ID: 1001070304

View in Genome Browser
Species Human (GRCh38)
Location 5:168579551-168579573
Sequence AAACAAAAGGCCCCGGTCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001070297_1001070304 -8 Left 1001070297 5:168579536-168579558 CCCCGCAGCCGCTCCAAACAAAA 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070292_1001070304 6 Left 1001070292 5:168579522-168579544 CCGCTCCGGGGCCCCCCCGCAGC 0: 1
1: 0
2: 1
3: 27
4: 379
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070291_1001070304 11 Left 1001070291 5:168579517-168579539 CCTCGCCGCTCCGGGGCCCCCCC 0: 1
1: 0
2: 2
3: 67
4: 574
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070299_1001070304 -10 Left 1001070299 5:168579538-168579560 CCGCAGCCGCTCCAAACAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070298_1001070304 -9 Left 1001070298 5:168579537-168579559 CCCGCAGCCGCTCCAAACAAAAG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070294_1001070304 -5 Left 1001070294 5:168579533-168579555 CCCCCCCGCAGCCGCTCCAAACA 0: 1
1: 0
2: 0
3: 22
4: 216
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070288_1001070304 18 Left 1001070288 5:168579510-168579532 CCGCCGGCCTCGCCGCTCCGGGG 0: 1
1: 0
2: 1
3: 25
4: 263
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070290_1001070304 15 Left 1001070290 5:168579513-168579535 CCGGCCTCGCCGCTCCGGGGCCC 0: 1
1: 0
2: 5
3: 42
4: 396
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070296_1001070304 -7 Left 1001070296 5:168579535-168579557 CCCCCGCAGCCGCTCCAAACAAA 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070295_1001070304 -6 Left 1001070295 5:168579534-168579556 CCCCCCGCAGCCGCTCCAAACAA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116
1001070293_1001070304 1 Left 1001070293 5:168579527-168579549 CCGGGGCCCCCCCGCAGCCGCTC 0: 1
1: 0
2: 5
3: 59
4: 545
Right 1001070304 5:168579551-168579573 AAACAAAAGGCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001070304 Original CRISPR AAACAAAAGGCCCCGGTCCC CGG Exonic