ID: 1001080723

View in Genome Browser
Species Human (GRCh38)
Location 5:168665412-168665434
Sequence CCTTCTTGGAAGCGGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001080723_1001080730 -1 Left 1001080723 5:168665412-168665434 CCAGCCTTCCGCTTCCAAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 205
Right 1001080730 5:168665434-168665456 GGCTGACTACCTTCTCTACTGGG 0: 1
1: 0
2: 0
3: 11
4: 206
1001080723_1001080729 -2 Left 1001080723 5:168665412-168665434 CCAGCCTTCCGCTTCCAAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 205
Right 1001080729 5:168665433-168665455 GGGCTGACTACCTTCTCTACTGG 0: 1
1: 0
2: 0
3: 3
4: 168
1001080723_1001080734 29 Left 1001080723 5:168665412-168665434 CCAGCCTTCCGCTTCCAAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 205
Right 1001080734 5:168665464-168665486 CCAATGAAAAATTACCTGGAAGG 0: 1
1: 0
2: 4
3: 12
4: 224
1001080723_1001080732 25 Left 1001080723 5:168665412-168665434 CCAGCCTTCCGCTTCCAAGAAGG 0: 1
1: 0
2: 2
3: 16
4: 205
Right 1001080732 5:168665460-168665482 CATTCCAATGAAAAATTACCTGG 0: 1
1: 0
2: 2
3: 25
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001080723 Original CRISPR CCTTCTTGGAAGCGGAAGGC TGG (reversed) Intronic
903154086 1:21431950-21431972 CCCTCCTGGAAGGGGAAGCCAGG + Intergenic
905220239 1:36441127-36441149 CCTGCTGGGAAGAGGACGGCGGG + Intronic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906888858 1:49685057-49685079 CCTTCTTGAAGGTGGAAGGTGGG - Intronic
907238106 1:53065065-53065087 CATTCTTAGAAGAGCAAGGCTGG + Intronic
907424399 1:54370168-54370190 CCTTCCTGGAAGCTGGTGGCTGG + Intronic
909752080 1:79174615-79174637 ACTTCTTGGAAGGGGAAGGTAGG + Intergenic
910432617 1:87173984-87174006 GCTTCATGGAAGGGGAAGGTGGG + Intergenic
910751700 1:90638025-90638047 CCTTAGTGAAAGAGGAAGGCAGG + Intergenic
912701214 1:111879641-111879663 CCTTCTTGGAGGCAGAAAACTGG - Intronic
913194622 1:116445197-116445219 CCCTTTTGGAAGCGGGAGGTTGG + Intergenic
916576633 1:166072731-166072753 CCTTCTTAGAATTGGAGGGCAGG + Intronic
918359562 1:183742139-183742161 CCATCTTGAAAGAGGCAGGCAGG - Exonic
919628103 1:199932253-199932275 CCTTCTTGGAAGCAGAGAGATGG + Intergenic
919683516 1:200459159-200459181 CCATCTTAGAAGTGGAAGCCAGG + Intergenic
922802912 1:228372209-228372231 CCTCCCTGGATGCGGAGGGCTGG + Exonic
924229988 1:241955051-241955073 AGATCTTGGAAACGGAAGGCAGG + Intergenic
1064582481 10:16808370-16808392 GCTACTTGGAAGCCTAAGGCAGG + Intronic
1065967190 10:30779879-30779901 CTCTCTGGGAAGCAGAAGGCAGG - Intergenic
1066294692 10:34043937-34043959 GCTACTTGGAAGGTGAAGGCAGG - Intergenic
1067514527 10:46926526-46926548 TCTCCTAGGAAGTGGAAGGCAGG + Intronic
1067647733 10:48125287-48125309 TCTCCTAGGAAGTGGAAGGCAGG - Intergenic
1069047988 10:63763194-63763216 GCATCTTGGAAGGGGATGGCTGG + Intergenic
1075623419 10:123944682-123944704 CCTGTTTGGAAGCAGAATGCTGG - Intergenic
1076450771 10:130555570-130555592 CCCTCTTGACAGTGGAAGGCAGG - Intergenic
1076769541 10:132655568-132655590 CCCTCTTGGAAGCGGAGTTCAGG - Intronic
1077662204 11:4079750-4079772 CCTACTGGGAAGTGGAAGTCAGG + Intronic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG + Intronic
1078626258 11:12961665-12961687 CATTCCTGGAAGCAGAAGTCTGG + Intergenic
1078939782 11:15989350-15989372 ACTTCTTGGAAGTAGAAGGCAGG + Intronic
1080057929 11:27926695-27926717 CCTGCATAGAAGGGGAAGGCTGG - Intergenic
1080368460 11:31607395-31607417 CCATCTTGGAAGCAGAGTGCTGG - Intronic
1080503585 11:32892568-32892590 CCTTCCGGGCTGCGGAAGGCGGG + Intergenic
1080718938 11:34830595-34830617 CTTTCCTGAAAGCGGAGGGCTGG - Intergenic
1081632722 11:44700766-44700788 CCTTCCTGGAAGCCAGAGGCAGG + Intergenic
1081848263 11:46256790-46256812 CCATCTTGGAAGCAGAGAGCAGG + Intergenic
1084230875 11:67751746-67751768 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1085674153 11:78499375-78499397 CCTTCTTGGAAGCCTGAGGCAGG - Intronic
1087555154 11:99710000-99710022 CATTTCTGGAAGAGGAAGGCAGG - Intronic
1089934556 11:122350376-122350398 GCTTCTTGGGGGCGGAAGGATGG + Intergenic
1090051800 11:123386547-123386569 GCTACTTGGAAGGGTAAGGCAGG - Intergenic
1090374469 11:126279247-126279269 CCATCTTCGAAGCAGAAAGCAGG - Intergenic
1090424352 11:126596744-126596766 CCTTCCTGGAAGAAGAAAGCTGG - Intronic
1090602015 11:128382473-128382495 CCTACTTGGGAGGGTAAGGCAGG - Intergenic
1091386546 12:99590-99612 CCTTGATGTAAGAGGAAGGCTGG - Intronic
1096285603 12:50297189-50297211 ATTGCTTGGAAGCGGAAGTCAGG - Intergenic
1097399509 12:59112174-59112196 CCATCTTAGAAGCAGAAAGCAGG + Intergenic
1099705880 12:86152324-86152346 CCATCTTGGAAGCAGAGGTCAGG - Intronic
1102010362 12:109614590-109614612 CCATCTTGGAAGCGGTAAGGAGG - Intergenic
1102835401 12:116053616-116053638 CCTACTTTGAAGCAGAAGGGAGG + Intronic
1103386482 12:120536310-120536332 CCTACTTGGAAGGGTAAGGTGGG + Intronic
1103772948 12:123342758-123342780 GATTCTTGGAGGCTGAAGGCTGG - Intronic
1103786259 12:123435625-123435647 GCTACTTGGAAGGGCAAGGCAGG + Intronic
1104872767 12:132012368-132012390 CCATCTGGGAAGCGGAAACCAGG - Intronic
1105065739 12:133195827-133195849 GCTACTTGGAAGGGGGAGGCAGG - Intronic
1106029818 13:25990020-25990042 TCTTCCTGGAAGGGGAAGGGAGG - Intronic
1107414508 13:40188387-40188409 CCTTCTTGGTAGGAGAAGGCAGG - Intergenic
1113465668 13:110511173-110511195 CCTTTATGGAAGCGCACGGCAGG - Intronic
1116748522 14:48851723-48851745 CCATCTTGGAAGCAGAAATCAGG + Intergenic
1121050281 14:90815830-90815852 ACTTCTTGGAAGCCCCAGGCCGG + Intronic
1121324407 14:93011640-93011662 CCTTCATGGCAGCGGAGGGAGGG + Intronic
1123099277 14:105785137-105785159 CCTACTTGGAAGAGTGAGGCAGG - Intergenic
1124022423 15:25936979-25937001 CCATCTTGGAAGCGGAGACCTGG + Intergenic
1124882834 15:33658311-33658333 AATTCTTGGGGGCGGAAGGCGGG - Intronic
1126369858 15:47934180-47934202 CCATCTTGGAAGCAGAAGACAGG - Intergenic
1129380272 15:75160667-75160689 CCATCTTGGAAGCAGAGAGCAGG - Intergenic
1132362389 15:101227370-101227392 CCTTCTTGGAAGGGGATAGGGGG + Intronic
1132648081 16:1008177-1008199 CCGTCTGTGAAGCGGAAGGTTGG - Intergenic
1133818375 16:9215150-9215172 CCCACTTGGAGGCTGAAGGCAGG + Intergenic
1134771907 16:16816330-16816352 CAATCTTGGAAGAAGAAGGCTGG - Intergenic
1136390726 16:29962437-29962459 CCCACTTGGAAGCAGGAGGCGGG + Intronic
1137241781 16:46661339-46661361 GCTACTTGGAAGCCTAAGGCAGG - Intronic
1139127764 16:64100644-64100666 CCTTCTTGGAAGGCTGAGGCAGG + Intergenic
1139325050 16:66146029-66146051 CCCTCTTGGAAGGGGATGGCTGG + Intergenic
1140743905 16:77964496-77964518 GATTCTTGCAAGAGGAAGGCAGG - Intronic
1141600901 16:85125752-85125774 GCGTGTTGGAAGCGGCAGGCAGG + Intergenic
1142141104 16:88473256-88473278 CCCACTTGGAAGAGGATGGCAGG + Intronic
1142903874 17:3029671-3029693 CCTTCCTGGAAGCTGCTGGCTGG - Intronic
1144064732 17:11614694-11614716 CCATCTTGGAAGCAGAGGCCAGG - Intronic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1144577236 17:16436808-16436830 CCTCCTTGGGAGGGGAAGCCAGG - Exonic
1146243854 17:31260156-31260178 CCTACTTTGAAGCTGAAGCCGGG + Intronic
1146675071 17:34767763-34767785 CCATCTGAGAAGTGGAAGGCTGG + Intergenic
1147197003 17:38773730-38773752 TCTCCTTGGAAGAGGAAGGGAGG + Intronic
1149898806 17:60453981-60454003 CCTACTTGGAAGACTAAGGCAGG - Intronic
1152819931 17:82432348-82432370 CCCTCTGGCAAGCGGAAGACAGG + Intronic
1154253624 18:12765137-12765159 CCTTCTTGGAAGCGGGTGCAGGG - Intergenic
1155318167 18:24592724-24592746 CCACCTTGGAAGAGGAAGGCAGG + Intergenic
1157088785 18:44610618-44610640 CCCTATTGGAAGGGGCAGGCTGG - Intergenic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1160619528 18:80160929-80160951 CCTTCTGGGAGGCAGCAGGCTGG + Intronic
1160715132 19:572975-572997 CCTGCTTGGAGGCGGGAGCCAGG + Intronic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1164596607 19:29534311-29534333 CCCTCCTGGAACCTGAAGGCAGG + Intronic
1164890096 19:31816106-31816128 CCTTGTTGTTAGCGGAGGGCTGG - Intergenic
1164890729 19:31821095-31821117 CCTTCTAAGAAGAGGAAAGCTGG - Intergenic
1165008099 19:32823059-32823081 CCTCCTGGGAAGCGGAATGAGGG - Intronic
1165240598 19:34463761-34463783 CCTTATAGGAGGAGGAAGGCAGG - Intronic
1167330663 19:48853930-48853952 CCTTCCTGAATGCGGAAGTCAGG - Intronic
1168105649 19:54164404-54164426 CGGTCTTGGAAGAGGAAGCCAGG - Intronic
1168229866 19:55023623-55023645 CCGTATAGGAAGCAGAAGGCTGG - Intronic
925503695 2:4536136-4536158 GCTTGTTAGAAGCGGAAGCCTGG - Intergenic
926006559 2:9377570-9377592 CCTGCCTGGCAGCTGAAGGCTGG + Intronic
926386539 2:12340980-12341002 CATTCCTGGAAACTGAAGGCTGG + Intergenic
929803696 2:45126401-45126423 CCTTGTTGAAAGTGGAAGGAGGG + Intergenic
929812127 2:45199575-45199597 CCATCTTGGAAGTGGAAACCAGG + Intergenic
930015869 2:46970286-46970308 CCTTCTTGAAAGCTCAAAGCAGG - Intronic
930027916 2:47040672-47040694 CCTGCTTTGAAGCCGCAGGCCGG - Intronic
930475404 2:51875552-51875574 CCTTCTTGTAAGCAGAAAGAAGG - Intergenic
938062734 2:128265726-128265748 CCCTCCTGGAAGGGGAAGCCAGG - Exonic
941081662 2:161068432-161068454 TCTTCTTGGAAGCTTAAAGCAGG + Intergenic
944159719 2:196645342-196645364 CCTTCCTGGAAGTGAAAGGGGGG - Intronic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
947402763 2:229744883-229744905 CCATCTTGGAAGCAGAAAGCTGG - Intergenic
947975676 2:234363789-234363811 GCATCTTGGATGAGGAAGGCTGG + Intergenic
948735049 2:239998160-239998182 CCCTCTTGGAAGAGAAAGTCGGG - Intronic
1172246392 20:33448026-33448048 CCTTCTTGGAAGGCTGAGGCAGG + Intergenic
1173641626 20:44606896-44606918 CCCTCTTGGAAGCAGAGAGCAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174166442 20:48586887-48586909 ACTTCTTTGAAGCAGAAGCCTGG + Intergenic
1174846670 20:53949536-53949558 CCTTCCTGGGAGGGGAATGCTGG - Intronic
1175397623 20:58677828-58677850 CCAACTTGGAAAGGGAAGGCTGG - Exonic
1175717717 20:61266553-61266575 CCTTCCTGGAAGCGGAAGTCGGG - Intronic
1178428827 21:32501465-32501487 CCTTCTTTGAAGCAGAAAGATGG + Exonic
1179165224 21:38930306-38930328 CCTTCTTGGTAGAGAAAGGAGGG + Intergenic
1179435698 21:41360689-41360711 CCTTCCTTGAAGCAGTAGGCCGG + Intergenic
1179828681 21:43982660-43982682 CCCTCTTGGAAGCGGAGTTCTGG - Exonic
1180736786 22:18023619-18023641 CCCTCCTGGAAGCAGAGGGCGGG - Intronic
1181397274 22:22631263-22631285 CTTGCTTGGAAGCAGTAGGCTGG + Intergenic
1181459409 22:23077515-23077537 CCTTCTTGGAATTGGGAGGCTGG + Intronic
1181705243 22:24645938-24645960 CTTGCTTGGAAGCAGTAGGCTGG + Intergenic
1183331155 22:37222324-37222346 CCTTCTTCAAAGCGGAGGCCTGG - Intergenic
1184111768 22:42399664-42399686 CCTGCTGGGAAGGTGAAGGCTGG + Intronic
1184277179 22:43415833-43415855 CCTTCTTGGAAGGAGGAGACGGG - Intronic
1184353509 22:43961559-43961581 ACTACTTGGAAGGGTAAGGCAGG - Intronic
1184777825 22:46632143-46632165 CCTGCTTGGGAGGGGAAGGTTGG + Intronic
1185108868 22:48889744-48889766 ACTTCTTGCAAACTGAAGGCTGG + Intergenic
950194925 3:11002440-11002462 CCATTTTGGAAGCGGAAAGAGGG + Intronic
950475670 3:13213544-13213566 CGTTCTTGGAACCTGAAGGCAGG + Intergenic
952888941 3:38028733-38028755 CCTTCTGGGAGGCGGGAGGTTGG - Intronic
953046604 3:39298494-39298516 CCTCCTGGGAGGCAGAAGGCAGG + Intergenic
954717195 3:52532851-52532873 CCTTCTTGGAGGGGGCCGGCTGG - Intronic
956773548 3:72547027-72547049 CCATCTTGGAAGCAGAGGCCAGG + Intergenic
958190985 3:90184946-90184968 CCTTCTTCAAAGAGGATGGCTGG - Intergenic
958413188 3:93844076-93844098 CCTTCTTCAAAGAGGATGGCTGG - Intergenic
961879505 3:130050925-130050947 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
963040967 3:141069535-141069557 CATCCTTGGAAGCAAAAGGCAGG + Intronic
968630118 4:1646023-1646045 CCATCTTGGAAGCAGAGGGCAGG + Intronic
968991717 4:3917829-3917851 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
969508756 4:7605144-7605166 CCTTGTTGGAAGTGGAAGCCAGG - Intronic
969823626 4:9739659-9739681 CCTTCTTTGAAGCAGAAAGATGG + Intergenic
970443451 4:16104905-16104927 CCATCTTGGAAGCAGGAGGTGGG - Intergenic
971124024 4:23732782-23732804 TCTTCTTGTTAGCAGAAGGCTGG + Intergenic
973636819 4:52868728-52868750 CCACCTTGGAAAGGGAAGGCAGG + Intergenic
973848489 4:54937287-54937309 CCTGCTGGGAAGTGGCAGGCTGG + Intergenic
975800869 4:78057958-78057980 GCTTCTTGGATGCTGAAGGCTGG + Exonic
976040160 4:80874579-80874601 CCATCTTGGAAGCAGAAAGGAGG - Intronic
977149904 4:93498232-93498254 CCATCTTGGAAGCAGAAACCTGG - Intronic
977990927 4:103441659-103441681 ACTTGTTGGCAGAGGAAGGCAGG + Intergenic
979700509 4:123661155-123661177 CTTTCTTGGAAATGAAAGGCTGG + Intergenic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984180605 4:176478279-176478301 GCTTCTTGTAAGCAGAAGCCTGG + Intergenic
986622752 5:9692555-9692577 CCTTACTGGAAGCAGATGGCAGG - Intronic
988984896 5:36608084-36608106 CCTCATTGGAAGGGGAAGGACGG + Intronic
993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG + Intergenic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
997888795 5:137657183-137657205 CCTTCCTGGAAGAAGCAGGCAGG + Intronic
998166351 5:139846590-139846612 TATTCTTGGAAGCGGGAGGAGGG + Intergenic
1001080723 5:168665412-168665434 CCTTCTTGGAAGCGGAAGGCTGG - Intronic
1003833456 6:10040784-10040806 CCATCTTGGAAGCAGAGAGCAGG - Intronic
1004571454 6:16849849-16849871 GCTTCTGGGATTCGGAAGGCTGG - Intergenic
1006271730 6:32970847-32970869 CCTCCTCGGAGGCGGACGGCCGG + Intronic
1006405923 6:33844774-33844796 CCTACTGGGAAGGGGCAGGCTGG + Intergenic
1007492285 6:42232786-42232808 CCCTCTGGGAAGCAGAAGCCTGG - Exonic
1007633407 6:43284961-43284983 CCTGCTTGAGAGCAGAAGGCAGG - Exonic
1015519428 6:134115445-134115467 CCTTCTTGGAGGCCAAGGGCTGG + Intergenic
1015831786 6:137377706-137377728 GCTACTTGGAAGCCGGAGGCAGG + Intergenic
1017435400 6:154411034-154411056 CCTTCTTGGACCAGGAAAGCCGG - Exonic
1018046578 6:159970589-159970611 CTTTTTTGGAAGGGGAAGGGTGG + Intronic
1020314523 7:6895611-6895633 CCTTCTTTGAAGCAGAAAGATGG - Intergenic
1021101647 7:16591427-16591449 GCTTCTTGGAAGCCTGAGGCAGG - Intergenic
1021742176 7:23697861-23697883 CCTACTTGGAAGGGTAAAGCAGG - Intronic
1022156335 7:27664893-27664915 TCTTCCTGGAAGCGGAAGTCAGG - Intergenic
1022318444 7:29265630-29265652 CTTTCTTGGAGGCAGGAGGCAGG + Intronic
1022342969 7:29486111-29486133 CCCTCTGGTAAGGGGAAGGCAGG - Intronic
1022502596 7:30892140-30892162 CCTTCATGGAAGGGGCAGGGAGG - Exonic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1026928791 7:74211386-74211408 GCTACTTGGAAGGGTAAGGCAGG - Intronic
1027216171 7:76185416-76185438 CCTTCCTGGAAGCCCCAGGCCGG + Intergenic
1030664338 7:112257923-112257945 CCTACTTGGAAGGCTAAGGCTGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1033202207 7:139383035-139383057 CCTACTTGGAAGGGTGAGGCAGG - Intronic
1034645251 7:152640555-152640577 CGTACTTGGAAGCGGAAGTGCGG + Intergenic
1034879713 7:154753786-154753808 GCTTCTTGGATGCGGATGGAGGG - Intronic
1036394060 8:8351772-8351794 CTTTTTTGCAAGGGGAAGGCAGG - Intronic
1037643922 8:20773108-20773130 CCTTCTGGGAAGCAGAAACCAGG + Intergenic
1037785240 8:21899074-21899096 ACTTCTTTGATGGGGAAGGCAGG - Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1043199866 8:77353334-77353356 CCATCTTGGAAGCAGAAACCAGG + Intergenic
1044166105 8:88985735-88985757 CCTACTTGGAGGTGGAAGGCTGG - Intergenic
1044754210 8:95444922-95444944 CCTTCTTTAGAGAGGAAGGCAGG + Intergenic
1045143809 8:99316287-99316309 CCTTAGTGGCAGCGGAGGGCAGG + Intronic
1046926102 8:119790906-119790928 CCTTCTTGGGAGGTGGAGGCAGG - Intronic
1047185865 8:122632893-122632915 ACTTTTTGGAAGCAGAAGGTGGG - Intergenic
1047435741 8:124834379-124834401 CATTCTTGGCTGCTGAAGGCAGG + Intergenic
1049509751 8:143021610-143021632 CCTTCTGGGATGGGGCAGGCCGG - Exonic
1051366465 9:16324729-16324751 GCCTCTTGGGAGCAGAAGGCTGG + Intergenic
1054769020 9:69067297-69067319 TCTTCTTGGAAGGAGCAGGCCGG + Intronic
1056423323 9:86451721-86451743 CCATCTTGGAAGCTGAAGGCAGG - Intergenic
1058137792 9:101326553-101326575 TCTTCTTGGAAGAGGAAAGTGGG + Intergenic
1058678298 9:107420115-107420137 CCTTCTTTGAAGGTGAGGGCTGG - Intergenic
1058893346 9:109379908-109379930 CCTTCTTGTAAGTGGAAGTGTGG + Intronic
1060706486 9:125806458-125806480 CCATCCTGGAAGCAGAAGCCTGG - Intronic
1060913394 9:127369011-127369033 GCTGCTGGGAAGCTGAAGGCAGG - Intronic
1062220608 9:135413239-135413261 CCTTCTCGGAAGAGGAGGGGAGG - Intergenic
1186089223 X:6026157-6026179 CCATAATGGAAGCGGAATGCTGG - Intronic
1186327770 X:8498334-8498356 CATTCTTGGAGCAGGAAGGCTGG + Intergenic
1188855888 X:35195302-35195324 ACATCTTGGAAGCAGAAAGCAGG + Intergenic
1190744477 X:53313896-53313918 CATTCTATGAATCGGAAGGCTGG + Intronic
1193256077 X:79350697-79350719 CCTTCTTGGAAGTGAAAATCTGG + Intergenic
1193270464 X:79523762-79523784 CCTACTTGAGAGTGGAAGGCAGG + Intergenic
1200215329 X:154365706-154365728 TCTTCTTGGAAGGGGGAGGGTGG - Intronic
1201434240 Y:13939707-13939729 CATTCTTGGAGCAGGAAGGCTGG - Intergenic