ID: 1001079997

View in Genome Browser
Species Human (GRCh38)
Location 5:168660696-168660718
Sequence CAGGGAGACCTGGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001079987_1001079997 4 Left 1001079987 5:168660669-168660691 CCCCAGTCAGTGTGACCTTGTCT No data
Right 1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG No data
1001079986_1001079997 5 Left 1001079986 5:168660668-168660690 CCCCCAGTCAGTGTGACCTTGTC No data
Right 1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG No data
1001079989_1001079997 2 Left 1001079989 5:168660671-168660693 CCAGTCAGTGTGACCTTGTCTTG No data
Right 1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG No data
1001079988_1001079997 3 Left 1001079988 5:168660670-168660692 CCCAGTCAGTGTGACCTTGTCTT No data
Right 1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001079997 Original CRISPR CAGGGAGACCTGGGGGAAGA AGG Intergenic
No off target data available for this crispr