ID: 1001070296

View in Genome Browser
Species Human (GRCh38)
Location 5:168579535-168579557
Sequence TTTGTTTGGAGCGGCTGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001070296_1001070304 -7 Left 1001070296 5:168579535-168579557 CCCCCGCAGCCGCTCCAAACAAA 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001070296 Original CRISPR TTTGTTTGGAGCGGCTGCGG GGG (reversed) Exonic
903780720 1:25818513-25818535 TTTGTTTGGTGGGGCTGGGGGGG + Intronic
905528837 1:38660554-38660576 TCTGTCTGGAGCAGCTGCAGGGG + Intergenic
905862565 1:41361266-41361288 GTTGCTTGCAGGGGCTGCGGCGG + Intergenic
905924873 1:41742327-41742349 TTTGTTTGGAGCCCTTGCTGTGG - Intronic
907159648 1:52360839-52360861 TCTGCTTGGGGCGGCTGCTGGGG + Intronic
915499530 1:156305646-156305668 TTTGTTTGGGCTGGGTGCGGTGG + Intergenic
915681888 1:157589445-157589467 TTTGTGTGCAGCTGCTGAGGAGG + Exonic
917554533 1:176070152-176070174 TTTGGTTGGAGCAGCTGGGCAGG - Intronic
920091672 1:203457722-203457744 TTTGTTTAGGGCGGGTGCAGTGG + Intergenic
920689781 1:208137140-208137162 TGTGTTTGGAGTGGGTGCTGGGG - Intronic
921599354 1:217090167-217090189 TCCGTTTGCAGCGGCTGCGGCGG - Intronic
924005510 1:239606272-239606294 TTTTTTTGGGGAGGGTGCGGGGG + Intronic
1062786532 10:269860-269882 TGTGCTTGGGGCGGCTGCAGGGG - Intergenic
1065022970 10:21516338-21516360 TTTGGTTGCAGCGGCGGCGGAGG + Exonic
1065877826 10:30012468-30012490 TTTGGTAGGAGAGGCTGGGGAGG + Intergenic
1072538650 10:96381799-96381821 TTTGTTTTGAGTGTCTGCTGTGG - Intronic
1073114689 10:101085071-101085093 TTTGTTTTGGGAGGCTGAGGAGG + Intergenic
1076313469 10:129524250-129524272 TTTGTTTGGCAAGGCTGCAGGGG - Intronic
1076389312 10:130086242-130086264 TTTGTGTGGAGAAGCTGAGGGGG - Intergenic
1081814178 11:45929393-45929415 TTTGTTTTGAGGGGGTGGGGGGG - Intronic
1082064829 11:47891580-47891602 TTTTTTTTGGGCGGCTGAGGCGG - Intergenic
1085678298 11:78546312-78546334 TTTTTTTGGAATGGCTCCGGGGG - Intronic
1086091803 11:83012300-83012322 GTTCTTTGGAGAGGCTGCAGTGG - Intronic
1086576974 11:88349491-88349513 TGTGTTTTGAGAGGCTGAGGTGG - Intergenic
1093654581 12:21680165-21680187 TTTGTTTGGGCCGGGCGCGGTGG + Intronic
1093888712 12:24493575-24493597 TTTGTTTTGGCCGGGTGCGGTGG + Intergenic
1095117434 12:38371622-38371644 TTTGTGTGGAGCGGGTTGGGAGG + Intergenic
1096209475 12:49753027-49753049 TATGTTTGTGGCGGCTGCAGGGG + Exonic
1097512814 12:60565087-60565109 GTTGTTTGGGGAGGCTGCAGTGG + Intergenic
1100818301 12:98407121-98407143 TTTTTTTGGGCCGGGTGCGGTGG - Intergenic
1101731596 12:107431619-107431641 TTTTTTGGGGGCGGGTGCGGGGG - Intronic
1106707085 13:32292268-32292290 TTTGTTTGGGCCGGGTGTGGTGG - Intronic
1108710365 13:53027267-53027289 TTTGTGTGGAGCTTCTGGGGTGG + Intergenic
1112903876 13:104392967-104392989 TTTGTGTGAATCGGCTGAGGCGG - Intergenic
1113869249 13:113548018-113548040 TTTGGTTGGGGCGGGGGCGGGGG + Intronic
1117315370 14:54566914-54566936 TTTGTCTCGAGCTGCTGCCGCGG + Intergenic
1120394532 14:83952563-83952585 TGTGTTAGTAGCGGCTGTGGTGG + Intergenic
1121335061 14:93072860-93072882 TTTGTTTTGGGTGGCTGAGGTGG - Intronic
1122937590 14:104967197-104967219 TTTGGCTGGGGAGGCTGCGGAGG - Intronic
1125677541 15:41511030-41511052 TTTGTTTGGAGCTGCTGAGCAGG + Intronic
1130600966 15:85272917-85272939 GTTCTTTGGGGCGGCTGCTGAGG - Intergenic
1131170535 15:90174976-90174998 TTTTTTTGGAGGGGGGGCGGGGG + Intronic
1132099549 15:99014255-99014277 TTTGGCTGCAGCGGCGGCGGGGG - Intergenic
1132245966 15:100296557-100296579 TTTGTTTGGAGGGGGTGAGGGGG + Intronic
1137713260 16:50581961-50581983 GTTGTTTGGGGCTGCTGGGGTGG + Intronic
1141972801 16:87494252-87494274 TTGTTTTGGAGCGACTGGGGCGG - Intergenic
1143546971 17:7602989-7603011 TTTCATTGGAGCAGCTGCAGAGG + Exonic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1150587786 17:66534064-66534086 TTTTTTTGGGGGGGGTGCGGGGG - Intronic
1150812711 17:68369217-68369239 TCTGTCTGGAGCGACTGCAGAGG + Intronic
1156588451 18:38459206-38459228 TTTCTTTGGAGCGGCTTCAAAGG + Intergenic
1157238784 18:45989719-45989741 CTTGTTTGGAGTAGCTGCAGGGG + Intronic
1160359477 18:78259993-78260015 TTTGTTTGGAGCGGGTGAGTTGG - Intergenic
1160552451 18:79703633-79703655 TCTGTTCCGAGCAGCTGCGGTGG + Intronic
1162108797 19:8388761-8388783 TTTGTTTTGGCTGGCTGCGGTGG - Intronic
927687060 2:25178432-25178454 TGTGTGAGGAGCGGCTGCAGAGG - Intergenic
927818593 2:26243036-26243058 ATTGTTTGGGCCGGGTGCGGTGG - Intronic
928087241 2:28353369-28353391 TTTTTTTGGAGGGGGTGCGGGGG + Intergenic
935107195 2:100055529-100055551 TTTAGTTGGAGGGGCTGAGGAGG + Intronic
936086554 2:109473445-109473467 TTTATTTGGGGAGGCTGTGGGGG + Intronic
936397735 2:112141853-112141875 TATGTTTGCAGCTGCTGCAGAGG + Intronic
936785327 2:116087696-116087718 TTTGTTAGGAGCGGCTTGGGAGG - Intergenic
938043531 2:128096128-128096150 CAGGCTTGGAGCGGCTGCGGAGG + Intronic
939056321 2:137369123-137369145 GTTGTTTGGAGGGGGGGCGGGGG + Intronic
940531737 2:154886534-154886556 TGGGTTTGCAGCAGCTGCGGTGG + Intergenic
941126026 2:161584694-161584716 GTTGTTTGGGCCGGGTGCGGTGG + Intronic
947936499 2:234009314-234009336 TTTATTTGGAGTGACTTCGGAGG + Intronic
1169758845 20:9069177-9069199 TTTGCCTGGAGCTGCTGCCGGGG - Intronic
1169765049 20:9139912-9139934 TTTCTTTGAAGGGGCTGAGGTGG + Intronic
1175216085 20:57392212-57392234 TTTATTTGGGGCGGCTGAGAGGG - Intronic
1175412862 20:58782948-58782970 TTGGTTGTGAGCGGCTGAGGTGG + Intergenic
1178348228 21:31850560-31850582 TTTTTTTGGACCGGGTGCGGTGG + Intergenic
1180074617 21:45456258-45456280 CTGGCTGGGAGCGGCTGCGGCGG - Intronic
1180669577 22:17542726-17542748 TTTGTTTGGAGCACCTGCCCAGG + Exonic
1183177777 22:36237132-36237154 TTTGTCTGGAGCCTCTGCTGGGG + Intronic
950857679 3:16120872-16120894 TTTGTTTGGGGAGGTTGCAGGGG - Intergenic
951958965 3:28293315-28293337 TTTTTTTCGAGTGGCTGGGGAGG + Intronic
956814131 3:72892582-72892604 TTTCATTGGAGCAGCTGGGGAGG - Intronic
957145525 3:76418523-76418545 TTTGTTTGGGCCGGGTGCAGTGG - Intronic
960568310 3:119158337-119158359 TTTGTTTGTAGTGGGTGAGGTGG + Intronic
961845547 3:129760006-129760028 TTTTTTTGGGCCGGGTGCGGTGG - Intronic
962335865 3:134529626-134529648 TTTGTTGGGGCCGGGTGCGGTGG - Intronic
962876407 3:139539123-139539145 TTTGTTGGGGGCGGCAGGGGAGG - Intronic
963610129 3:147456675-147456697 TTTGTTTGGGGAGACTGCAGGGG + Intronic
964146347 3:153468504-153468526 GTTGTTTTGGCCGGCTGCGGTGG + Intergenic
968089117 3:195889120-195889142 ATTGTTAGGAGAGGCTGGGGTGG - Intronic
970751738 4:19372032-19372054 TTTTTTTGGGGGGGGTGCGGGGG - Intergenic
972006788 4:34119551-34119573 TTTGTTTGGTGCAGCTTCTGAGG + Intergenic
975965191 4:79964770-79964792 TCTGTTTGCAGCGGCGGCAGCGG - Intronic
981792913 4:148560473-148560495 TATGTTTGCAGCGGGTGAGGTGG + Intergenic
983131250 4:164022665-164022687 TGTGCATGGAGCAGCTGCGGCGG + Intronic
986624983 5:9715484-9715506 TTTATTTGGAGAGGCTTCTGCGG + Intergenic
993520346 5:88891695-88891717 TTTGTTTGGGCCGGGTGCAGTGG - Intronic
994894710 5:105687975-105687997 TGTGTGTGGAGGGTCTGCGGGGG + Intergenic
999182484 5:149679936-149679958 TCTGTTTTGAGCACCTGCGGTGG + Intergenic
1001031081 5:168263419-168263441 TTTGTGTGTAGCGCCTGGGGAGG + Intronic
1001070296 5:168579535-168579557 TTTGTTTGGAGCGGCTGCGGGGG - Exonic
1005209683 6:23446367-23446389 TTTGTGTGTAGCGGGTACGGGGG - Intergenic
1005588903 6:27304339-27304361 TTTATTTGGGTCGGGTGCGGTGG - Intronic
1005852932 6:29835700-29835722 TTTGTTTTGAGCTGCTGCCTGGG - Intergenic
1007870937 6:45037243-45037265 TTTGGTAGGAGTGGCTGCAGTGG + Intronic
1009420515 6:63459549-63459571 TTTGTTGGGGGCGGCGGGGGTGG - Intergenic
1015991372 6:138947359-138947381 TTTGTTTGGGAAGGCTGTGGAGG - Intronic
1020073034 7:5240029-5240051 TTTTTTGGTAGAGGCTGCGGCGG - Intergenic
1022497617 7:30862952-30862974 TTTGATTAGAGCGGCAGAGGTGG + Intronic
1026199294 7:68200357-68200379 TGGGTTTGGGGTGGCTGCGGTGG - Intergenic
1027557770 7:79687177-79687199 TTTGTTTGGAGGGGGAGGGGAGG + Intergenic
1029592945 7:101519421-101519443 TTTTGTTGGAGAGGCTGAGGTGG - Intronic
1029640500 7:101816623-101816645 TTTGTGGGGAGTTGCTGCGGGGG + Intronic
1029650936 7:101890990-101891012 TTTTTTTTGAGCGGGGGCGGGGG + Intronic
1031223744 7:119007732-119007754 TTTTTTTGGAGAGGCTACTGTGG - Intergenic
1031991019 7:128199148-128199170 TTTTTTTGGCGGGGGTGCGGGGG - Intergenic
1032394998 7:131583075-131583097 TTTGTTTGGGCCGGGTGCGGTGG + Intergenic
1033754908 7:144390340-144390362 TTTGAGTGGAGGGGCTGGGGTGG - Intergenic
1034147116 7:148883767-148883789 TTTGTGTGGCGCGGCCGCGGCGG - Intronic
1037009422 8:13821812-13821834 TTTGTTTGGGGAGGCTGTTGTGG - Intergenic
1038848156 8:31248895-31248917 TTTGTTTGGAGTAACTACGGTGG + Intergenic
1045230274 8:100299470-100299492 AGTGTTTGGACCGGGTGCGGTGG + Intronic
1048289592 8:133170495-133170517 TTTCTTTGGGCCGGGTGCGGTGG + Intergenic
1052156846 9:25202867-25202889 TGTGATTGGAGGGGCTGCTGCGG + Intergenic
1056523236 9:87419255-87419277 TTTGTTTTGGCCGGGTGCGGTGG - Intergenic
1057276152 9:93676925-93676947 GTTGTTTGGAGACGATGCGGAGG - Exonic
1059242630 9:112820332-112820354 TTTTTTTGTAGCGGATGAGGGGG - Intronic
1062365738 9:136208162-136208184 CTTGCTTGGAGGGGCTGCAGAGG + Exonic
1185802962 X:3030005-3030027 TTTGAGTGGATCGGCTGTGGTGG - Intronic
1187173190 X:16870702-16870724 GTTGCTTGTAGCGGCAGCGGTGG + Intergenic
1188626585 X:32292552-32292574 TTTGTTTTGGGAGGCTGAGGCGG - Intronic
1189169876 X:38898606-38898628 TTTGTTTGGAGTGGCTGTGGTGG - Intergenic
1201789641 Y:17825411-17825433 TGTGTGTGGAGCGGGTGGGGGGG - Intergenic
1201811913 Y:18080578-18080600 TGTGTGTGGAGCGGGTGGGGGGG + Intergenic
1202351292 Y:23995161-23995183 TGTGTGTGGAGCGGGTGGGGGGG - Intergenic
1202519487 Y:25674958-25674980 TGTGTGTGGAGCGGGTGGGGGGG + Intergenic