAGGGG - Intergenic
1198289001 X:135221342-135221364 GAAGTTTTAAGGAGGTGCAGGGG + Intergenic
1198502859 X:137270027-137270049 GAGTTTAGAAGGAGGTATGGAGG - Intergenic
1199272256 X:145898316-145898338 GAGGCCTGAAGTGGGTGAGGTGG + Intergenic
1200255689 X:154581414-154581436 GAGGTTGCAAGAAGGTGAAGGGG - Intergenic
1200262080 X:154622990-154623012 GAGGTTGCAAGAAGGTGAAGGGG + Intergenic
1200583853 Y:4982519-4982541 GAGTTTGGATGAAGGTGAGGAGG - Intergenic
1200745028 Y:6896745-6896767 GAGGATTGAAGTAGGTGGGGAGG + Intergenic
1201866577 Y:18661992-18662014 GAGGTTGGAAGGTGGAGAAGTGG - Intergenic