ID: 1001084268

View in Genome Browser
Species Human (GRCh38)
Location 5:168689135-168689157
Sequence TCTGATTCAGGGAGTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001084262_1001084268 3 Left 1001084262 5:168689109-168689131 CCCAGGGATCTTGTTAAAATGTG 0: 3
1: 10
2: 67
3: 299
4: 895
Right 1001084268 5:168689135-168689157 TCTGATTCAGGGAGTCTGGGTGG No data
1001084263_1001084268 2 Left 1001084263 5:168689110-168689132 CCAGGGATCTTGTTAAAATGTGT 0: 1
1: 2
2: 6
3: 93
4: 405
Right 1001084268 5:168689135-168689157 TCTGATTCAGGGAGTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001084268 Original CRISPR TCTGATTCAGGGAGTCTGGG TGG Intronic
No off target data available for this crispr