ID: 1001085641

View in Genome Browser
Species Human (GRCh38)
Location 5:168698482-168698504
Sequence GCTTGTCCCTCCCTGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001085641_1001085652 12 Left 1001085641 5:168698482-168698504 CCAGAAGCCAGGGAGGGACAAGC 0: 1
1: 0
2: 5
3: 48
4: 349
Right 1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG No data
1001085641_1001085645 4 Left 1001085641 5:168698482-168698504 CCAGAAGCCAGGGAGGGACAAGC 0: 1
1: 0
2: 5
3: 48
4: 349
Right 1001085645 5:168698509-168698531 ACCCTCCCCTAGAGGCTCAGAGG 0: 1
1: 1
2: 1
3: 36
4: 201
1001085641_1001085644 -4 Left 1001085641 5:168698482-168698504 CCAGAAGCCAGGGAGGGACAAGC 0: 1
1: 0
2: 5
3: 48
4: 349
Right 1001085644 5:168698501-168698523 AAGCAAGGACCCTCCCCTAGAGG No data
1001085641_1001085647 5 Left 1001085641 5:168698482-168698504 CCAGAAGCCAGGGAGGGACAAGC 0: 1
1: 0
2: 5
3: 48
4: 349
Right 1001085647 5:168698510-168698532 CCCTCCCCTAGAGGCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001085641 Original CRISPR GCTTGTCCCTCCCTGGCTTC TGG (reversed) Intronic
900576555 1:3385439-3385461 GCTTGGCCAGCACTGGCTTCCGG + Intronic
900624317 1:3601114-3601136 GCTGCTCCCACCCTGCCTTCAGG + Intronic
900964676 1:5949735-5949757 GCTTGTCCCTGCATGGGTCCTGG - Intronic
901397697 1:8993389-8993411 GCTTGTCCTTCCCTGGCTTTAGG + Intergenic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
902293050 1:15447505-15447527 GCATGTCCCTCCCTGGACACTGG - Intronic
902609271 1:17587750-17587772 GCTTTTCCCTTCCTGCTTTCTGG - Intronic
903438255 1:23368559-23368581 TCTTTTCCCTCCTTGGCTTTTGG - Intronic
903473657 1:23604956-23604978 CCTTGCCCCTTCCTAGCTTCTGG - Intronic
903552829 1:24169812-24169834 CCCTGTCCCTCCCTAGCTTTGGG + Intronic
903975433 1:27146695-27146717 GCTTCAACCTCCCTGGCTCCAGG - Intronic
904151708 1:28446897-28446919 GCTAGTATCTGCCTGGCTTCGGG - Intronic
904463153 1:30692436-30692458 GCTCTGCCCTCCCTGGCTGCGGG - Intergenic
904661965 1:32092019-32092041 CCCTTTCCCTCCCTGGCTTGAGG - Intronic
905226833 1:36484388-36484410 GCTGGTCCCTCCCCTTCTTCAGG + Intergenic
905596723 1:39214088-39214110 CCTCCTCCCTCCCTGCCTTCAGG + Intronic
905727048 1:40261187-40261209 TCTTTTTCCTACCTGGCTTCAGG - Intronic
906444793 1:45886907-45886929 GCCTGGTCCTCCCTGGCCTCAGG + Intronic
907417104 1:54322165-54322187 TCTTGTCCCTTCCTGGCTGCTGG + Intronic
910065575 1:83146945-83146967 TCTTGTCTCTTCCTGGCTTCTGG - Intergenic
911973172 1:104462405-104462427 GGTTTTACCTCCCAGGCTTCAGG + Intergenic
912321635 1:108719364-108719386 CCTTGTCCCTTTCTGGGTTCAGG + Intronic
912510828 1:110189163-110189185 GCTTGTCTCTCTCTGGCTCCAGG + Intronic
912518102 1:110228400-110228422 CCTTGACTCTCCCTGGCCTCAGG - Intronic
913697805 1:121344606-121344628 GCTTCTGCTTCACTGGCTTCAGG - Intronic
914139750 1:144935445-144935467 GCTTCTGCTTCACTGGCTTCAGG + Intronic
915882989 1:159692615-159692637 CCTTGTCCCTGCCTGGGTTGTGG + Intergenic
916303879 1:163306833-163306855 TCATGCCTCTCCCTGGCTTCTGG - Intronic
916847680 1:168670056-168670078 TCTTGTCACTCCTTGGCTTATGG - Intergenic
916963653 1:169913426-169913448 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
916963663 1:169913478-169913500 CCTTGTTTCTTCCTGGCTTCTGG - Intergenic
917081275 1:171258945-171258967 CATTTTCCCTGCCTGGCTTCAGG - Intronic
917640151 1:176975509-176975531 GCTTGTCCATCACTGGCCTCCGG + Intronic
919986761 1:202681095-202681117 CCTGGTCCCACCCTGGCTCCTGG + Intronic
920383462 1:205549595-205549617 GCTTCTACCTCCCTGGGCTCAGG - Intergenic
920485197 1:206363256-206363278 GCTTCTGCTTCACTGGCTTCAGG - Intronic
920833627 1:209487644-209487666 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
920853439 1:209644956-209644978 GCTTCTCACTCCATTGCTTCTGG - Intronic
924744846 1:246822367-246822389 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1067179752 10:43975799-43975821 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1067282859 10:44886031-44886053 GCCTGTCCCTGCCAGGCTTGGGG - Intergenic
1067713455 10:48668544-48668566 GCTTCTTCCTCCCTGGCTCTGGG - Intergenic
1069296358 10:66849682-66849704 CCTTGACCCTCCCTAGCTTCTGG - Intronic
1069512282 10:69051384-69051406 CCTTTTCTCTTCCTGGCTTCTGG + Intergenic
1069754397 10:70764317-70764339 CCTGCTCCCTACCTGGCTTCAGG + Intergenic
1069792228 10:71030071-71030093 GCCTGGCCCTGCCTGCCTTCAGG + Intergenic
1070478804 10:76858825-76858847 TCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1072803925 10:98412295-98412317 GCTGAGCCCTCCTTGGCTTCTGG + Intronic
1074359611 10:112814589-112814611 GATTCTACCTCCCTGGGTTCTGG - Intronic
1074545528 10:114399403-114399425 GGTAGTCCCTCCCTGGCTGAAGG + Intronic
1075395876 10:122126675-122126697 GCTTCTCCCTCCCTCTCTCCAGG - Intronic
1075456530 10:122588574-122588596 CCATGGTCCTCCCTGGCTTCTGG - Intronic
1075629929 10:123994739-123994761 GCCTTTCCCTCCCGGCCTTCCGG - Intergenic
1075646344 10:124099351-124099373 CCGTCTCCCTCCCTGGCTCCTGG + Intergenic
1075728117 10:124620967-124620989 GCTTGTCCCTTCCTGCCACCAGG + Exonic
1076543679 10:131230004-131230026 GCTGCTCCCTTCCTTGCTTCAGG - Intronic
1076558581 10:131346296-131346318 GCGTGTCCATCCCAGGCTACTGG - Intergenic
1076727939 10:132421998-132422020 TCTTGTCCCTGCCTGGCAGCGGG - Intergenic
1076834654 10:133014961-133014983 CCCAGCCCCTCCCTGGCTTCTGG + Intergenic
1076905179 10:133357790-133357812 GCTCGGGCCTCCCTGGCTTCCGG - Intronic
1077231379 11:1459508-1459530 GCGGGACCCTCACTGGCTTCAGG - Intronic
1077258756 11:1604319-1604341 GCTTGGCCATCCCTGCCTCCTGG + Intergenic
1078643096 11:13114258-13114280 GCTTCTTCCTCCCTACCTTCTGG - Intergenic
1079009040 11:16813386-16813408 GCTTGTCCCCCACTGGCTAGGGG + Intronic
1080445038 11:32330964-32330986 GCTTCTCCCTACCTGGCAACTGG + Intergenic
1080712070 11:34758270-34758292 GCTAGGCCTGCCCTGGCTTCTGG + Intergenic
1081274912 11:41136638-41136660 TCCTTTCCCACCCTGGCTTCTGG + Intronic
1082659735 11:55895289-55895311 GTTTGTCTCTTCCTGCCTTCGGG + Intergenic
1083203000 11:61131673-61131695 CCTTGTCCCTCCAAGGCCTCTGG + Exonic
1083455798 11:62777928-62777950 CCTGCTCCCTCCCTGGATTCAGG + Intronic
1083832453 11:65241563-65241585 CTTTGTCCCTCCCTGCCTCCTGG + Intergenic
1084889003 11:72227612-72227634 TCTTGCCCCTCCTTGGCTTGGGG + Intronic
1085328198 11:75624777-75624799 GCACGTCCCTACCTGGCTCCAGG + Intronic
1085401541 11:76238765-76238787 GCCCCTCCCTCCCTGGCTCCAGG - Intergenic
1085683164 11:78597023-78597045 GCTTGGCTCTTCCTAGCTTCTGG + Intergenic
1085986935 11:81799202-81799224 GCTGGTATCTGCCTGGCTTCTGG - Intergenic
1087009676 11:93501472-93501494 GCTTGGCATTCCCTGGCTTGTGG + Intronic
1087045398 11:93840029-93840051 CCATGTCGCTCCCTGGCTTCAGG - Intronic
1087191279 11:95257208-95257230 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1088620332 11:111675272-111675294 GCATATCCCTGCCTTGCTTCTGG - Intronic
1089750767 11:120649562-120649584 GCATAGCCCTCGCTGGCTTCAGG + Intronic
1090395703 11:126416698-126416720 GCTCGCCCCGCCCTGGCGTCAGG + Intronic
1090838513 11:130470904-130470926 GCTTCTCCCTCCCTAGCCTCCGG + Exonic
1091019135 11:132082829-132082851 GTTTGTCCTTTCTTGGCTTCAGG - Intronic
1091283177 11:134393873-134393895 GCCTGTCCCTCCCTCTCTTTGGG - Intronic
1092242725 12:6845448-6845470 GCCTGTCCCTCCCTTGGTTTGGG - Intronic
1092534240 12:9372956-9372978 AATTGTCCCTCCTTAGCTTCTGG + Intergenic
1093772055 12:23029716-23029738 CCTTGCCTCTCCCTGGCATCTGG + Intergenic
1093827593 12:23713232-23713254 GCATGCCTCTCCCTAGCTTCTGG - Intronic
1094642770 12:32292188-32292210 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1096078085 12:48817363-48817385 GCTCATCCCTCCTTGGCTTGAGG - Intronic
1096533332 12:52255544-52255566 ACTTGTCCATCCCTTTCTTCTGG + Intronic
1097510064 12:60528435-60528457 ACTTTTCCCTCCTTGGCCTCTGG + Intergenic
1098204907 12:68098453-68098475 CCTTGCCTCTTCCTGGCTTCCGG + Intergenic
1098608492 12:72424183-72424205 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1099538327 12:83872767-83872789 TATTGTCCCTCACTGTCTTCTGG - Intergenic
1100370508 12:93964943-93964965 GCCTATCCCTGCCTGGCTTTGGG - Intergenic
1100596030 12:96072869-96072891 GCTTTTCCCACCCTTGCCTCAGG - Intergenic
1101425610 12:104585820-104585842 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1101634121 12:106523076-106523098 CCTTGCACCTCCCTGACTTCAGG + Intronic
1101675503 12:106913269-106913291 GCTTGGCCCTGCCAGGCTCCTGG + Intergenic
1101880690 12:108623580-108623602 GTCTGTGCCTCCGTGGCTTCTGG + Exonic
1102894725 12:116589550-116589572 CCTTGTCTGTTCCTGGCTTCTGG - Intergenic
1103275809 12:119711048-119711070 GCTTCTGCCTGCCTGGGTTCAGG - Intronic
1103991000 12:124799442-124799464 GCTTCGACCTCCCTGGGTTCAGG - Intronic
1104233104 12:126904467-126904489 GCCTCTACCTCCCTGGCTTAAGG + Intergenic
1104266820 12:127241140-127241162 CCTGGTCCCTCCCTGGCCTCAGG - Intergenic
1104496702 12:129247374-129247396 ACTTGTCCCTCTCTGGCTTTAGG + Intronic
1104655121 12:130568556-130568578 GCTTGTCTCTCCATTGCTTCTGG - Intronic
1104913165 12:132250039-132250061 ACCTGTCCCTCCGTGGCTGCTGG - Intronic
1106554296 13:30796921-30796943 GCTTGTGGCTCCATGGCTCCCGG + Intergenic
1107962453 13:45570558-45570580 GCTTGTACCCCTCTGGTTTCTGG + Intronic
1108372370 13:49783000-49783022 GCTTGTCCTTCCCTTGCTTTTGG - Intronic
1108580971 13:51827952-51827974 GTTTCTCCCTCCCTGGCCACTGG + Intergenic
1113484745 13:110645763-110645785 GCTTGACCCTCCCGGGCCTCAGG - Intronic
1113547506 13:111165549-111165571 GCTTGTTCCTCCAAGCCTTCTGG - Intronic
1113819404 13:113202200-113202222 GCATGTGCCTCCCTTTCTTCTGG - Intronic
1113857544 13:113456253-113456275 GCCTGGCCCCCGCTGGCTTCTGG - Intronic
1113942935 13:114028044-114028066 GTGTGGCCCTCCCTGCCTTCCGG - Intronic
1114214396 14:20645090-20645112 CCTTCTCCCTCCCTGCCCTCAGG - Intergenic
1114416371 14:22547414-22547436 CCTTGTCCATCACTGGCATCTGG + Intergenic
1114631214 14:24160761-24160783 GCCTGACCCTCCCTGGACTCAGG + Exonic
1117344887 14:54822110-54822132 GCTTTTCCCTCCCTTGCATGTGG - Intergenic
1117580881 14:57150625-57150647 CCTTGCCCCTCCCTAGCTTCTGG + Intergenic
1119322503 14:73740098-73740120 GCTCTGCCCTCCCTGGCTCCTGG - Exonic
1119484456 14:74978689-74978711 CCTTGTCCCTCCTTGTCTCCTGG - Intergenic
1119710648 14:76820428-76820450 CCTCGTCCCTCCCTGTCTGCTGG - Intronic
1120810524 14:88798679-88798701 GGTTGTGCCTGCCTGGCATCTGG - Intergenic
1121339565 14:93097194-93097216 GCTTGACCCTCCCTGTATCCAGG + Intronic
1121530536 14:94649688-94649710 CCTCCTCCCTCCCTGGCTTAAGG + Intergenic
1122202188 14:100129368-100129390 CCTTGTCCCTCTCTCGATTCTGG + Intronic
1122271025 14:100568527-100568549 GCTTGCCCCTCCCGGGCCCCAGG + Intronic
1122627313 14:103091150-103091172 GCCTCTCCCTCCCTGGCTTCAGG - Intergenic
1122767444 14:104081973-104081995 GCCAGTCGCTCCCTGGCTCCTGG - Intergenic
1122960216 14:105090762-105090784 GCTGGTACCTTCCGGGCTTCAGG + Intergenic
1123086403 14:105719061-105719083 GCTGGGCCCTCCTTGGCTTTTGG + Intergenic
1124111685 15:26795893-26795915 CCTTGCCTCTCCCTGGCTTCTGG + Intronic
1125825075 15:42669380-42669402 GCTTTTCCCTCCTTGACCTCTGG - Intronic
1126555393 15:49982197-49982219 GCCTGTCCTTCCCTGACTTCTGG - Intronic
1129489362 15:75908484-75908506 GCTGGTCTCACCCTGGCCTCAGG + Intronic
1130981643 15:88815978-88816000 CCTTGCCCCTTCCTGGCTTCTGG + Intronic
1132344701 15:101101200-101101222 GCTTGGCCCGGCCTGCCTTCGGG - Intergenic
1132799507 16:1744682-1744704 GCTTGACGCTCTCTGGCCTCCGG + Intronic
1133835261 16:9362138-9362160 CCTTGTCTTTTCCTGGCTTCCGG - Intergenic
1135396353 16:22134626-22134648 CCTTGCCCCTCCCTGGCTTCTGG + Intronic
1137020773 16:35425256-35425278 GGTTGCCCCGCACTGGCTTCTGG + Intergenic
1137056713 16:35749588-35749610 GCTCGACCCTGCCTAGCTTCCGG - Intergenic
1137815143 16:51391808-51391830 GCTTTTCTCACCCTGGATTCTGG - Intergenic
1138419981 16:56892757-56892779 GCTTCTCTCTCCCGGGATTCTGG - Intronic
1138567825 16:57846292-57846314 GCTTCTCCCGGCCTGGCTTTAGG - Intronic
1140220897 16:73043100-73043122 CCTTTTCCCTCCCTGGAGTCAGG - Intronic
1140487089 16:75302062-75302084 GCTTTTCCCTCCTTTGCTTGAGG - Intronic
1140929825 16:79617190-79617212 CCTTCTCCCTCCTTGACTTCTGG - Intergenic
1141484605 16:84330420-84330442 GCCTCTCCCTCCCTGGCAGCAGG - Intergenic
1142310152 16:89307577-89307599 GCAGGTCCCTCCCGGGCCTCCGG + Intronic
1143185089 17:5005077-5005099 TGTGGTCCCTCCCTGGCTCCAGG - Intronic
1143202624 17:5122911-5122933 GCTTGGCGGTCCCCGGCTTCGGG - Intronic
1143980083 17:10861420-10861442 GCTTCTTCCTCCGTGGCTCCTGG + Intergenic
1144779798 17:17802071-17802093 ACTTCTCCCTCCCCGGCCTCAGG + Intronic
1145820195 17:27826851-27826873 CCTTGTCCATCCCCTGCTTCAGG + Intronic
1146646048 17:34578311-34578333 GCTTCCTCCTCCCTGGCTGCTGG - Intronic
1148860928 17:50604041-50604063 ACTGGTCCCTTCCTGGCCTCTGG - Intronic
1149849374 17:60026233-60026255 GCTTGGCGGTCCCCGGCTTCGGG + Intergenic
1149860794 17:60120291-60120313 GCTTGGCGGTCCCCGGCTTCGGG - Intergenic
1150375643 17:64679279-64679301 GGTTGCCTCTTCCTGGCTTCTGG - Intergenic
1150596803 17:66613583-66613605 CCTTGCCTCTTCCTGGCTTCTGG + Intronic
1150652050 17:67016676-67016698 GCTTGTGGCTCCCAGGCTGCAGG + Intronic
1151336300 17:73441612-73441634 TCTTGCCCCTTCCTGGCTTCCGG - Intronic
1151632746 17:75322023-75322045 GCCTGTCCCTCTCTGGTTTCTGG - Intronic
1151880058 17:76889358-76889380 GCTCTTCCCTCCCTGCCTGCTGG - Intronic
1152114805 17:78378905-78378927 GCGAGTCCCTCCCCGGTTTCCGG + Intronic
1152375924 17:79919031-79919053 GCATGTGGCTCCCTGGCTTCTGG + Intergenic
1152796565 17:82310521-82310543 GCCTGTCCCTGCATGGCCTCTGG + Intergenic
1152854871 17:82658999-82659021 CCTGGGCCCTCCCTGGCTTGTGG - Intronic
1153230092 18:2926780-2926802 GATTTTCCCTCCTTGGATTCTGG + Exonic
1153342945 18:3994133-3994155 GCTTTTCCCTGCCTGGCACCGGG + Intronic
1153463632 18:5364611-5364633 TCCTGTCTCTTCCTGGCTTCTGG - Intergenic
1156256124 18:35398263-35398285 GCTTGCTCCTCAGTGGCTTCAGG + Intergenic
1156455819 18:37293310-37293332 CCTTGCCCCTTCCTAGCTTCTGG + Intronic
1157550197 18:48576061-48576083 GATTGTCCCTCCCGGTCCTCGGG + Intronic
1158003979 18:52651064-52651086 ACCTTTCCCTCCCTGACTTCAGG + Intronic
1158441231 18:57476075-57476097 GCTTCCCCCACCCTGGCGTCTGG + Intronic
1158602067 18:58863934-58863956 GCCTGTCCCACCCTGGCCTTGGG + Intronic
1158973322 18:62688335-62688357 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1159041308 18:63325469-63325491 TCTTGCCTCTCCCTAGCTTCTGG + Intergenic
1161006590 19:1940355-1940377 GCTTGTACCTGCCTGCCTTCCGG - Intergenic
1161127429 19:2566286-2566308 CCTTGGCCTTCCCTGGCTTGTGG - Intronic
1161717822 19:5886708-5886730 GCAAGTCCCGCCCTGACTTCTGG + Intronic
1161785033 19:6319308-6319330 GGGTCTCCCTCCCTGCCTTCCGG + Intronic
1161981996 19:7634782-7634804 CCTTGCCCCTCCCTGGCTTTTGG + Intronic
1162148443 19:8628258-8628280 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
1162208223 19:9071859-9071881 CTTTGTGCCTCACTGGCTTCAGG - Intergenic
1162234931 19:9301379-9301401 CCTTTTCTCTTCCTGGCTTCTGG - Intronic
1163055471 19:14714441-14714463 CCTTGCCCCTCCCTGGCTTCTGG - Intronic
1163055602 19:14715392-14715414 ACGTGACCCTGCCTGGCTTCAGG + Exonic
1164691962 19:30217878-30217900 GATGGTCCTTCCCTGGCTCCTGG + Intergenic
1164821900 19:31257086-31257108 GGTGTTTCCTCCCTGGCTTCAGG + Intergenic
1165068266 19:33241271-33241293 GCTGGTCCCTCCTGGGCTTCTGG + Intergenic
1165596877 19:37016490-37016512 GCTTGTCCTTCCCTTTCTTGGGG + Intronic
1165715975 19:38046204-38046226 GCTGGTCCATCCCAGGCTGCTGG + Intronic
1166344104 19:42154804-42154826 GCTTGAGCATCCCTGACTTCTGG - Intronic
1167644249 19:50697140-50697162 CCTTTCCCCTCCCTGGCTGCTGG - Intronic
1167751703 19:51384588-51384610 GTCCCTCCCTCCCTGGCTTCTGG - Intronic
1168018884 19:53594687-53594709 GCTTGCCACCTCCTGGCTTCCGG - Intergenic
1168448392 19:56444242-56444264 GCTGGCACCTCCTTGGCTTCTGG + Intronic
925981373 2:9180083-9180105 CCCTGACCCTCCCAGGCTTCAGG + Intergenic
926028253 2:9563567-9563589 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
926061321 2:9806900-9806922 TCTTGTCCATGCCAGGCTTCTGG - Intergenic
926772974 2:16394315-16394337 CCTTGCCCCTCTCTGGGTTCTGG + Intergenic
927912861 2:26914035-26914057 GGCGATCCCTCCCTGGCTTCAGG - Intronic
929701877 2:44169253-44169275 TCTTCTCCCTCCCTTGCCTCAGG + Exonic
929920577 2:46168554-46168576 GCTTCTCCCTCTAGGGCTTCAGG - Intronic
930516374 2:52412460-52412482 GCTTGTGCCTGGCTGGCTTCAGG - Intergenic
932388002 2:71356207-71356229 GCTTGTCCATCCCTTACTTAAGG - Intronic
933350621 2:81147735-81147757 GCTTTACCATGCCTGGCTTCAGG - Intergenic
935082942 2:99816579-99816601 GAGTGTCCCTCCTTGGCTTTGGG + Intronic
935300158 2:101686807-101686829 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
936313460 2:111406445-111406467 GCTTCTCCCTCCTGGTCTTCAGG - Intergenic
937233489 2:120416272-120416294 GCTCGTCTGTCCCTGGCTGCTGG + Intergenic
937515374 2:122649212-122649234 TCTTGCCACTCCCTGGCTGCTGG + Intergenic
937791686 2:125968920-125968942 ACTTGTTCTTCCCTTGCTTCGGG + Intergenic
940035719 2:149310485-149310507 GCCTGTCCCTGCCTGGCTCTGGG - Intergenic
940179343 2:150914547-150914569 CCTTGCCTCTCTCTGGCTTCTGG + Intergenic
941264814 2:163348285-163348307 GCTGCTCCCTCCCTTGCTTCGGG - Intergenic
943295231 2:186129856-186129878 ACTTGTACTTCCCTGGCTACTGG - Intergenic
946112309 2:217430705-217430727 GCTTGTGCCTCCCAGGTCTCAGG - Intronic
946278197 2:218646433-218646455 TGTTGTTCCTCCCTGGCATCAGG - Intronic
946763961 2:223022884-223022906 TCATGCCTCTCCCTGGCTTCTGG + Intergenic
947145172 2:227057540-227057562 GCATGTCCCTCTCTGCCTTTGGG + Exonic
947518072 2:230824170-230824192 GCTTCTCCCTACCTGGTGTCAGG - Intergenic
948077621 2:235178123-235178145 GCTTGTCCCACACTTGCTCCAGG + Intergenic
948262686 2:236615707-236615729 CCTTGACTCTTCCTGGCTTCTGG + Intergenic
948943607 2:241208383-241208405 CCTTGGTCCTCCCTGGCTTGTGG + Intronic
1168818033 20:754341-754363 CCTTGTCCTTCCCTGGCTTAGGG - Intergenic
1169073920 20:2750169-2750191 GTGTTTCCCTCCCTGGCCTCTGG + Intronic
1169130262 20:3163183-3163205 GCTTTTCCCTTCCTGTCTTGGGG + Exonic
1169256331 20:4102630-4102652 GCTGCTCCCTCCCTTGCTGCTGG - Intergenic
1169490851 20:6070395-6070417 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
1170582979 20:17712671-17712693 GATTCTCCCTTCCTGTCTTCTGG + Intronic
1170634180 20:18090673-18090695 GCTTCTCCCTCCATAGCTCCTGG + Intergenic
1171179019 20:23077756-23077778 GGTTGTCCCTCTCTGAGTTCTGG - Intergenic
1171817804 20:29803894-29803916 GCTTGTCCCTTCTTGGAGTCAGG + Intergenic
1172646725 20:36474852-36474874 CCTAGTCTCTCCCTGGCTCCTGG - Intronic
1173661685 20:44738613-44738635 TCTTGTCCGTCCTTGGCTTTGGG + Intergenic
1174751117 20:53112158-53112180 GCTGGCCCCTCCCTGCCCTCTGG - Intronic
1175698943 20:61123561-61123583 GCTCAGCCCTCCCTGGCTCCAGG + Intergenic
1176127590 20:63482848-63482870 CCTTCTCCCTCCCTGGCTTCTGG + Intergenic
1176127731 20:63483408-63483430 CCTTGTCTCTCCCGGGCTCCCGG - Intergenic
1176273370 20:64248120-64248142 GCTTGTTCCACTCTGGCTACGGG + Intergenic
1177059932 21:16358955-16358977 GCTTTCCCCTCCCTAGCCTCTGG + Intergenic
1178439918 21:32590453-32590475 CCTGGTCCCTTCCTGTCTTCAGG - Intronic
1179293775 21:40042733-40042755 GCATGGCCCTTCCTGGCTTGGGG + Intronic
1179719365 21:43306602-43306624 GCTTGGGGCTCCCTGGCTTGTGG - Intergenic
1180151223 21:45949055-45949077 GCTCCTCCCTCCCTGTCCTCCGG - Intergenic
1180154271 21:45970628-45970650 GCTGCTCCCTCACTGGCCTCCGG + Intergenic
1180321255 22:11323384-11323406 GCTTGTCCCTTCTTGGAGTCAGG + Intergenic
1181462411 22:23093649-23093671 GCCTGTCCCTCACTGGCCACAGG - Intronic
1181477816 22:23179783-23179805 GCCTGGCCCTCCCTGCCTTGCGG + Intronic
1181635635 22:24173087-24173109 GCTTCTCCCTCCCTGCCTCAAGG + Intronic
1181673698 22:24438306-24438328 GCATATCCCTTCCTGGGTTCTGG - Intronic
1182620961 22:31618292-31618314 GCCTGTCCCTCCATGGCCCCAGG + Exonic
1182958886 22:34453396-34453418 GCTTCTGCCTCCCTAGCTGCTGG - Intergenic
1183674878 22:39293606-39293628 GCTTCTCCCTCGCTTCCTTCAGG + Intergenic
1184566617 22:45295784-45295806 GGTTGTCACACCCTGACTTCAGG + Exonic
949369980 3:3324403-3324425 CCTTGCCTCTCCCTAGCTTCTGG - Intergenic
949389318 3:3541757-3541779 CCTTGTCTCTTCCTAGCTTCTGG + Intergenic
949996715 3:9623081-9623103 TCTTGCCTCTCCCTGGCTTCAGG - Intergenic
952210439 3:31224477-31224499 GCTTCTCCCTCCCTGAGGTCTGG + Intergenic
953457810 3:43056473-43056495 CCTTGTGCCCCTCTGGCTTCTGG - Exonic
953635292 3:44658408-44658430 GATTGGCCCTCCCTGGCATGAGG + Intronic
953909712 3:46885683-46885705 ACTGGACACTCCCTGGCTTCGGG + Intronic
954195896 3:48997066-48997088 ACTTGTGCCTCTCTGGATTCTGG + Intronic
955037973 3:55287523-55287545 GCCTGTCCCTTCCTGGATTCTGG + Intergenic
955499478 3:59569958-59569980 CCTTGCCTCTTCCTGGCTTCTGG + Intergenic
957288670 3:78249204-78249226 GTTTGTCTCTTCCTGCCTTCAGG + Intergenic
958043750 3:88257780-88257802 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
959150097 3:102597867-102597889 GCTTGCCTCTTCCTAGCTTCTGG + Intergenic
960162706 3:114367853-114367875 TCTTGTCCCTTCTTGGATTCAGG - Intronic
960517152 3:118614990-118615012 TCTTGCCCCTCCCTGGCTTATGG - Intergenic
960808962 3:121610430-121610452 GCCTGTCCCTCCTTGGAGTCAGG + Intronic
962304992 3:134278093-134278115 GCTTGTTCCTCCCTTACTTCTGG - Intergenic
962891939 3:139679522-139679544 GCTTCTCCCTCCCTGGCCTAGGG - Intergenic
964221009 3:154344735-154344757 TCTTGCCTCTCCCTAGCTTCTGG - Intronic
965002887 3:162980512-162980534 CCTTGCCTCTCCCTAGCTTCTGG + Intergenic
967106088 3:186256110-186256132 GCTTTTCCTTCCTTGGCTCCCGG + Intronic
968291347 3:197542117-197542139 GCTTGTCCCTGCCTGGACTGAGG + Intronic
968331367 3:197873394-197873416 GCTTGTCCGTCACTGGCTATGGG - Intronic
968698071 4:2042305-2042327 GCTGACCCCTCGCTGGCTTCAGG + Exonic
968717974 4:2175853-2175875 CCTTTGCCCTCCCTGGCCTCTGG + Intronic
969215702 4:5720638-5720660 GCATCTCCCTCCCTGGCTGGTGG + Intronic
969359165 4:6650744-6650766 CCTTGCTTCTCCCTGGCTTCTGG + Intergenic
969638606 4:8383542-8383564 GCTTTTCCCGCCCAGGCTCCTGG - Intronic
969745416 4:9067258-9067280 GCTTGTCTCTCTCTGGCCTGTGG + Intergenic
971203158 4:24531634-24531656 GCTTTTACCTCCCTGGGCTCTGG - Intronic
973967789 4:56181667-56181689 CCTTGGCTCTTCCTGGCTTCTGG + Intronic
974590435 4:63942275-63942297 TGTTGTTCCTTCCTGGCTTCAGG + Intergenic
975747087 4:77485400-77485422 GCTTGTTCCTCTCTGCTTTCAGG - Intergenic
977536591 4:98261451-98261473 GCGGGTCCCTCCCTGGCTGCGGG + Intronic
978878026 4:113665636-113665658 GCTGGTTCCACACTGGCTTCAGG - Intronic
979226526 4:118292154-118292176 ACTTGTCCCTCCCCTTCTTCTGG + Intronic
979434565 4:120673420-120673442 CCATGTCCCTCCCTGTCTGCTGG - Intergenic
982522844 4:156440975-156440997 GCTTCTCACTCTCTGGCTTCAGG - Intergenic
982635195 4:157887135-157887157 CCTTGTCTCTTCCTGGCTTCTGG - Intergenic
982984271 4:162185541-162185563 GCTTGCCCCTTCCTAGTTTCTGG + Intergenic
983078472 4:163355172-163355194 CCTTGCCCCTTTCTGGCTTCTGG + Intergenic
984501970 4:180568055-180568077 GCTTGTTCCTACCTTCCTTCAGG - Intergenic
985981830 5:3476546-3476568 GCTTCTCCCTCCCAGGTTCCTGG + Intergenic
986126392 5:4886109-4886131 GCTTATGCTTGCCTGGCTTCAGG - Intergenic
986213796 5:5699138-5699160 GCTTGTCCCTTCTCGCCTTCAGG + Intergenic
986295010 5:6430776-6430798 TCTAGTCCATCCCTGGATTCAGG - Intergenic
986923374 5:12716409-12716431 GTTTGCCCCTCCCTAGCTCCTGG - Intergenic
988807733 5:34756115-34756137 TTTTATCCCTCCCTGGCTTAAGG + Intronic
996759440 5:126972526-126972548 GCTTGTCTCACCCAGGCCTCGGG + Intronic
996865208 5:128113079-128113101 GCTTGTACCTCCTTTGCTTTTGG + Intronic
997213903 5:132094826-132094848 TCTTGCCCCACCCTGGCCTCTGG - Intergenic
997648125 5:135494641-135494663 ACTTCTCCCTTCCTGCCTTCTGG + Intergenic
997997812 5:138600552-138600574 GCTTGTTGCTGCCTTGCTTCAGG + Intergenic
999120823 5:149208007-149208029 GCTTGCCACTGCCTGGCATCAGG - Intronic
999472004 5:151863338-151863360 GCCTGGACCTCCCTGGGTTCAGG - Intronic
1000014243 5:157263814-157263836 GCACGTCCCTCCCAGGCTTAAGG - Intergenic
1000489098 5:161886692-161886714 GCTTCTACCTCCCTGGGTTCAGG - Intronic
1000991296 5:167914730-167914752 CCTTGTCTCTCCCTAGCTTCTGG + Intronic
1001085641 5:168698482-168698504 GCTTGTCCCTCCCTGGCTTCTGG - Intronic
1001147369 5:169196604-169196626 GCTTGACCTCCCCAGGCTTCAGG - Intronic
1001158209 5:169291185-169291207 GCTCCTCCCACCCTGGCATCAGG - Intronic
1001433131 5:171679286-171679308 GCTAGTCCAGCCCTGGCTCCTGG + Intergenic
1001476234 5:172052946-172052968 GCTTGTCCCGCCATTCCTTCAGG + Exonic
1002339407 5:178505120-178505142 TCTGGTCCATGCCTGGCTTCTGG + Intronic
1005297130 6:24437422-24437444 GGTTGTACCTCCCTGACTGCCGG - Intronic
1006011580 6:31046731-31046753 CCTGGTCCCACCCAGGCTTCTGG + Intergenic
1006314215 6:33280522-33280544 GCTTCTCCCTCCCTCCCTTCAGG - Exonic
1006446804 6:34084329-34084351 TCCTGTCCCTCCCTGGCCTCAGG + Intronic
1007717138 6:43863970-43863992 CCTTCTCCCTCCCTCCCTTCTGG + Intergenic
1009974924 6:70662369-70662391 ACTGTTCCTTCCCTGGCTTCTGG + Intergenic
1010009890 6:71037594-71037616 GCTGGTATCTGCCTGGCTTCTGG + Intergenic
1014863285 6:126496829-126496851 GCTTTTTCCTCCTGGGCTTCAGG + Intergenic
1017335240 6:153250618-153250640 TCTTGTCCCTTCCCAGCTTCTGG + Intergenic
1017985316 6:159438430-159438452 GCATGTTCCTGCCTGGCCTCTGG - Intergenic
1018244330 6:161807582-161807604 TCTTGCCTCTTCCTGGCTTCTGG + Intronic
1022778809 7:33557075-33557097 CCTTTCCTCTCCCTGGCTTCAGG + Intronic
1023995199 7:45155594-45155616 GCTTGTCCCTCGGTGGGTGCTGG - Intergenic
1027278534 7:76587808-76587830 TCTTGTCTCTTCCTGGCTTCTGG + Intergenic
1029116144 7:98238289-98238311 GCCTGTCTCCCCCTGGCCTCTGG + Intronic
1029438735 7:100576103-100576125 GCCTGTCCCTTCCTGTCCTCAGG + Intronic
1032493657 7:132344404-132344426 ACTGGTCCCTCCCTTGCCTCTGG - Intronic
1032976656 7:137232159-137232181 CCTTGTCCCTGCCTGGATTGAGG + Intronic
1033137847 7:138799425-138799447 GCCAGTCCCTCCCTCGCTTCTGG + Intronic
1034186136 7:149178821-149178843 ACTTGTCCCTCAGAGGCTTCAGG - Exonic
1034449449 7:151129498-151129520 GCCTGGCCCTCCTGGGCTTCTGG + Intronic
1034729402 7:153371204-153371226 GCCTCTACCTCCCAGGCTTCAGG - Intergenic
1037412756 8:18615814-18615836 CTCTGTCCTTCCCTGGCTTCTGG - Intronic
1037998156 8:23368342-23368364 GCCTCTCCATCCCTGTCTTCGGG + Exonic
1038004642 8:23419280-23419302 CCTTGCCCCTTCCTGGTTTCTGG - Intronic
1038183276 8:25248747-25248769 GCCTGTGCCTCCCTAGCTCCTGG + Intronic
1038333587 8:26628795-26628817 GCTCCTCCCTCCCAGGCTTCTGG - Intronic
1039085267 8:33773619-33773641 GCTTGAGCCTCCCTGGGTACAGG + Intergenic
1039148806 8:34480167-34480189 GCTGGCATCTCCCTGGCTTCTGG + Intergenic
1039736985 8:40343504-40343526 GCTTGCTCCTCCCTGCCTTTGGG - Intergenic
1039833644 8:41237498-41237520 GCATGTCCCACCCGGGCTTGCGG - Intergenic
1041198912 8:55430777-55430799 GCTTGTAGCTGCCTGTCTTCTGG + Intronic
1045940117 8:107728718-107728740 ACTTTTTCCTCCCGGGCTTCTGG + Intergenic
1047941657 8:129832413-129832435 CCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1048253354 8:132885831-132885853 CCTTGCCCCTTCCTGGTTTCTGG + Intronic
1048269076 8:133013754-133013776 GCTTGGGCTTACCTGGCTTCCGG - Exonic
1048308804 8:133302419-133302441 CCTTGCCCCTTCCTGGCTCCTGG + Intergenic
1048358775 8:133676328-133676350 GTTTTTTCCTCCCTGGCCTCAGG - Intergenic
1049365949 8:142236981-142237003 GCTCTTCCCTTCCTGCCTTCAGG - Intronic
1049796291 8:144498679-144498701 CCTTGTCCTTCCCTGGGTCCTGG + Intronic
1051613096 9:18980626-18980648 GCTGGGCCCTGCCTGCCTTCTGG + Intronic
1052216420 9:25972023-25972045 TCTTGTCTCTCCCTGACATCCGG - Intergenic
1052361677 9:27567877-27567899 CCTTGCCTCTTCCTGGCTTCTGG - Intronic
1052867336 9:33472412-33472434 GCTTCTCCCTCACTGGCCACAGG - Exonic
1053276068 9:36784270-36784292 GCTTGCCTCCTCCTGGCTTCTGG + Intergenic
1053418189 9:37959834-37959856 GCATGTCCTACCCTGGCTCCCGG + Intronic
1055191520 9:73530318-73530340 GCTGGCCTCTGCCTGGCTTCTGG - Intergenic
1055665123 9:78545539-78545561 CTTTGTCCCTCCCTATCTTCTGG + Intergenic
1055751709 9:79513855-79513877 CCTTGCCCCTCTCTTGCTTCTGG - Intergenic
1055949359 9:81716404-81716426 GCTTGTACCTCCCTGGGCCCAGG + Intergenic
1056622399 9:88225215-88225237 GCTGGTCCCTCCCTGGGCCCTGG - Intergenic
1056658339 9:88526853-88526875 GCTTGCCTCTTCCTGGCTTCTGG - Intergenic
1057693728 9:97309392-97309414 CCTTGGTCCTCCCTGGATTCAGG + Exonic
1057792958 9:98136004-98136026 GGGTGTTCCTCCCTGCCTTCAGG - Intronic
1058465325 9:105221482-105221504 GCATATCCCTTCCTGGATTCAGG + Intergenic
1058489539 9:105481853-105481875 GCCTGGACCTCCCTGGCTTAAGG + Intronic
1060007984 9:120017239-120017261 CCTTGCCTCTCCCTAGCTTCCGG + Intergenic
1061206644 9:129167818-129167840 GCTGGTCTCACCCTGACTTCAGG + Intergenic
1203369469 Un_KI270442v1:289157-289179 GCTTGTCCCTTCTTGGAGTCAGG + Intergenic
1186804378 X:13125353-13125375 CCTAGTCCTTCCCTGGCTTAAGG + Intergenic
1186839533 X:13471313-13471335 GCTCATCCCTCACTGCCTTCAGG - Intergenic
1186907429 X:14126780-14126802 GCATGTCCTACCCTGGCTTCTGG + Intergenic
1187413535 X:19072065-19072087 GCTTGTCCAACCCTGGCCCCCGG + Intronic
1188016764 X:25114872-25114894 CCTTGTCTCTTCCTGGCTTTTGG - Intergenic
1188271154 X:28142332-28142354 GCTTGTCTTTCCTTGGCTCCTGG + Intergenic
1189365612 X:40385620-40385642 GCTGGGACCTCCCTGGCATCTGG - Intergenic
1195525118 X:105879011-105879033 CCTTGTCTCTTCCTGGCTTCTGG + Intronic
1195538903 X:106039976-106039998 GCTTGTCACTCCCTTTCTTTAGG - Intergenic
1195684888 X:107576509-107576531 GCTCTTCCCTCCATGTCTTCAGG - Intronic
1196207074 X:112952741-112952763 GTTTCTCCCTTTCTGGCTTCAGG + Intergenic
1196678754 X:118448660-118448682 GCTGGTCTTTCCCTGGCTTGAGG - Intronic
1198396131 X:136221065-136221087 GCTTGACTCTTCCTGCCTTCAGG - Intronic
1199726095 X:150582717-150582739 CCTTGCCTCTCCCTAGCTTCTGG - Intronic
1200071688 X:153532364-153532386 TGTTGTCCCTCCCTGGCTTTGGG - Intronic
1200428128 Y:3045237-3045259 GCTTGTTCCTCACTGACTACAGG - Intergenic