ID: 1001085643

View in Genome Browser
Species Human (GRCh38)
Location 5:168698489-168698511
Sequence GGTCCTTGCTTGTCCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001085643_1001085645 -3 Left 1001085643 5:168698489-168698511 CCAGGGAGGGACAAGCAAGGACC 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1001085645 5:168698509-168698531 ACCCTCCCCTAGAGGCTCAGAGG 0: 1
1: 1
2: 1
3: 36
4: 201
1001085643_1001085653 27 Left 1001085643 5:168698489-168698511 CCAGGGAGGGACAAGCAAGGACC 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1001085653 5:168698539-168698561 GCCCTGCTGACACCTTGATTTGG 0: 7
1: 16
2: 62
3: 121
4: 317
1001085643_1001085652 5 Left 1001085643 5:168698489-168698511 CCAGGGAGGGACAAGCAAGGACC 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG No data
1001085643_1001085647 -2 Left 1001085643 5:168698489-168698511 CCAGGGAGGGACAAGCAAGGACC 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1001085647 5:168698510-168698532 CCCTCCCCTAGAGGCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001085643 Original CRISPR GGTCCTTGCTTGTCCCTCCC TGG (reversed) Intronic
900097245 1:944947-944969 GGGCCAGGCTTTTCCCTCCCTGG - Intronic
900494270 1:2969385-2969407 AGTCCCTGCTTGGCCCTGCCAGG - Intergenic
900541153 1:3203562-3203584 GGTCCGTGCGTTTCTCTCCCCGG + Intronic
900556247 1:3282346-3282368 GCTCCTTGCTTGGCCCCCACAGG + Intronic
900673715 1:3871091-3871113 GGTCCTTGCTTCTCACGCGCTGG + Intronic
901297330 1:8170531-8170553 TGTCCTCGCTTGAACCTCCCCGG + Intergenic
904750254 1:32737413-32737435 GGTTTTTGCTGGTTCCTCCCTGG + Intergenic
906319767 1:44808722-44808744 AGTCCCTGCTTCTCCCTCTCAGG + Exonic
907046851 1:51304870-51304892 GATCCCTGCCTGGCCCTCCCAGG - Intronic
907326249 1:53640428-53640450 AATCCTGGCCTGTCCCTCCCTGG + Intronic
907404077 1:54243127-54243149 GGTCATTGCTGGTACCTCTCTGG - Intronic
913241748 1:116835803-116835825 GCTCCTTTCTTCTCCCTCCACGG - Intergenic
915341524 1:155179232-155179254 GGCCTTTGCCTGCCCCTCCCTGG + Intronic
915643216 1:157246064-157246086 GGTGCCTGCTTCTCCTTCCCAGG + Intergenic
915748053 1:158180410-158180432 GGTCCTTGCTCTCCCCTCCCCGG - Intronic
916178494 1:162063202-162063224 GGACCTTAATTTTCCCTCCCAGG - Intergenic
916530288 1:165650040-165650062 GCTCCTTGCCTCTCCCTCCATGG - Intronic
919886875 1:201941431-201941453 GGTGCCTGCTTTTGCCTCCCTGG + Intronic
921712708 1:218388559-218388581 TTTCCTTGCTTGTCCCTCTCTGG + Intronic
1066646519 10:37616218-37616240 GGCCCTGGCTCTTCCCTCCCTGG - Intergenic
1069842591 10:71349062-71349084 GTTCCTTACCTGTCACTCCCAGG + Intronic
1070087352 10:73250250-73250272 GGTGCATGCTTGTAGCTCCCCGG + Exonic
1071298790 10:84241385-84241407 GGCCCTTGCGTGGCCCCCCCAGG - Exonic
1072414816 10:95238271-95238293 GGGACTTGCTTCTCCTTCCCAGG + Intronic
1073242696 10:102068512-102068534 GGTCCTTGCCTGTCTCCACCAGG + Intergenic
1073455791 10:103635963-103635985 GGCCCCAGCTTTTCCCTCCCGGG - Intronic
1075410477 10:122224289-122224311 GACCCTTACTTGTCCCTCTCTGG - Intronic
1076228212 10:128797953-128797975 GATCCTTGCTTGCCTCTCCCAGG - Intergenic
1076736319 10:132460809-132460831 TGCCCTTGCTTCTGCCTCCCAGG + Intergenic
1076841493 10:133048124-133048146 GTTCCTGCCTTGTCCCTCCCTGG + Intergenic
1077430591 11:2514099-2514121 GCTCCTGGCTTGGCCCTCCACGG + Intronic
1078634228 11:13033885-13033907 GATCCTGCCTTGTCTCTCCCAGG - Intergenic
1078756262 11:14213778-14213800 AGTCCTTGCTAATCCATCCCTGG - Intronic
1078916832 11:15786136-15786158 GATCCTTGCTTGCCTCTCTCAGG - Intergenic
1078916844 11:15786211-15786233 GATCCTTGCTTGCCTCTCTCAGG - Intergenic
1079579490 11:22045434-22045456 GCTCCAAGCTTGTCCCTCACAGG + Intergenic
1084493195 11:69489317-69489339 GGTCTTTCCTTCTGCCTCCCTGG + Intergenic
1084749594 11:71195821-71195843 GGTCCTTTCTTGTTCCTCAAGGG - Intronic
1084764587 11:71299916-71299938 GGTCCTTCCTTGTCTCTTCTGGG - Intergenic
1085280073 11:75324491-75324513 GGCCCTTGCTAGTGCCTCCTCGG - Intronic
1085340804 11:75730265-75730287 GGTCCTTCCTGGTTCTTCCCTGG + Intronic
1085636430 11:78162903-78162925 GGTTTTGGCTTTTCCCTCCCTGG + Intergenic
1089368419 11:117935231-117935253 GACCCATGCTTGTCCCTGCCAGG - Intergenic
1089445128 11:118545853-118545875 GGTCCTTCCATGCCCCTTCCAGG - Exonic
1091332047 11:134737595-134737617 TGACTTTGCCTGTCCCTCCCAGG - Intergenic
1091832535 12:3560069-3560091 GGTCTTTACTTTTTCCTCCCAGG + Intronic
1092052314 12:5480581-5480603 GGTCCTTTGGTCTCCCTCCCGGG - Intronic
1092240589 12:6833817-6833839 GCTCCTGCCTTCTCCCTCCCAGG - Intronic
1096860440 12:54523481-54523503 GCTCCTGGCTTGTCCCTCTCGGG - Exonic
1098558500 12:71846417-71846439 GTTCCTTGCTTGTCTGTACCTGG - Intronic
1098641241 12:72840083-72840105 GATCCTGGCTTGGCACTCCCAGG - Intergenic
1098721995 12:73912016-73912038 GGAGCTTGCTTATCCCTTCCAGG - Intergenic
1101321086 12:103673681-103673703 AGAGCTTGCTTGTCCCACCCAGG - Intronic
1101876548 12:108599893-108599915 GTTCTTTGCTTCTCCCTCCTGGG + Intergenic
1102952065 12:117037727-117037749 GTTCCTTTATTGACCCTCCCTGG - Intergenic
1112750496 13:102578583-102578605 GGTCCTTGCTCTGCCATCCCTGG + Intergenic
1113605325 13:111600564-111600586 GGTCCTTTCCTGATCCTCCCAGG - Intronic
1113807289 13:113117331-113117353 GGTCTTTGCAGATCCCTCCCAGG - Intronic
1114657180 14:24323152-24323174 GCTCCCTTCCTGTCCCTCCCAGG + Intronic
1115408454 14:33046159-33046181 GGTCCTCACTTGTACTTCCCTGG - Intronic
1117666683 14:58063088-58063110 GGTCCTTCCTTGTCTCTTCCTGG + Intronic
1118132262 14:62980112-62980134 GGTCCTTGCTTGTTTCCACCAGG + Intronic
1118909550 14:70049884-70049906 GGGCCTTGATTGTCCTTGCCAGG + Intronic
1119466572 14:74863237-74863259 GGTCCTTGCTGGTACCTTGCTGG + Exonic
1120396701 14:83976032-83976054 GGACCCTGCTTGCCCTTCCCAGG - Intergenic
1122271023 14:100568520-100568542 GGGCCTGGCTTGCCCCTCCCGGG + Intronic
1123924518 15:25094603-25094625 GGTCCTTTTTTGGCCCTCCAAGG + Intergenic
1124208110 15:27740417-27740439 TGTCCTTCCCTGACCCTCCCAGG - Intergenic
1125421941 15:39512710-39512732 GCTCCCTGCTTGACCCTCCAGGG - Intergenic
1125425004 15:39539853-39539875 TGTCCTTGCTTTGCCCTCCAAGG + Intergenic
1125794676 15:42395422-42395444 TGTGCTTGCCTGTCCTTCCCCGG - Intronic
1127395838 15:58543326-58543348 AGGCCTTGCCTGTGCCTCCCGGG - Intronic
1130573316 15:85068453-85068475 GGTCCTTGTTTGGCTCTTCCTGG + Intronic
1131626636 15:94127531-94127553 TGTCCTTAATTGTCCCTCCCAGG - Intergenic
1132523928 16:405051-405073 GCTCCTCGCTTCTCCCTGCCCGG + Intronic
1136845548 16:33573289-33573311 TGTGCCTGCTTCTCCCTCCCAGG + Intergenic
1137595226 16:49719179-49719201 GGCCTTTGCTTTTCCCGCCCAGG + Intronic
1140220900 16:73043107-73043129 TGTCCATCCTTTTCCCTCCCTGG - Intronic
1203107256 16_KI270728v1_random:1421942-1421964 TGTGCCTGCTTCTCCCTCCCAGG + Intergenic
1143289853 17:5820443-5820465 AGGCCTTCCTTGACCCTCCCGGG + Intronic
1144830894 17:18130679-18130701 GGTTTTTACTAGTCCCTCCCTGG + Intronic
1146400158 17:32495342-32495364 GGTCCCTGCCTGTCACACCCCGG + Intronic
1147123636 17:38351680-38351702 GGTCCTTGCTTTTCACTTCCTGG - Intergenic
1147358151 17:39913535-39913557 AGTCTTTGCTTCTGCCTCCCAGG - Intronic
1147721246 17:42540787-42540809 AGTCCTTTCTTCTCCTTCCCTGG - Intronic
1148508712 17:48149477-48149499 GGACGTTGCTTTTCCCTCGCCGG - Intronic
1149561084 17:57608436-57608458 GGTTCCTGCGTTTCCCTCCCCGG + Intronic
1149651061 17:58276725-58276747 GGTTCCTGCTGGTCTCTCCCTGG - Intronic
1150828514 17:68497747-68497769 GGTTCTAGCTTGCCCCTCTCTGG - Intergenic
1151472826 17:74328403-74328425 GGGGCTTGGTTTTCCCTCCCAGG + Exonic
1151967934 17:77441356-77441378 GGGCCTTGTTTTTCCCTCCGGGG - Intronic
1152760398 17:82104418-82104440 GGGGCCTGCTTGCCCCTCCCAGG + Intronic
1153610578 18:6880348-6880370 AGTCCTTAGTTATCCCTCCCTGG + Intronic
1158076794 18:53539612-53539634 GGTCCTTCCTTTCCTCTCCCTGG + Intergenic
1161301359 19:3544521-3544543 GGTCCTTGCAAGTCCCTGGCGGG + Exonic
1162548776 19:11346727-11346749 GCTGCTTCCGTGTCCCTCCCGGG - Intronic
1163055474 19:14714448-14714470 AGTCCTTCCTTGCCCCTCCCTGG - Intronic
1163263852 19:16206666-16206688 GACCCCTGCTTGTCCCTTCCAGG - Intronic
1163879975 19:19910810-19910832 GGTCCTTTCTTGTAAATCCCAGG - Intronic
1168264793 19:55216867-55216889 GGTCCTGGCTGGCCCCACCCAGG - Intergenic
925140588 2:1547337-1547359 GGCCCTTCCTTGTCTCTTCCAGG + Intergenic
926757836 2:16250262-16250284 GACCCTTGCCTGTCCCTGCCTGG - Intergenic
928683820 2:33728102-33728124 GGTCTGGGCTTCTCCCTCCCAGG + Intergenic
931704287 2:64934331-64934353 GGTCCCTGCTTGTCCATGCATGG + Intergenic
931855967 2:66302032-66302054 TGTCCTTGGCTGTCCCTCACTGG + Intergenic
935300161 2:101686814-101686836 GGTCCTTCCTTGCCTCTTCCTGG - Intergenic
936469281 2:112784319-112784341 TTTCTTTTCTTGTCCCTCCCTGG - Intronic
937103047 2:119286381-119286403 GGTCCTTGGTTGTGCCTCCCAGG + Intergenic
938015198 2:127861072-127861094 GGGGTCTGCTTGTCCCTCCCTGG - Intergenic
939376575 2:141375938-141375960 GCGCCTTGCTTGTCCTTCCCAGG + Intronic
941848573 2:170156711-170156733 GGTCAGTGCTTGTGCCTCTCAGG - Intergenic
942063731 2:172251091-172251113 GGTGCTTGCCTGTCTCTCTCTGG - Intergenic
944594256 2:201246845-201246867 GCTCCTTTCTTGCTCCTCCCTGG - Intronic
946113002 2:217436639-217436661 AGTCCCTCCTTGTCCCTCTCTGG - Intronic
948201961 2:236135972-236135994 TGCCTTTTCTTGTCCCTCCCGGG + Intergenic
948257234 2:236577266-236577288 TGTCCTTGCTTCTCCCCTCCCGG - Intronic
948994410 2:241571215-241571237 GGGCCTTGCTTTTCCCACTCGGG - Intronic
1170775735 20:19373287-19373309 GGCCCTTCCTTGTCCTGCCCAGG + Intronic
1171091999 20:22294105-22294127 CGTCCTTTCCTGGCCCTCCCCGG - Intergenic
1173046548 20:39518008-39518030 GGTCTTTGCTTGTCTCTGTCTGG + Intergenic
1176167575 20:63682083-63682105 GGCCCGGGCCTGTCCCTCCCTGG + Intronic
1178890847 21:36520089-36520111 GATCCTTCCTTGCCCCTCCCTGG + Intronic
1178937423 21:36875348-36875370 GGTCCTTGGGTGTCCCTGGCTGG - Intronic
1179101643 21:38359797-38359819 GGGCCTTGCCTGCCTCTCCCAGG + Intergenic
1180981206 22:19878841-19878863 GGTGTTTGCTTGGCCCTCACTGG + Intronic
1181013857 22:20057249-20057271 GGTCCTTGCCTGGCCCACACTGG + Intronic
1182356229 22:29723348-29723370 AGTCCGTGCCTGTCCCTCACAGG - Intronic
1183104695 22:35607475-35607497 GCCCCTGGCTTGTCCCACCCTGG - Intronic
1183353898 22:37348534-37348556 GGACCTTGCTTTTCCCTGCAAGG - Intergenic
1184445921 22:44546866-44546888 GGCCCCTGCTTGTCCCTGCCAGG + Intergenic
949996717 3:9623088-9623110 GATCCTTTCTTGCCTCTCCCTGG - Intergenic
950691148 3:14659127-14659149 AGTACTTGTTTGTCCCTTCCAGG - Intronic
952097918 3:29977283-29977305 GGAACTTCCTTGCCCCTCCCTGG + Intronic
952961035 3:38589204-38589226 GTTCCTTGCTGTTCCCTCCTCGG + Intronic
953345922 3:42175436-42175458 CTCCCTTGCTTCTCCCTCCCTGG + Intronic
953970120 3:47340663-47340685 AGTCCTTACTTGTCCGTCTCAGG - Exonic
954715645 3:52525411-52525433 TGGCCTTGCTGCTCCCTCCCTGG + Intronic
955866652 3:63391194-63391216 CATCCTTCCTGGTCCCTCCCTGG + Intronic
961481427 3:127183313-127183335 GTTCCTGGCATGTCCCTCCTTGG - Intergenic
962314840 3:134352884-134352906 GGTTCATCCTTGTCTCTCCCAGG - Intergenic
962971077 3:140402650-140402672 GTACCTTGCTTGCCCCTCCTTGG + Intronic
965663735 3:171069411-171069433 CGGCCTTGGCTGTCCCTCCCAGG - Intronic
968291346 3:197542110-197542132 GTGCGTTGCTTGTCCCTGCCTGG + Intronic
969257007 4:6008966-6008988 GGTCAATGCTTGGCCCACCCAGG + Intergenic
973144779 4:46812336-46812358 GATCCATGCTGGTGCCTCCCAGG - Intronic
973598636 4:52518690-52518712 GCTCCTTCCCTGTCCATCCCTGG - Intergenic
973895637 4:55409957-55409979 CGTCCTTCCTGGTCCCTCACGGG + Intronic
975845003 4:78515773-78515795 GTTCCTTGTTCTTCCCTCCCTGG + Intronic
977423482 4:96834433-96834455 GTGCATTGCTTGTCCCTCTCAGG - Intergenic
985687775 5:1291162-1291184 CGTCCCTGGGTGTCCCTCCCAGG - Intronic
985687809 5:1291287-1291309 CGTCCCTGGGTGTCCCTCCCAGG - Intronic
985715620 5:1458091-1458113 GGTCCTCGCCCGTCTCTCCCAGG - Intronic
989592005 5:43121054-43121076 GTTCCGTGCTTTCCCCTCCCAGG - Intronic
991389420 5:66126185-66126207 GTCCCATGCTTGTCCCTCTCAGG - Intergenic
991968521 5:72115374-72115396 TGCCCTTTCTAGTCCCTCCCTGG + Intronic
997265698 5:132494053-132494075 AGTCCTTTCTTTTCCCTCCTTGG + Intergenic
998104122 5:139457492-139457514 GGTCCTCACTGGGCCCTCCCTGG + Intronic
998377354 5:141699928-141699950 CATCCTTGGTTGTCCCTCCCTGG - Intergenic
1000973218 5:167737453-167737475 GGTCCATGCTGGTACCTCCCAGG + Intronic
1001085643 5:168698489-168698511 GGTCCTTGCTTGTCCCTCCCTGG - Intronic
1001237280 5:170040980-170041002 GGCTCCTGCTTGTCCCTGCCAGG + Intronic
1002297119 5:178237918-178237940 TGTCCTATCTTGTCCCTCTCTGG + Exonic
1004135316 6:12960594-12960616 TGTCCTTGTTGGACCCTCCCTGG - Intronic
1007178824 6:39913835-39913857 GATCCTTGTTTCTCCCTCCCAGG - Exonic
1007599459 6:43072803-43072825 GGTCCTTCCTTTTCCTTCCAGGG + Exonic
1008490831 6:52085471-52085493 GGCCCCTGCTGGTCCCTTCCTGG + Intronic
1013898167 6:115118101-115118123 AGTTCTTCCTTGTCCCTCCATGG - Intergenic
1019337295 7:491435-491457 GGCCCCTGCTCGCCCCTCCCTGG - Intergenic
1019538972 7:1543120-1543142 GGACCCTGCCTGTCCCTCACCGG + Exonic
1023343095 7:39243295-39243317 GGTCCTTGCCTTTCCATCACTGG - Intronic
1024231475 7:47367094-47367116 GGTCCTTGCATGGCACTGCCAGG + Intronic
1024506536 7:50167039-50167061 GGGCCCTGCCTGGCCCTCCCAGG - Intergenic
1025255552 7:57381904-57381926 GGCCCTTACCTGCCCCTCCCAGG - Intergenic
1029031879 7:97477315-97477337 GGTCCTTGCCTTTCCCTTCCAGG - Intergenic
1031011097 7:116525908-116525930 GGCCCTCTCTTGTCCCTCCACGG - Intronic
1032097490 7:128946852-128946874 GGTCCCAGCTCGTCCATCCCAGG - Intronic
1032774509 7:135096970-135096992 AGTACTTGCTTGTCTCTTCCAGG - Intronic
1035225246 7:157428944-157428966 TGTCCTGGGATGTCCCTCCCAGG - Intergenic
1038448034 8:27617367-27617389 GGTCTTTACTCATCCCTCCCTGG - Intergenic
1038888114 8:31688331-31688353 GGAGCTTGTTTGTCCCTTCCAGG + Intronic
1040610132 8:48976169-48976191 AGTCCTTGCATCCCCCTCCCAGG + Intergenic
1043947397 8:86269687-86269709 GCTCCTTGCTTGTTCCTGCATGG + Intronic
1045112384 8:98947816-98947838 GCTCCTTTCCTCTCCCTCCCCGG + Intronic
1046496354 8:115019321-115019343 CATTCTTACTTGTCCCTCCCTGG + Intergenic
1047306277 8:123655338-123655360 GCTCCCTGCTTGTGCCTCCATGG - Intergenic
1049406167 8:142452709-142452731 GGCGCTTGCTAGGCCCTCCCTGG - Intronic
1049606745 8:143533095-143533117 GGTCCTCCCCTGTCCCTCCCTGG + Intronic
1049653338 8:143786868-143786890 GCTCCTTCCTTGTCCCCCTCAGG - Intergenic
1052669865 9:31542260-31542282 ATTCCTTGCTTGTCTCCCCCCGG - Intergenic
1053430943 9:38041376-38041398 GGGCCTTGCTTGTGACTACCTGG - Intronic
1056658341 9:88526860-88526882 AGTCCTTGCTTGCCTCTTCCTGG - Intergenic
1059655721 9:116355518-116355540 GGTACTGGCTTCTGCCTCCCTGG - Intronic
1060976612 9:127768709-127768731 GGTCCTTGCTGGGCTCTTCCAGG + Intronic
1187905078 X:24058244-24058266 AGGCCTCACTTGTCCCTCCCTGG - Intronic
1190702006 X:52996129-52996151 TGTGCTCACTTGTCCCTCCCTGG + Intergenic
1198018648 X:132636618-132636640 AGTCCTTGCCTGTCTCTCTCTGG - Intronic