ID: 1001085652

View in Genome Browser
Species Human (GRCh38)
Location 5:168698517-168698539
Sequence CTAGAGGCTCAGAGGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001085643_1001085652 5 Left 1001085643 5:168698489-168698511 CCAGGGAGGGACAAGCAAGGACC 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG No data
1001085641_1001085652 12 Left 1001085641 5:168698482-168698504 CCAGAAGCCAGGGAGGGACAAGC 0: 1
1: 0
2: 5
3: 48
4: 349
Right 1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG No data
1001085638_1001085652 21 Left 1001085638 5:168698473-168698495 CCAGGAACACCAGAAGCCAGGGA 0: 1
1: 0
2: 6
3: 39
4: 337
Right 1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001085652 Original CRISPR CTAGAGGCTCAGAGGGAGCA TGG Intronic
No off target data available for this crispr