ID: 1001085638

View in Genome Browser
Species Human (GRCh38)
Location 5:168698473-168698495
Sequence TCCCTGGCTTCTGGTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 337}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001085638_1001085642 -10 Left 1001085638 5:168698473-168698495 CCAGGAACACCAGAAGCCAGGGA 0: 1
1: 0
2: 6
3: 39
4: 337
Right 1001085642 5:168698486-168698508 AAGCCAGGGAGGGACAAGCAAGG 0: 1
1: 0
2: 7
3: 60
4: 517
1001085638_1001085644 5 Left 1001085638 5:168698473-168698495 CCAGGAACACCAGAAGCCAGGGA 0: 1
1: 0
2: 6
3: 39
4: 337
Right 1001085644 5:168698501-168698523 AAGCAAGGACCCTCCCCTAGAGG No data
1001085638_1001085647 14 Left 1001085638 5:168698473-168698495 CCAGGAACACCAGAAGCCAGGGA 0: 1
1: 0
2: 6
3: 39
4: 337
Right 1001085647 5:168698510-168698532 CCCTCCCCTAGAGGCTCAGAGGG No data
1001085638_1001085652 21 Left 1001085638 5:168698473-168698495 CCAGGAACACCAGAAGCCAGGGA 0: 1
1: 0
2: 6
3: 39
4: 337
Right 1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG No data
1001085638_1001085645 13 Left 1001085638 5:168698473-168698495 CCAGGAACACCAGAAGCCAGGGA 0: 1
1: 0
2: 6
3: 39
4: 337
Right 1001085645 5:168698509-168698531 ACCCTCCCCTAGAGGCTCAGAGG 0: 1
1: 1
2: 1
3: 36
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001085638 Original CRISPR TCCCTGGCTTCTGGTGTTCC TGG (reversed) Intronic
900827932 1:4941453-4941475 CCCCTGTCTTCTGGTCTTCAGGG + Intergenic
900933777 1:5752789-5752811 ACCCTGGTTTCTGGGGTCCCGGG - Intergenic
902331388 1:15732741-15732763 TCCCTGGCTAATGGGTTTCCTGG - Intronic
902735722 1:18399398-18399420 TTCCTGGCTGCTGGTGCTCCCGG + Intergenic
902839005 1:19063653-19063675 TCCCCGGCTGCTGCTGTTACCGG + Intergenic
902914095 1:19625558-19625580 TCCCTGGCTCCTCGCTTTCCTGG + Intronic
903516239 1:23912831-23912853 CACCTGGCTTCTTGTGTCCCTGG + Intronic
903695693 1:25204958-25204980 TTCCTGGGTGCTGCTGTTCCAGG + Intergenic
904581881 1:31549578-31549600 TCCCTGGCCGCCTGTGTTCCTGG - Intergenic
906177477 1:43787236-43787258 TCCCAGGCTCCAGCTGTTCCTGG - Intronic
906218741 1:44060555-44060577 TCACTTACTTCTGGTGTTCCTGG - Intergenic
906326081 1:44846917-44846939 TTGCTGGGTTCTGGTGTTGCAGG + Intergenic
906667342 1:47631347-47631369 TCCCTTGCTTCTGATATTCTAGG + Intergenic
907067122 1:51495186-51495208 GACCTGGCTTCTGGTGTGTCAGG - Intronic
907525455 1:55051330-55051352 TTCCTGGCTGCAGGGGTTCCAGG + Intronic
907580980 1:55572524-55572546 TTCCTAGCTTCTGGTGCTCTAGG + Intergenic
907941424 1:59091619-59091641 TCCCTGGTCTCTGGTGTCCCAGG + Intergenic
908584641 1:65554683-65554705 TCCCTGGCTTCAGCCTTTCCGGG + Intronic
911973174 1:104462414-104462436 TCCCAGGCTTCAGGTGCTGCAGG + Intergenic
912005367 1:104892683-104892705 TCTCTGACTTCTGTTGTTTCCGG - Intergenic
912695831 1:111841728-111841750 TCCCTGGCTCCTGCTCTGCCAGG + Intronic
913225569 1:116695331-116695353 TACCTGGATTCTGGAGCTCCAGG - Intronic
918454446 1:184693794-184693816 TCCCTGGCCTGAGGTGTTGCAGG + Exonic
919319313 1:196014775-196014797 TCCATGGGTTTTGGTATTCCAGG + Intergenic
921122954 1:212152592-212152614 TCCCTGCCTACTGCTGTTCCAGG + Intergenic
921963110 1:221056936-221056958 TCCCTTGCTTCTGGTCATCAAGG - Intergenic
922614785 1:226955333-226955355 TCCCTGGCTCCCGCTTTTCCTGG + Intronic
922615215 1:226957132-226957154 TCCCTGGCTCCTGCTCTCCCTGG + Intronic
922615219 1:226957148-226957170 TCCCTGGCTTCCGCTCTCCCTGG + Intronic
923494090 1:234509558-234509580 TCCCTGCCTTCTTGTGTAGCTGG + Intergenic
924094706 1:240539260-240539282 TGGCTGGCTTGTGGTCTTCCTGG + Intronic
924183533 1:241463717-241463739 TCCCTGTCCTTTTGTGTTCCAGG + Intergenic
924234663 1:241990672-241990694 TCCCAGCCTTCAGGTGTTTCTGG + Intergenic
1066384840 10:34933318-34933340 CTCCTGGCTTCAGGTGATCCTGG - Intergenic
1068980328 10:63056115-63056137 ACCCTGGAGTCTGATGTTCCAGG - Intergenic
1069512283 10:69051393-69051415 TTCCTGGCTTCTGGTGTTGCTGG + Intergenic
1070534664 10:77366802-77366824 TCCCTGGCATCTTCTGTTCTTGG + Intronic
1070599607 10:77856627-77856649 CCCCTGGCTCCTGGGGGTCCAGG - Intronic
1070630177 10:78079234-78079256 TCCCTTGCTTCTGGGGTTTGAGG + Intergenic
1070761685 10:79028015-79028037 TGCCTGGCCTCTGGAGCTCCTGG - Intergenic
1071570115 10:86692131-86692153 TCCCTGGCTTCTGCAGTGCTGGG - Intronic
1071573801 10:86711737-86711759 TCCCGGGCCTCAGGTGTTCCGGG - Intronic
1074518907 10:114198854-114198876 TCTCTGCCTTTTGGTGTTTCTGG + Intronic
1075714146 10:124546177-124546199 TCCCTGGCTGCTGGTGAGCAGGG + Intronic
1076260221 10:129059227-129059249 TCCGTGGATTATGGTGTGCCAGG + Intergenic
1076751874 10:132547349-132547371 TTCCTGGCGTCAGGTGTTCTCGG + Intronic
1076751918 10:132547529-132547551 TGCCTGGCATCTGGGGTTCCCGG + Intronic
1076834661 10:133014970-133014992 TCCCTGGCTTCTGGGAGGCCCGG + Intergenic
1077360902 11:2139699-2139721 TCCCGGGTTTCTGGGGTGCCCGG + Intronic
1078601770 11:12738522-12738544 TGCCTGCCTTCTGGTATCCCGGG - Intronic
1081633352 11:44704170-44704192 ACCCTGCCTCCTGGTGTTCATGG - Intergenic
1081978978 11:47254458-47254480 TCCCTGGTTTCTGCTTTTCCAGG + Intronic
1081999119 11:47383330-47383352 ACCCTGGCTTCTGGGGCTCTAGG + Intergenic
1082938044 11:58674876-58674898 AGCCTGGCTTCTCCTGTTCCGGG + Intronic
1083189099 11:61036598-61036620 TCCCAGGCATCTGGAGTGCCAGG + Intergenic
1083442889 11:62688475-62688497 TCCCTGCCTTCTGTGGCTCCTGG - Exonic
1083857479 11:65400324-65400346 TGGCTGGCTTCTGGTTGTCCCGG + Intronic
1083942966 11:65907814-65907836 TCCCAGGCTTCAGGCCTTCCTGG - Intergenic
1084117752 11:67051895-67051917 TCCCACGCTTCTGATCTTCCAGG - Intergenic
1084183332 11:67457394-67457416 TCCTTGGCTGCTGGGGTACCAGG - Intronic
1085293651 11:75418047-75418069 ACCCTGGTTGCTGGTGGTCCTGG - Intronic
1085381353 11:76121986-76122008 TCCCTGGCTTCTGTAATGCCAGG - Intronic
1085517471 11:77119754-77119776 TCCTTGGCATCTGATGTGCCTGG + Intronic
1085965969 11:81526837-81526859 TCCCTGGCTAGTTGTATTCCTGG + Intergenic
1086917543 11:92547923-92547945 TCCTTGGCTTCTTGGGCTCCTGG + Intronic
1088066445 11:105726057-105726079 TCCCTGGCTTCAGCCTTTCCAGG - Intronic
1090986059 11:131767297-131767319 TCCCAAGCTGCTGGGGTTCCAGG - Intronic
1091381653 12:66156-66178 CCCCAGGATTCTTGTGTTCCAGG + Intergenic
1092081878 12:5723330-5723352 TCCCTGCCTTCTGCTCATCCAGG + Intronic
1092742571 12:11644295-11644317 TCCCTAGCTTCAGGTCTTACGGG - Intergenic
1096900080 12:54868184-54868206 TCCCTGGCTACCTGTGTTCCTGG + Intergenic
1098300306 12:69047525-69047547 TCCCTGGCTCCTTCTGTACCAGG - Intergenic
1100183244 12:92107931-92107953 TCACTGGCCTTTGCTGTTCCTGG - Intronic
1101015510 12:100496393-100496415 TCTCTGGCTTCTTGTCTTTCAGG - Intronic
1101221289 12:102643992-102644014 TCTGTGGGTCCTGGTGTTCCTGG + Intergenic
1101953463 12:109194104-109194126 TCCCCAGCTTCTGGTGCTGCTGG + Intronic
1103285327 12:119796289-119796311 TCCCTTGCCTCTGGTTTTCCTGG - Intronic
1104566596 12:129890433-129890455 CCACTGGCTGCTGGTGTTCCTGG + Intronic
1104587327 12:130057754-130057776 TCCCCGGCTTCTGGTGTCTGCGG - Intergenic
1104607742 12:130202422-130202444 GGCCTGGCTTCTGGGGTCCCTGG + Intergenic
1105426596 13:20300138-20300160 TCCCTGTCTTCAGCAGTTCCTGG + Intergenic
1105885752 13:24639652-24639674 ACCCTGGCCTCTTCTGTTCCTGG - Intergenic
1106581269 13:31020404-31020426 TCCCTGCCTCCTGATGTTCATGG - Intergenic
1107451878 13:40517170-40517192 TCCCTAGCTTCTGGTGTTGCAGG - Intergenic
1107756975 13:43635046-43635068 CCCCTTGCTTCTGATCTTCCAGG - Intronic
1109447932 13:62469724-62469746 TCCCTGGATTTTGGTATTCTTGG + Intergenic
1112364550 13:98745625-98745647 TCTCTTGCTTCTGGTGTGGCTGG - Intronic
1113117078 13:106885276-106885298 TCCCCACCTTCCGGTGTTCCTGG - Intergenic
1113415054 13:110122522-110122544 TTCCTGACTTCTGGTGGTGCCGG + Intergenic
1113513630 13:110874514-110874536 TCCCTGGCTGCAGCTGTGCCCGG + Intergenic
1113956161 13:114100787-114100809 TCCACGGCTTCCGGTGTCCCTGG - Intronic
1116161298 14:41269413-41269435 TCACTTACTTCTGGTGTTACTGG - Intergenic
1116761140 14:49016270-49016292 TCCCTGAATTCTGTTATTCCGGG + Intergenic
1118885415 14:69861594-69861616 TCCCTGGCTTCCCATGTGCCAGG + Intronic
1119173873 14:72555035-72555057 GCCCTCCCTGCTGGTGTTCCTGG - Intronic
1119895569 14:78216815-78216837 TTCTCGGCTTCTGGTGTTACCGG + Intergenic
1119916467 14:78406669-78406691 TGCCAGTCTTCTGATGTTCCTGG + Intronic
1120481663 14:85056447-85056469 TTCCTAGTTTCTGGTGTTGCTGG - Intergenic
1120487933 14:85138197-85138219 CTCCTGATTTCTGGTGTTCCTGG + Intergenic
1121559639 14:94864934-94864956 TTGCAGGCTTCTGGTGGTCCTGG + Intergenic
1121599250 14:95190973-95190995 TCCCTGGATTCTGCCATTCCTGG + Exonic
1122046667 14:99028882-99028904 TACCTGGCTTCTGGTGGTGAGGG - Intergenic
1122538315 14:102481779-102481801 CCCCTGACTTCAGGTGTTTCTGG + Intronic
1122862803 14:104590059-104590081 TCCCTGGCACCTGGAGTTGCAGG - Intronic
1123178313 14:106443034-106443056 TCCCTGTCTTCAGGGGATCCTGG + Intergenic
1123971371 15:25511118-25511140 TCCCTACCTTCTGTTGTGCCAGG + Intergenic
1124904884 15:33858975-33858997 CCCCTGGCTTTTGATTTTCCAGG + Intronic
1125188974 15:36967411-36967433 TACCTGCATTCTGGTGTTCTTGG - Intronic
1125412064 15:39416041-39416063 TCCCTGGTTCCTGGTGCCCCAGG - Intergenic
1125646713 15:41278745-41278767 TTCCTGGCTCTTGGTCTTCCAGG + Exonic
1126193701 15:45906448-45906470 TGCCTGGCTTCAAGAGTTCCTGG - Intergenic
1129246319 15:74280965-74280987 AGACTGGCTTCTGGGGTTCCAGG - Intronic
1129870027 15:78934167-78934189 TCCCGGGCTTGCAGTGTTCCTGG - Intronic
1130705416 15:86228600-86228622 TCCCTCACTTCTGCTTTTCCTGG - Intronic
1130900071 15:88200366-88200388 TGCCTGGCATCTGGTGTTCCTGG + Intronic
1131185792 15:90272860-90272882 TCCAGGGCTTCTGGAATTCCGGG + Exonic
1131356727 15:91751752-91751774 TGCCTGGTTTCTGCTGTTCCTGG + Intergenic
1131731053 15:95281853-95281875 TTTCTGGCTTCTGGCTTTCCAGG + Intergenic
1134169904 16:11960321-11960343 CCCCTGGCTTCTGGCTTCCCAGG + Intronic
1134856139 16:17521070-17521092 TCCCAGGCTGCTGGTGTTCATGG + Intergenic
1135039302 16:19105528-19105550 TCCCTTGTTACTGGTGGTCCTGG + Intergenic
1136552247 16:30987946-30987968 CTACTGGCTGCTGGTGTTCCTGG + Exonic
1137354294 16:47744631-47744653 ATCCTGGCTTCTCCTGTTCCTGG - Intergenic
1140038344 16:71388609-71388631 TCACTGGCTTCTTGTGTTCAGGG - Intronic
1140196769 16:72861579-72861601 TTCCTGGACTCTGGTTTTCCAGG - Intronic
1141678373 16:85529660-85529682 GCCCTGGCTTTAGGTGTCCCTGG + Intergenic
1143101352 17:4506419-4506441 TCCCTGGCCCCTGGTGGTCTTGG + Intronic
1145786700 17:27598327-27598349 TCTCTGGCCTCTGGAGCTCCAGG + Intronic
1146054694 17:29575192-29575214 GCCCTGGGTTCTGCTGTCCCTGG - Intronic
1146472036 17:33132298-33132320 TCCCTTGCTTCAGTTCTTCCTGG + Intronic
1146614947 17:34348980-34349002 TGCCTGGCTTTTGTTGCTCCTGG + Intergenic
1147282297 17:39371959-39371981 TCCCTGCCTTCTGTTGTACGTGG + Intronic
1148172564 17:45534948-45534970 TCCCACGCTTCTGGAGCTCCTGG - Intergenic
1148276706 17:46310502-46310524 TCCCACGCTTCTGGAGCTCCTGG + Intronic
1148287917 17:46412428-46412450 TGCTTAGCTTCTGGTGTTGCCGG + Intergenic
1148298823 17:46528090-46528112 TCCCACGCTTCTGGAGCTCCTGG + Intronic
1148310087 17:46630008-46630030 TGCTTAGCTTCTGGTGTTGCCGG + Intronic
1148363355 17:47032587-47032609 TCCCACGCTTCTGGAGCTCCTGG + Intronic
1149868526 17:60163462-60163484 TCCCGGGCTCCTGCTGTCCCCGG + Intronic
1150403768 17:64881871-64881893 TCCCACGCTTCTGGAGCTCCTGG - Intronic
1151133086 17:71918629-71918651 CCACTGGATTTTGGTGTTCCAGG + Intergenic
1151314779 17:73314974-73314996 TCCCTGGTTCCTGGCGTTCCAGG + Intergenic
1151597542 17:75087716-75087738 TTTCTAGCTTCTGGTTTTCCCGG - Intronic
1151676822 17:75602958-75602980 TCCCTGGGGTCTGGTGTGGCGGG - Intergenic
1151727353 17:75892664-75892686 TCCCTGCTGCCTGGTGTTCCAGG + Intronic
1152787220 17:82254904-82254926 TCACTGGCTTCTGGAGGCCCCGG - Intronic
1156593846 18:38523191-38523213 CTCTTAGCTTCTGGTGTTCCTGG + Intergenic
1156894703 18:42232460-42232482 TCCCTGCATTCTGGTGAGCCAGG + Intergenic
1157054539 18:44210945-44210967 TCCCTGGCTAGTTATGTTCCTGG + Intergenic
1157680961 18:49605732-49605754 TTTTTGGCTTCTGGTGTTCAAGG + Intergenic
1158077959 18:53553182-53553204 TTCCTAGCTTCTGGTGTTCCTGG - Intergenic
1158380283 18:56922054-56922076 GCCATGGCTGCTGGTGTTTCAGG + Intronic
1158405891 18:57158627-57158649 TCCCTGCCTTTTGGTCTTCATGG + Intergenic
1158970389 18:62660963-62660985 TCCCAGGCTACTGTTTTTCCAGG + Intergenic
1159946437 18:74447580-74447602 TTCCTGGCCTCTGGCTTTCCCGG - Intronic
1160510901 18:79452746-79452768 TCCCTGGTTTTGGGGGTTCCTGG + Intronic
1161018846 19:1998409-1998431 TCCCACGCTCCTGCTGTTCCTGG - Intronic
1161319895 19:3636303-3636325 GCCCTTGGTTCTGGTCTTCCTGG - Intronic
1161477191 19:4493436-4493458 ACCCGGGCTTCTGATGTACCCGG + Intronic
1162155760 19:8677195-8677217 TCCCTGGATGCTGGGATTCCAGG + Intergenic
1162297257 19:9821805-9821827 CCCCTTGCTTCTTGGGTTCCTGG - Intronic
1163145710 19:15378365-15378387 TCCCTGATTTCTTGTGTTTCCGG - Intronic
1163464031 19:17455760-17455782 TCCGTGGCTCCTGGTCCTCCAGG + Exonic
1163491882 19:17621675-17621697 TCTCTGACTTCTGGTTTTGCAGG + Intronic
1164574722 19:29399060-29399082 GCCCAGGCTTCTGCTGTTCTTGG + Intergenic
1164721029 19:30431726-30431748 TCCCTGGCTGCTGCTGCCCCAGG + Intronic
1166850114 19:45755901-45755923 TCCCCTGCTTCTGGGCTTCCTGG + Intronic
1167088124 19:47324373-47324395 TTCCTGGCTTCGGGAGTTGCAGG + Intergenic
1168582627 19:57568229-57568251 TTGTTGACTTCTGGTGTTCCTGG - Intergenic
925010457 2:481500-481522 CCGCTGGCTTCAGGTGTACCCGG - Intergenic
926272896 2:11379918-11379940 TCCCTGAGTTATGATGTTCCTGG - Intergenic
927693036 2:25221867-25221889 TCCCTGACTTCTGGAGGCCCAGG - Intergenic
928007193 2:27573521-27573543 GCCCTGGCAACTGATGTTCCTGG - Intergenic
928092352 2:28382782-28382804 TCCCTTGCTTCTGTCTTTCCAGG + Intergenic
928106949 2:28476688-28476710 TCCCTGGAGCCTTGTGTTCCAGG - Intronic
929048748 2:37816262-37816284 TCCGCGGCTTCTGGTGATTCAGG + Intergenic
929745855 2:44657600-44657622 TCCCTGACTACAAGTGTTCCTGG + Intronic
931103492 2:59029295-59029317 TCCCTGGCTGCTGGTTCTCTAGG + Intergenic
932327177 2:70871110-70871132 TCCCTGGCTCCTGATCCTCCTGG + Intergenic
932451197 2:71811915-71811937 TCCCTGGCGTCTGGAGTCCAAGG + Intergenic
934067643 2:88354333-88354355 TTCCTAGCTACTGGTGTTGCTGG - Intergenic
935721303 2:105981748-105981770 TCCCAGTCTACTGATGTTCCAGG + Intergenic
936061621 2:109298674-109298696 TCCCTGGCTCCTGTGGGTCCAGG + Intronic
937374886 2:121329352-121329374 TCCCTGTCTCTTGTTGTTCCTGG - Intergenic
938624397 2:133092363-133092385 TTCCTAGCTTCTGGTGTTACCGG - Intronic
941043051 2:160644847-160644869 TTCCTAGCTTCTGGTGATGCTGG - Intergenic
941367203 2:164622518-164622540 TCCCTGGCATCTGCTTTACCAGG + Intergenic
942581582 2:177424735-177424757 TCACTGGCATCTGTTGTTTCTGG + Intronic
944896346 2:204169615-204169637 TCCACAGCATCTGGTGTTCCAGG + Intergenic
946806037 2:223472250-223472272 TCACTTGCTTCTGGTATTCCTGG + Intergenic
947854342 2:233313147-233313169 CCCCTGGCTTTTGGTGCCCCGGG - Intronic
947955317 2:234184833-234184855 CTCCTGGCCTCTGGTGTTGCCGG - Intergenic
948390204 2:237606452-237606474 TCTCTGGCCTCTGGTGCTCCTGG - Intergenic
948452609 2:238086075-238086097 TCCCTTTCTTCTGGTCTTTCTGG - Intronic
948636002 2:239338014-239338036 TCCCTGGCTTTCGGTGTGCTGGG - Intronic
948843276 2:240670117-240670139 CTCCTGGCTTCTAGTGTTGCTGG - Intergenic
948858643 2:240742400-240742422 TCCCTGGGTTTTGGTCTTGCAGG + Intronic
1171119065 20:22552564-22552586 TCTATGACTTCTGGTGTTCTAGG + Intergenic
1172841575 20:37905319-37905341 TCCCTGGGGTCTGGTGCTCTAGG - Intronic
1173105431 20:40129010-40129032 GCACTGGCATCTGGTCTTCCTGG + Intergenic
1173523176 20:43713831-43713853 ACCCTGGCTTCTGGGGACCCAGG - Intronic
1173705217 20:45105226-45105248 TCACTGGCTTCTTCTCTTCCTGG + Intergenic
1173895292 20:46546183-46546205 TCCCTGGCTGCTGCTGCTGCAGG - Exonic
1174688099 20:52475002-52475024 ATCCTGGCTTATGGTGTTCCAGG - Intergenic
1175769563 20:61614984-61615006 CACCTGGTTTCTGGTGTTCTGGG - Intronic
1175913998 20:62417252-62417274 TCAGTGTCTTCTGCTGTTCCCGG + Exonic
1176103772 20:63376156-63376178 TTCCTGGAATCTGGGGTTCCTGG - Intronic
1176283553 20:64328677-64328699 CCCCAGGATTCTTGTGTTCCAGG - Intergenic
1178761003 21:35402945-35402967 TCCCTGGCTTCTGGGGATGCTGG + Intronic
1179350097 21:40600913-40600935 TCACTAGCTTCTGGTGTTGGTGG - Intronic
1179907615 21:44432270-44432292 TCTCCAGCTCCTGGTGTTCCTGG + Intronic
1180731816 22:17988023-17988045 GCCTTGGCTTCGGGTGTTCTGGG - Intronic
1180858302 22:19062125-19062147 TCAATGGCTTCTGGGTTTCCAGG - Intronic
1181421190 22:22800163-22800185 TCCCTGGCTTCAGGTGCTTCTGG + Intronic
1182283957 22:29233189-29233211 TCCCTGCCTCCTGGTCTTGCGGG + Intronic
1184091441 22:42295025-42295047 CCCATGGCTGGTGGTGTTCCAGG - Intronic
1184746805 22:46460967-46460989 CCCCTGGCTTCTTGTGTTGCGGG - Intronic
1185238650 22:49728858-49728880 TCCCAGGCTTCTGGTTCCCCTGG - Intergenic
949953413 3:9248123-9248145 TGCCTGGCTTCCGGGGTTCCAGG - Intronic
950149851 3:10678499-10678521 GCCCTGGCTTCTGGGGGCCCAGG + Intronic
952222733 3:31341213-31341235 TCGGTGGCTTCTGGGCTTCCTGG - Intergenic
954082785 3:48222246-48222268 TCCCTGGCCTCGGGTTTCCCTGG - Intergenic
954710195 3:52501724-52501746 GCCCTGGCTACTGGGGTTCCCGG + Exonic
955603671 3:60675422-60675444 TCTCTGGCTTCTTTTGTTCCCGG - Intronic
955757180 3:62237179-62237201 TCTGTGGCTTCTGTTTTTCCGGG - Intronic
956470128 3:69557741-69557763 TCCTTGGTTTTTGGTCTTCCAGG + Intergenic
956540430 3:70332327-70332349 TTCCCCGCTCCTGGTGTTCCAGG + Intergenic
956643084 3:71432639-71432661 TCCCAGGATTCTGGTGCTGCAGG - Intronic
957074056 3:75587838-75587860 TCCCTGCCAGCTGGAGTTCCAGG + Intergenic
957281087 3:78152609-78152631 TCCCTGCCTTCTGGTGTGCATGG - Intergenic
958743484 3:98104825-98104847 GCCCTTGTTCCTGGTGTTCCTGG + Intergenic
959574029 3:107914806-107914828 TGCCTGGCCTCTCCTGTTCCTGG + Intergenic
960874928 3:122286734-122286756 TCCCTGGATGCTGGAGGTCCAGG - Intergenic
961183607 3:124895688-124895710 GCCATGGCTTCTTGTGTACCTGG - Intronic
961722715 3:128907233-128907255 TCCTTGGCTGCTTTTGTTCCTGG + Intronic
961938713 3:130614079-130614101 TCCCTGTATTCTGGTTTTCAAGG + Intronic
962993763 3:140604920-140604942 TTTCTGGCTTCTGGGGGTCCTGG - Intergenic
965641214 3:170830762-170830784 TGCCTGGCTTCTGATTTTGCTGG + Intronic
967256656 3:187600023-187600045 TTCCTGGCTTCTGGTGTTTGTGG - Intergenic
968169595 3:196499295-196499317 TCCTTAGCTTCTGGTGTGGCTGG - Intronic
968229545 3:196997295-196997317 TTCCTAGCTTCTGATGTCCCTGG - Intronic
968634739 4:1672162-1672184 TCCGTGGGTTCTTGGGTTCCTGG - Intronic
969839639 4:9871453-9871475 CTCCTGGCTTCTGGTGCTGCTGG + Intronic
970034188 4:11713280-11713302 TCCCCGACTTTTGGTGTTCTTGG - Intergenic
970478158 4:16445665-16445687 CTCATGGCTTCTGGTGTTGCAGG + Intergenic
980942319 4:139286463-139286485 TCCCAGGCTTCAATTGTTCCTGG + Intronic
981968625 4:150637440-150637462 TCCCTGCCTCCTAGTGTTCATGG + Intronic
982137141 4:152282479-152282501 TCCCTTTCTTGTGATGTTCCTGG + Intergenic
982478196 4:155878100-155878122 AGCCTGGCTTCTCCTGTTCCTGG - Intronic
984478708 4:180270753-180270775 TTGCTGGCTTCAGGTGTTCCTGG - Intergenic
985482302 5:121568-121590 TTCCTGGATTCAGGTGTTTCCGG - Intergenic
985770364 5:1806165-1806187 TCCCAGCCTCCTGATGTTCCGGG - Intronic
987118913 5:14748242-14748264 TCTCTTGCTTCATGTGTTCCTGG - Intronic
988802560 5:34710252-34710274 TTCCTAGCTTCTGGTTTTGCTGG + Intronic
990194689 5:53301452-53301474 ATCCTAGCTTCTGGTGTTGCCGG + Intergenic
991101096 5:62794118-62794140 TCCCTTTCTTCTGTAGTTCCTGG + Intergenic
992059321 5:73026242-73026264 CCCCTGACCTCAGGTGTTCCAGG - Intronic
992229848 5:74653433-74653455 TTGCTGGCTTCTGTTGTTTCAGG - Intronic
994024248 5:95063280-95063302 TCCCTGAGTTCTGGTGTTTGAGG - Intronic
994130640 5:96223701-96223723 TACATGGCTGCAGGTGTTCCTGG + Intergenic
994759186 5:103832501-103832523 TCCTAGGCTTCTGTTGTTTCTGG - Intergenic
996452946 5:123647535-123647557 TCCCTGCCTCCTGGTATTCCTGG - Intergenic
996500728 5:124213369-124213391 TCCCTGACTCCTTGTGTTCCCGG - Intergenic
997405821 5:133645809-133645831 TTTCTGGCTTCTGGTGTTCCAGG - Intergenic
997652899 5:135535503-135535525 TCCCGGGCGTCTGAGGTTCCAGG - Exonic
999639332 5:153655926-153655948 TACCTTGCTTCTGTTGTCCCTGG + Intronic
999977846 5:156929606-156929628 TTCCTAGCTTCTGGTACTCCAGG - Intronic
1000115618 5:158150784-158150806 TATGTTGCTTCTGGTGTTCCAGG - Intergenic
1000156937 5:158561551-158561573 TCACTGGCTTCTGGACTTCCAGG + Intergenic
1001085638 5:168698473-168698495 TCCCTGGCTTCTGGTGTTCCTGG - Intronic
1001121361 5:168983297-168983319 TCCCTGGCTTTAGGTGATCTTGG - Intronic
1001889529 5:175327582-175327604 TGCCTGGGCTCTGGTGTCCCAGG - Intergenic
1001994666 5:176146694-176146716 TCCCTGCCTTCTGAGGGTCCCGG - Intergenic
1002196734 5:177505179-177505201 CCCCTGGCTTGTGGAGTTCTGGG - Intronic
1002795749 6:469903-469925 TCCATGGTTTCAGGTGTCCCTGG - Intergenic
1002851567 6:1001426-1001448 TCCCAAGATTCTGGTGTTCAGGG + Intergenic
1003077842 6:2998859-2998881 TCCTTGATTTCTGGTGTCCCGGG - Intronic
1003421179 6:5959971-5959993 TGCCCGGCTTCTGGTGTCCCTGG + Intergenic
1005781705 6:29200269-29200291 TCCCTGATTTCTGGTATTACTGG - Intergenic
1005935520 6:30518007-30518029 TCCCGGGCCAGTGGTGTTCCGGG + Intergenic
1005964355 6:30716551-30716573 TCCCTGCCTTCTCGTGTTCCTGG + Intronic
1007780435 6:44250224-44250246 TCCCTGGCTTTTGCTTTCCCTGG + Intronic
1008243009 6:49135575-49135597 GCCCTGGCCTCTCCTGTTCCTGG - Intergenic
1008728827 6:54455067-54455089 TCCCAGGCTTCACTTGTTCCTGG - Intergenic
1011309541 6:85966999-85967021 TCCCTGGCTTGTGCTCGTCCTGG + Intergenic
1011492619 6:87907763-87907785 TTCTTGGCTTCTGATGATCCAGG + Intergenic
1012633862 6:101510337-101510359 TCTCAGGCTTCTGGTGGTCATGG + Intronic
1014462335 6:121711616-121711638 TCCCTGGCTCCTGGAGTCCAGGG + Intergenic
1015179225 6:130344378-130344400 TCCCTGGCTTCTTTTTTTACGGG + Intronic
1015546298 6:134364955-134364977 TCCCGGACTTCTGCAGTTCCTGG + Intergenic
1016763323 6:147764281-147764303 TCCCTGGCTTCTGGCTTGTCAGG - Intergenic
1018748022 6:166777466-166777488 TGCCTGGGTTCTGGGGCTCCTGG - Intronic
1018748908 6:166784917-166784939 TTCCTGGCTTCTGTTGTACACGG + Intronic
1018993514 6:168692783-168692805 TCTCTAGCTCCTGGTGGTCCCGG + Intergenic
1019669548 7:2270089-2270111 TCCCTGGGCTCTGGTGTCCCTGG - Intronic
1019677560 7:2323722-2323744 GTCCTGGCTTCTGGCGTGCCAGG - Intronic
1020658677 7:10956756-10956778 CTACTGGCTTCTGGTGTTCCTGG - Intergenic
1021806093 7:24357474-24357496 TCCCTGGCTTCTTGAGCTCTAGG + Intergenic
1022594252 7:31697053-31697075 TCCTTGGCTTTTTCTGTTCCAGG - Exonic
1022779555 7:33565538-33565560 TCCCTGTCTTTTTGTTTTCCAGG + Intronic
1023039555 7:36160423-36160445 TCCCTGGCTTCTTCCGTGCCTGG - Intronic
1023057815 7:36303865-36303887 TCCCAGGCTCCAGCTGTTCCTGG + Intergenic
1023484347 7:40668753-40668775 TCCTTGTCTTTTGGTGTTCTTGG - Intronic
1023529295 7:41136516-41136538 TCCCAGGCTTCAGCTGTCCCTGG + Intergenic
1023575764 7:41624946-41624968 TCCCTTGCTACTGGTGGCCCAGG - Intergenic
1023691255 7:42790259-42790281 CTCCTAGCTTCTGGTGTTGCTGG + Intergenic
1024174583 7:46825842-46825864 TCCCTTCCTTCTGGCCTTCCTGG - Intergenic
1024655012 7:51444978-51445000 GCCCTGGCTTCTTGTCTTCAGGG - Intergenic
1024816788 7:53280839-53280861 TCCTTGGCTTCTGGGATTCATGG + Intergenic
1024944551 7:54795490-54795512 TTCCTGGCTTCAAGTGTTCTCGG - Intergenic
1026052093 7:66955480-66955502 TCCCTGGCTTGCTGTCTTCCAGG + Exonic
1026734544 7:72941370-72941392 TCGAGGGCTGCTGGTGTTCCCGG + Intronic
1026784878 7:73296278-73296300 TCGAGGGCTGCTGGTGTTCCCGG + Intergenic
1026870819 7:73850344-73850366 ACTCTGGCCTCTGCTGTTCCTGG + Intergenic
1026965324 7:74435598-74435620 TCCCTGCCTTCTTGTCTGCCCGG - Intergenic
1027267258 7:76501220-76501242 TCCCTGGGTACTGGGGCTCCTGG - Intronic
1027319070 7:77001088-77001110 TCCCTGGGTACTGGGGCTCCTGG - Intergenic
1027984305 7:85266833-85266855 TCCCTGGCTTTTGTTGCTTCTGG - Intergenic
1029692412 7:102191073-102191095 TCCCTGGCGTCTGCTGGCCCTGG + Intronic
1030499330 7:110339851-110339873 TTCCAGCCTTCTGTTGTTCCTGG - Intergenic
1030821662 7:114099702-114099724 TCCTTGGATTCTGGTGTCCAAGG - Intronic
1031023173 7:116650398-116650420 TTCCTAGCTTCTGGTGTTTGTGG + Intergenic
1031657197 7:124372497-124372519 TCTCTGGCTTCCGTTGTTGCCGG - Intergenic
1032027830 7:128457384-128457406 TAGTTGGCTTCTGGTGGTCCAGG - Exonic
1032081802 7:128862859-128862881 TCAGTGGCTTCTGGTGCTCTAGG + Intronic
1032571902 7:133009467-133009489 TCCCTGGCTTCTGGGAATCAGGG - Intronic
1032580077 7:133096240-133096262 AGCCTGGCTTCTCCTGTTCCTGG - Intergenic
1033094028 7:138414096-138414118 TTCCTGGCTTTTGGTGGCCCCGG + Intergenic
1033362913 7:140650624-140650646 TTCCTGCCTTCTGGTTTTCTAGG - Intronic
1035129741 7:156640779-156640801 TCCCTGGGTTCCGGTGTTCGCGG + Exonic
1035191779 7:157176168-157176190 TCCTGGGCTTCAGGTGTTTCTGG - Intronic
1035423710 7:158752319-158752341 TTCATGGCTTCTGGTGCTGCTGG - Intronic
1035436557 7:158863955-158863977 TCCTTAGCTCCTGGTGTTGCGGG + Intronic
1035882769 8:3260306-3260328 TCCCTGGCTTTGGGTGTTGCAGG + Intronic
1036179784 8:6574298-6574320 ATCCTAGCTTCTGGTGTTGCTGG + Intronic
1036533975 8:9627167-9627189 TTCCTGGCAGCTGGTGCTCCAGG + Intronic
1036936393 8:13006316-13006338 TGCCTGGCTTCTGCTCTTGCAGG - Exonic
1037609235 8:20462404-20462426 TCCCTGGCTTTTGCTGTCCATGG - Intergenic
1038040533 8:23720456-23720478 TTCCTGGCTTCTGGAGGCCCAGG - Intergenic
1038330882 8:26608357-26608379 TCCATTCTTTCTGGTGTTCCAGG + Intronic
1038911291 8:31967614-31967636 ACCCTGCCTTCTGGTTTTCATGG - Intronic
1039051286 8:33496669-33496691 TCTCTGCCTCCTGTTGTTCCAGG - Exonic
1039479311 8:37860020-37860042 TGCCTGGCTTCTGCTGCTGCTGG - Exonic
1039863824 8:41483515-41483537 TCTCTGGAGTCTGGTTTTCCCGG + Intergenic
1040595747 8:48835800-48835822 TCCATGGCTTTGGTTGTTCCTGG + Intergenic
1041320165 8:56604341-56604363 TCCCTGGTCTCTGCTGATCCTGG - Intergenic
1042584296 8:70318204-70318226 TCACTGGCTTATTGAGTTCCAGG - Intronic
1042760945 8:72270780-72270802 TCACTGATTTCTGGTGTTCCTGG - Intergenic
1042769598 8:72365344-72365366 TTCCTGGCTGCTGGCATTCCTGG - Intergenic
1045016797 8:98007457-98007479 TGCCTGGCTTTTGGTTTTGCAGG + Exonic
1045543724 8:103110045-103110067 TCCCTTGCTCCTGGAGTTACTGG - Intergenic
1045839325 8:106561140-106561162 TCCCTTGCTTGAGGTGTTCTAGG - Intronic
1046061947 8:109150843-109150865 TCATTGGCTTCTGCTGTTCCTGG - Intergenic
1047193289 8:122698360-122698382 TCCCTGTTGTCTGGTGTTCTTGG - Intergenic
1048368822 8:133759191-133759213 TTCTTAGCTTCTGGTGTTGCTGG + Intergenic
1049347555 8:142146824-142146846 ACCCTGGCTTCTGGGATTGCTGG - Intergenic
1049476169 8:142797888-142797910 TCCCAGGCTTCGGGCCTTCCCGG - Intergenic
1049534882 8:143174609-143174631 TCCCTGCCTACTGGGGGTCCTGG + Intergenic
1049572364 8:143375254-143375276 ACCCTGGCTTCTGGTGTCCTTGG + Intronic
1051323362 9:15935360-15935382 TCCCTGGGTCTTGGTTTTCCTGG + Intronic
1051859363 9:21606894-21606916 TTCCTGGCTTCTCATCTTCCAGG + Intergenic
1054755559 9:68954030-68954052 TCAATTGCTTCTGGTGTCCCTGG + Intronic
1055200573 9:73654757-73654779 TGCTTTGCTTCTGGTGCTCCTGG - Intergenic
1055848842 9:80600375-80600397 TCCATGGTTTCTGCAGTTCCAGG - Intergenic
1057859350 9:98627320-98627342 TACCAAGCTTCTGGTGGTCCAGG - Intronic
1059277253 9:113107367-113107389 GCTCTGATTTCTGGTGTTCCTGG - Intergenic
1059278998 9:113117184-113117206 GCTCTGATTTCTGGTGTTCCTGG + Intergenic
1060984665 9:127813241-127813263 TCCAGTGCTGCTGGTGTTCCAGG - Exonic
1062067486 9:134536565-134536587 TCCCTGTCTTCAGTTCTTCCAGG + Intergenic
1062385292 9:136306958-136306980 GCCCTGGCTGCTGGGGCTCCTGG + Intergenic
1186674291 X:11799677-11799699 TCCCTGGCTCCTGGGATTCACGG + Intergenic
1186961716 X:14743797-14743819 TTCCTAGCTTCTGGTGATTCGGG + Intergenic
1187847589 X:23556794-23556816 TTCCTGGTTTCAGGTCTTCCTGG - Intergenic
1189335135 X:40166564-40166586 TCCTTGGCTTCTGGGGCCCCAGG + Intronic
1189551772 X:42101090-42101112 TCTCTGGCCCCTGGAGTTCCAGG + Intergenic
1190319081 X:49169221-49169243 TACCTGGCTTCTGGTCATTCAGG - Intergenic
1192909996 X:75593330-75593352 TTCCCGGCTTCTGGTGTTACCGG - Intergenic
1193311282 X:80013695-80013717 TCCTTGGCCTCTGGTTTTTCAGG + Intergenic
1195069537 X:101266032-101266054 TGCCTGTCTTCCTGTGTTCCGGG + Intergenic
1195080060 X:101362240-101362262 TCACTGGCTTCTTGTTTTGCAGG - Exonic
1198234965 X:134728458-134728480 ACACTGGCTTCTGGTCTTCATGG - Intronic
1199767498 X:150952020-150952042 TCCCTGGCTGCTGCTTCTCCTGG - Intergenic
1199941189 X:152629483-152629505 TCTCAGGCTTCTGCTGTCCCAGG + Intergenic