ID: 1001086693

View in Genome Browser
Species Human (GRCh38)
Location 5:168705168-168705190
Sequence TTGGCAAGTGCAGTGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001086693_1001086699 25 Left 1001086693 5:168705168-168705190 CCTGCAATCACTGCACTTGCCAA 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1001086699 5:168705216-168705238 GCACAGCTTCTAGAGTCAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 165
1001086693_1001086696 -4 Left 1001086693 5:168705168-168705190 CCTGCAATCACTGCACTTGCCAA 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1001086696 5:168705187-168705209 CCAACAGGCAGTGAGTGCAGTGG 0: 1
1: 0
2: 2
3: 36
4: 357
1001086693_1001086697 1 Left 1001086693 5:168705168-168705190 CCTGCAATCACTGCACTTGCCAA 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1001086697 5:168705192-168705214 AGGCAGTGAGTGCAGTGGCCAGG 0: 1
1: 0
2: 4
3: 38
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001086693 Original CRISPR TTGGCAAGTGCAGTGATTGC AGG (reversed) Intronic
900086557 1:900963-900985 TTCCCAAGTGCTGGGATTGCAGG - Intergenic
900183723 1:1323667-1323689 TTCCAAAGTGCTGTGATTGCAGG + Intronic
901148371 1:7083692-7083714 TTGTCAAGTGCAGCGAGTGGTGG + Intronic
902324958 1:15693860-15693882 TTGGCATTTGCAGGGATTGTGGG + Intronic
905021566 1:34818452-34818474 CTCCCAAGTGCAGTGATTACAGG - Intronic
906991058 1:50738927-50738949 TTGGCAAGTGTAGAGATTTTAGG + Exonic
908014130 1:59814570-59814592 CTGGCAGGTGCAGTGAGGGCGGG - Intergenic
909700570 1:78517428-78517450 TTGATAAGTGCTGTGATTGTGGG + Intronic
910425981 1:87120454-87120476 TTGGCAATTTCAGTTACTGCTGG + Intronic
910773500 1:90852147-90852169 CTGGGAAGTGCAGTGAGGGCTGG + Intergenic
911354190 1:96796192-96796214 TTCCCAAGTGCTGGGATTGCAGG - Intronic
912522401 1:110254627-110254649 ATGACATGTGCAGTGATTACGGG + Intronic
915056959 1:153141933-153141955 TTGGCAAGTCCTGTGATCACAGG + Intergenic
921799010 1:219380460-219380482 TTGTCATGTACAGTCATTGCTGG + Intergenic
922275216 1:224071242-224071264 TCGGAAAGTACTGTGATTGCAGG + Intergenic
924228232 1:241940845-241940867 TTCGCAAGTGCTGGGATTACAGG + Intergenic
924318510 1:242823640-242823662 TTCCAAAGTGCTGTGATTGCAGG - Intergenic
924863139 1:247947955-247947977 TTGCAAAGTGCTGTGATTGCAGG - Intronic
1063142931 10:3271652-3271674 GTGCCAAGTGCAGTGTTTGCTGG + Intergenic
1067265914 10:44745130-44745152 TTGGCCAGTGCTGGGATTACAGG - Intergenic
1068907921 10:62347353-62347375 TTGCCATGTGCAGTCATTGAAGG - Intergenic
1071830821 10:89370490-89370512 TTGGAAAGTGCTGGGATTACAGG + Intronic
1075814916 10:125257637-125257659 GTGGCAAGTGCCGGGATTGGTGG - Intergenic
1076913239 10:133402771-133402793 TGGGTGAGTGCAGTGAATGCAGG + Exonic
1081938979 11:46924641-46924663 TTGGCCAGTGCTGGGATTACAGG + Intergenic
1085034705 11:73292947-73292969 TGGGCCAGTGCAGGGGTTGCGGG + Intronic
1085299378 11:75449468-75449490 TTGGCACCTGCAGGGATTGGAGG + Intronic
1086276072 11:85130657-85130679 TTGGAAAGTGAACTTATTGCTGG + Intronic
1090789946 11:130083291-130083313 TCCCCAAGTGCTGTGATTGCAGG + Intronic
1098005617 12:65993887-65993909 TTGGCAAGCAGAGTGCTTGCTGG - Intergenic
1098401100 12:70076830-70076852 TTGGAAAGTAAAATGATTGCGGG - Intergenic
1098882257 12:75928517-75928539 CTGGCATGTGCAGAGATTACAGG - Intergenic
1099097350 12:78391123-78391145 TAGACAAGTGCTGTTATTGCAGG + Intergenic
1100314655 12:93433390-93433412 TTCCCAAGTGAAGTGATTGATGG - Intronic
1100730002 12:97454499-97454521 TTGGAAAGTACAGAGATTACAGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101106276 12:101443719-101443741 TTCCAAAGTGCAGTGATTACAGG + Intergenic
1101120837 12:101578137-101578159 TCGGAAAGTGCTGGGATTGCAGG + Intronic
1101497333 12:105267243-105267265 TTGGGAAGTGCAGGGAATACTGG + Intronic
1101504037 12:105330607-105330629 TTGGCCAGTGCCGAGGTTGCTGG + Intronic
1102146151 12:110656437-110656459 TTGGCGAGGGCACTGATGGCAGG + Intronic
1105730151 13:23205731-23205753 TGGGCAGCTGCAGTGATGGCCGG - Intronic
1105787582 13:23764813-23764835 TTGTCAAGTGCTGGGATTACAGG + Intronic
1106564603 13:30873316-30873338 TTAGGAAGTGGAGTGAATGCTGG - Intergenic
1106644008 13:31613710-31613732 TTAGCAAGTGTGGTGAATGCGGG + Intergenic
1107005117 13:35600916-35600938 TTTCCAAGTGCTGTGATTACAGG - Intronic
1107901178 13:45016192-45016214 TTGGAAAGTGCTGGGATTACAGG - Intronic
1109089230 13:58018120-58018142 TTGCCAAGTGCTGGGATTCCAGG - Intergenic
1109977883 13:69865193-69865215 TCTCCAAGTGCAGAGATTGCAGG + Intronic
1110662117 13:78068683-78068705 ATGGCAAGTGCAATGCTTTCAGG + Intergenic
1110695289 13:78480906-78480928 TTGGCAACTTTAGTGAATGCCGG - Intergenic
1110725698 13:78820609-78820631 TTGCAATATGCAGTGATTGCAGG + Intergenic
1111265140 13:85801182-85801204 TGGGCAATTGCAGTAATTACTGG + Intergenic
1112133166 13:96546400-96546422 TTGGCAAGGGCAGGGATTGACGG + Intronic
1112160514 13:96862220-96862242 TAGCCCAGTGCAGTTATTGCTGG - Intergenic
1112410377 13:99157793-99157815 TTCCCAAGTGCTGGGATTGCAGG + Intergenic
1113136628 13:107097540-107097562 TGGGCAAGTGCTGTGATCCCTGG - Intergenic
1114706595 14:24733291-24733313 TTGCCAAGTGGTGTAATTGCTGG - Intergenic
1114965499 14:27954596-27954618 TTGGCAGGAGCAGTGCATGCAGG + Intergenic
1115136957 14:30121683-30121705 TTGCCAAGTGCTGGGATTACAGG + Intronic
1117974578 14:61284434-61284456 TTGGCAGGTGCCGTGAAAGCTGG + Intronic
1118134415 14:63006230-63006252 TTGGCAGGGGCAGAGGTTGCTGG - Intronic
1120732064 14:88014863-88014885 TTGGCAAATCAAGTCATTGCAGG - Intergenic
1124285050 15:28394386-28394408 TTGGTAAGTGGCGTGATTTCTGG - Intergenic
1124297647 15:28517228-28517250 TTGGTAAGTGGCGTGATTTCTGG + Intergenic
1126018274 15:44374388-44374410 TTGGAAAGTGCTGGGATTACAGG - Intronic
1127581341 15:60341793-60341815 TTGGGAAGTCGAGTGTTTGCAGG - Intergenic
1128854402 15:70995600-70995622 TTGGCAGCTTCAGTGAATGCAGG + Intronic
1129253901 15:74323180-74323202 TTGGCCAGTGCTCTGAATGCTGG - Intronic
1129968412 15:79756960-79756982 TTGTCAACTGCAGTATTTGCAGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132828188 16:1915186-1915208 TTTGCAAGAGCAGTGGGTGCAGG - Intronic
1133088347 16:3383281-3383303 CTCACAAGTGCAGTGAGTGCGGG - Exonic
1133604246 16:7370431-7370453 TTGACAAATACAGTGATTCCTGG - Intronic
1133817246 16:9207410-9207432 TTGGCGAGTGCTGGGATTACAGG + Intergenic
1134841865 16:17407970-17407992 TTGGCATGTGCAGATATTACAGG - Intronic
1136456496 16:30382535-30382557 ACGGCAGGTGCAGTGATGGCTGG - Exonic
1145187766 17:20810364-20810386 TTGCAAAGTGCGGGGATTGCAGG + Intergenic
1146411572 17:32590216-32590238 TTGGAGAGTTGAGTGATTGCAGG - Intronic
1147592464 17:41693380-41693402 TTGGCAAGTGCTGGGATTACAGG - Intergenic
1148145235 17:45360558-45360580 TTCCAAAGTGCTGTGATTGCAGG + Intergenic
1149125645 17:53227951-53227973 TTGGTAAGTGCAGACATTGTGGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149935362 17:60800089-60800111 ATGCCAAGTACTGTGATTGCTGG + Intronic
1150252417 17:63714372-63714394 TTAGCAAATGCATTGATTGTTGG - Intronic
1151147479 17:72054518-72054540 GAAGCAAGTGCAGTGCTTGCTGG - Intergenic
1151495618 17:74456503-74456525 TTGCCAAGTGCTGGGATTACAGG - Intergenic
1152341125 17:79725699-79725721 TTGCAAAGTGCTGGGATTGCAGG - Intergenic
1155448216 18:25935118-25935140 TCGGCAAGTGCTGGGATTACAGG + Intergenic
1156382458 18:36576842-36576864 TTGCCAAGTGCTGGGATTACCGG - Intronic
1157368661 18:47090054-47090076 CTGGCAAGTGCTGGGATTACAGG + Intronic
1157839544 18:50943955-50943977 TTTGAAAGTGCTGTGATTACAGG - Intronic
1158514738 18:58121665-58121687 TTCGAAAGTGCTGGGATTGCAGG + Intronic
1161480894 19:4510107-4510129 TTCCCAAGTGCTGAGATTGCAGG - Intronic
1163518233 19:17777784-17777806 TTGGCCAGTGCTGGGATTGCAGG - Intronic
1163868101 19:19791737-19791759 TTGGAAAGTGCTGGGATTACAGG + Exonic
1165284251 19:34826296-34826318 TTGGCAAGTGCAGTGTGTGATGG + Intergenic
1165505342 19:36224121-36224143 TTGCAAAGTGCTGGGATTGCAGG - Intronic
1166269273 19:41704035-41704057 CTGCCATGTGCAGTGATTGGTGG - Intronic
925166789 2:1720503-1720525 TTGGCAAGTCCAGAGTCTGCAGG + Intronic
926269271 2:11352936-11352958 TTTGCAACTGCAGTGAGTCCTGG - Intergenic
926671585 2:15581850-15581872 TTGGAAAGTGCTGGGATTACAGG - Intergenic
928623372 2:33114098-33114120 TTGCCAAGTGCTGGGATTACAGG + Intronic
929224003 2:39494507-39494529 TTGCAAAGTGCTGTGATTACAGG - Intergenic
931219968 2:60280273-60280295 ATGGAAAGTGCAATGAATGCTGG + Intergenic
932674758 2:73770077-73770099 TTGGAAAGTGCTGGGATTACAGG - Intronic
932676493 2:73786119-73786141 TTGCAAAGTGCTGTGATTACAGG - Intronic
933654661 2:84877811-84877833 TGGAAAAGTGCAGTTATTGCAGG - Intronic
933738265 2:85512658-85512680 TTGAAAAGTGCTGGGATTGCAGG + Intergenic
934475865 2:94593078-94593100 TCGGCAAGTGCTGGGATTACAGG + Intronic
936377787 2:111957177-111957199 TTGGCCAGTGCTGGGATTACAGG + Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937980696 2:127612979-127613001 ATGGGAACTGCAGTGTTTGCAGG - Intronic
938576149 2:132606488-132606510 TGGGCAAGTGCAGAGGTTGTGGG + Intronic
941727749 2:168882346-168882368 TTGCAAAGTGCAGGGATTACAGG - Intronic
941815415 2:169790835-169790857 TTGGCCAGTGCTGAGATGGCTGG - Intergenic
942147136 2:173038023-173038045 TGGTCAAGTGCAGCTATTGCTGG + Intronic
943032254 2:182699933-182699955 TGGTCAAGAGCAGTGATTACAGG - Intergenic
943059771 2:183029561-183029583 TCCGCAAGTGCTGGGATTGCAGG - Intronic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
943885057 2:193205917-193205939 TTGGTAAATGGAGTGATTTCTGG - Intergenic
944355400 2:198781655-198781677 TTCGGAAGTGCTGGGATTGCAGG - Intergenic
948302980 2:236922251-236922273 TTGGAAACTTCAGTGGTTGCAGG - Intergenic
948400345 2:237680231-237680253 TTCCCAAGTGCTGGGATTGCAGG - Intronic
948539513 2:238678655-238678677 TTCCAAAGTGCTGTGATTGCAGG + Intergenic
1169732218 20:8798634-8798656 TGGGCAGGGGAAGTGATTGCAGG + Intronic
1171246358 20:23613072-23613094 TAGGCAAATGCAGTTATTGTTGG + Intergenic
1171294777 20:24008002-24008024 TTGACAAGAGCAGTGTCTGCAGG - Intergenic
1173399322 20:42710524-42710546 TTTGCAAGTGCACAGAATGCAGG + Intronic
1178496485 21:33090546-33090568 TTGGCAAATGCAGTGCCTGAGGG - Intergenic
1182667319 22:31969258-31969280 TAGGTAAGTGCAGTAAGTGCAGG + Intergenic
1184737181 22:46406235-46406257 TTGGCAAGTGCGGTGCTGCCTGG - Intronic
1185115316 22:48931340-48931362 TTGGCCTGTGCTGAGATTGCAGG + Intergenic
1185381787 22:50512042-50512064 TTTGAAAGTGCTGGGATTGCAGG + Intronic
949288806 3:2438737-2438759 TTGGCAGGTGCGGTAATAGCAGG + Intronic
949734369 3:7154463-7154485 TTATCAAGTGCAATGATGGCAGG - Intronic
950842126 3:15977817-15977839 GTGGCAAGTGCTGGGATTACAGG + Intergenic
952324592 3:32309563-32309585 TTCCCAAATGCTGTGATTGCAGG + Intronic
956283829 3:67587557-67587579 TAGGAAAGTGCAGTGACAGCTGG + Intronic
956508055 3:69963705-69963727 TTGGCAGTTGCTGTGATTGAAGG - Intronic
960149492 3:114236490-114236512 CCTGCAAGTGCAGTGAGTGCGGG - Exonic
962774812 3:138649465-138649487 TTGGCAATGGCAGTGATGGGTGG + Intergenic
963007878 3:140742802-140742824 TTGGCCAGTGCAGAGATTCCTGG - Intergenic
963209776 3:142675937-142675959 TTGGGAAGTGCTGGGATTACAGG + Intronic
964051629 3:152401118-152401140 TTGTCAAGTGATGTGATAGCTGG + Intronic
966312064 3:178604678-178604700 TTGGCAAGGGAAGTGCTAGCAGG - Intronic
967052819 3:185800478-185800500 TTGCAAAGTGCAGGGATTACAGG - Intronic
967607956 3:191470713-191470735 TGTGCAACTGCAGTGGTTGCAGG - Intergenic
968057937 3:195707237-195707259 TTCCCAAGTGCCGTGATTACAGG + Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
975024656 4:69533242-69533264 TTGGCAAAAGCATTGAGTGCAGG - Intergenic
975444940 4:74452416-74452438 GTGTCAAGTATAGTGATTGCTGG + Intronic
976013332 4:80518938-80518960 CTGGCAAGTGAAGTGAATGCTGG + Intronic
976374339 4:84327072-84327094 TTGGGAAGTGCTGTGCTTGACGG - Intergenic
977484462 4:97624680-97624702 TTGGCACGTGCAAAGATTTCAGG - Intronic
978779921 4:112541204-112541226 TTAGCAATAGCACTGATTGCAGG + Exonic
979549233 4:121971848-121971870 TTGCCAAGTGCTGGGATTACAGG + Intergenic
980928542 4:139162836-139162858 TTTGAAAGTGCTGGGATTGCAGG - Intronic
982469914 4:155775550-155775572 TCCGAAAGTGCTGTGATTGCAGG + Intronic
982505196 4:156208464-156208486 GTGCCAAGTGAAGTAATTGCTGG - Intergenic
982951984 4:161710224-161710246 TTGGAAAGTGCTGGGATTACAGG + Intronic
984558003 4:181238551-181238573 TTGGAAAGTGCTGGGATTACAGG + Intergenic
985826804 5:2198120-2198142 TGGGCACGTGCTGTGTTTGCTGG - Intergenic
989426653 5:41303716-41303738 TTCCCAAGTGCTGGGATTGCAGG - Intergenic
990029616 5:51241357-51241379 TCTGCAACTGCAGTGATTACTGG + Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
994007126 5:94851340-94851362 GTGGCATGTGCAGTGATAGTGGG - Intronic
994292842 5:98050517-98050539 AGAACAAGTGCAGTGATTGCAGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994805602 5:104443853-104443875 TTGAAAAGTGCAGGGATTACAGG - Intergenic
999089877 5:148926788-148926810 TTGGCCAGTGCAGGAATTGAGGG - Intronic
999759126 5:154686812-154686834 CTGGTAACTGCAGGGATTGCAGG + Intergenic
1000181003 5:158811217-158811239 TTGGCATGTGCAGTGATATATGG - Intronic
1001029402 5:168250815-168250837 TTTGCAGCTGCAGTGATTTCGGG - Intronic
1001086693 5:168705168-168705190 TTGGCAAGTGCAGTGATTGCAGG - Intronic
1002762906 6:215611-215633 TGGGGAATTGCAATGATTGCTGG - Intergenic
1003397345 6:5764608-5764630 ATGGCAGCTGCAGTGACTGCTGG + Intronic
1005627210 6:27673946-27673968 TTGCCAAGGGGTGTGATTGCTGG + Intergenic
1006655369 6:35587797-35587819 ATGGCAAGTGCAGTTATTTCTGG - Intronic
1007916704 6:45568126-45568148 TTGGCAAGTTCTGGGATTGCAGG + Intronic
1007970196 6:46044298-46044320 CTGTCAAGTGCAGTCATTCCAGG - Intronic
1008274202 6:49524724-49524746 TCGGCAAGTGCTGGGATTACAGG - Intronic
1009681871 6:66904596-66904618 TTCGAAAGTGCAGAGATTACAGG + Intergenic
1011998611 6:93624548-93624570 TTGCCAGGTGCAGTGACTTCTGG + Intergenic
1012264415 6:97123768-97123790 TTTGCAAGTGCTTTGATTGCAGG + Intronic
1012386067 6:98684668-98684690 TTGGCAGCTGCAGTCATGGCTGG - Intergenic
1014683289 6:124461710-124461732 TTGGCTAGTGCACTCATTGAAGG + Intronic
1015628974 6:135211754-135211776 TTGGGAAGTGGAGTCATTGGTGG + Intronic
1016389896 6:143564344-143564366 TTGCAAAGTGCTGTGATTACAGG - Intronic
1020577831 7:9956675-9956697 TTCCCAAGTGCTGGGATTGCGGG - Intergenic
1021044565 7:15906730-15906752 CTGGCAACTGCAGTGAGAGCTGG - Intergenic
1021510402 7:21427641-21427663 GTGGCAATTGGAGGGATTGCTGG + Intergenic
1024152231 7:46583708-46583730 TTGTCAACTGCAGTGACTGTTGG - Intergenic
1024920554 7:54549636-54549658 TCTGCAAGTGCAGTGGTTGGTGG + Intronic
1025085105 7:56017257-56017279 TTGGCAAATACATTGGTTGCTGG + Exonic
1025608964 7:63060034-63060056 TTGGCAAATACATTGGTTGCTGG - Intergenic
1026114011 7:67481088-67481110 TTGGCAAGTTCAGACATAGCAGG - Intergenic
1028318853 7:89436321-89436343 TTGTTAAGTGCAGTGATTTGAGG - Intergenic
1034275203 7:149820975-149820997 TTGGCATGAGCAGTTGTTGCAGG - Intergenic
1036988951 8:13569982-13570004 TTCCCAAGTGCTGGGATTGCAGG + Intergenic
1038855288 8:31324404-31324426 TTGACAAGTGCTGGGATTACAGG + Intergenic
1039549655 8:38433579-38433601 TTAGCAAGTGCTGGGATTACAGG + Intronic
1043473284 8:80582011-80582033 GTGGCAAGTGCTGTGGTTGATGG - Intergenic
1045397644 8:101776888-101776910 TTTGCCAGTTCAGTGAGTGCAGG - Intronic
1045465231 8:102463470-102463492 TCCCCAAGTGGAGTGATTGCGGG - Intergenic
1046098360 8:109586267-109586289 TTGGCAAGTGCCAAGATTCCAGG + Intronic
1048180832 8:132192903-132192925 TTGGAAAGTGCTGGGATTACAGG + Intronic
1049662484 8:143825869-143825891 TTGGTTAGTGCAGTGATTTGGGG - Intronic
1052854185 9:33396841-33396863 TCGGCAAGTGCTGGGATTACAGG - Intronic
1053077956 9:35151055-35151077 TCCCCAAGTGCTGTGATTGCAGG + Intergenic
1053256511 9:36620908-36620930 TTGGCAGGTGCAATGCTGGCAGG - Intronic
1053932183 9:43121329-43121351 TCGGCAAGTGCTGGGATTACAGG - Intergenic
1054295295 9:63328509-63328531 TCGGCAAGTGCTGGGATTACAGG - Intergenic
1055383768 9:75738577-75738599 TTGCTAACTGCAGTGATTTCAGG + Intergenic
1055631700 9:78231401-78231423 TTGCAAAGTGCTGTGATTACAGG - Intergenic
1055775427 9:79762483-79762505 TTCGAAAGTGGAATGATTGCTGG + Intergenic
1058850778 9:109010248-109010270 TTGGCAAGTTCACTGAGTGTAGG - Intronic
1059147226 9:111911003-111911025 TTTGAAAGTGCTGGGATTGCAGG + Intronic
1059646094 9:116269519-116269541 TTGACAAGTGCTGTGATAGATGG + Intronic
1059907441 9:119003801-119003823 TTGGTTAGTGCTGTGATTTCGGG - Intergenic
1060267466 9:122120869-122120891 TTGCCATGTGCAGTGGGTGCTGG - Intergenic
1060947680 9:127579692-127579714 TTGGCAAGTGCAGTGTGGGCTGG + Intergenic
1187775903 X:22756997-22757019 TTGGAAAGGGCAGTGATTGAGGG + Intergenic
1189765205 X:44364956-44364978 TTGGCAATTACAGTGAAAGCTGG - Intergenic
1191839751 X:65503028-65503050 TTGGAATGTGCAATGATTCCAGG + Exonic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1197740073 X:129884554-129884576 TTGGAAAGTGCTGGGATTACAGG - Intergenic
1198116706 X:133551182-133551204 TTCTCAAGTGCAGGGACTGCTGG + Intronic