ID: 1001087710

View in Genome Browser
Species Human (GRCh38)
Location 5:168713218-168713240
Sequence CACAGCACGTTGGAGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 868
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 834}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001087701_1001087710 27 Left 1001087701 5:168713168-168713190 CCACACACATACACGAGTCTGGC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1001087710 5:168713218-168713240 CACAGCACGTTGGAGGGGCCGGG 0: 1
1: 0
2: 1
3: 32
4: 834
1001087702_1001087710 -7 Left 1001087702 5:168713202-168713224 CCTGAGTGCATCTTCCCACAGCA 0: 1
1: 0
2: 1
3: 8
4: 178
Right 1001087710 5:168713218-168713240 CACAGCACGTTGGAGGGGCCGGG 0: 1
1: 0
2: 1
3: 32
4: 834

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001087710 Original CRISPR CACAGCACGTTGGAGGGGCC GGG Intronic
900136182 1:1117981-1118003 CTCAGCACTTTGGGAGGGCCAGG - Intergenic
900270851 1:1787779-1787801 CCCAGCACGTTGGAAGGCCGAGG + Intronic
901826350 1:11864255-11864277 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
902066960 1:13696440-13696462 CCCAGCACGTTGGGGGGCCAAGG - Intergenic
902316099 1:15619709-15619731 CACAGCACTTTGGAAGGCCGAGG - Intronic
902348596 1:15836856-15836878 CTCAGCACTTTGGAAGGCCCTGG - Intergenic
902861122 1:19246530-19246552 CTCAGCACTTTGGAAGGTCCAGG + Intronic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903122046 1:21222588-21222610 CCCAGCACTTTGGAAGGCCCAGG + Intronic
903208895 1:21804311-21804333 CCCAGCACTTTGGAAGGGCAAGG - Intergenic
903272206 1:22196723-22196745 CCCAGCACTTTGGAAGGGCAAGG - Intergenic
903290523 1:22311112-22311134 CCCAGCACTTTGGAAGGGCGAGG + Intergenic
903469042 1:23572594-23572616 CACAGCACTTTGGGAGGACCAGG - Intergenic
903603065 1:24556162-24556184 CAGAGCAGGTAGGAGGCGCCTGG + Exonic
903654932 1:24943218-24943240 CCCAGCACGTGGGGGAGGCCAGG + Intronic
903991120 1:27270440-27270462 CCCAGCACTTTGGAGGGCCAAGG + Intronic
904311695 1:29633217-29633239 GACAGCATCATGGAGGGGCCAGG + Intergenic
904510017 1:30997261-30997283 CCCAGCACTTTGGAAGGGCAAGG + Intronic
904905447 1:33894407-33894429 CACAGCAGGCTGGAAGGGCTAGG + Intronic
905066342 1:35187478-35187500 CACAGCACTTTGGAAGGCCGAGG + Intronic
905406901 1:37739840-37739862 CTCAGCACTTTGGGAGGGCCAGG + Intronic
905457403 1:38097542-38097564 CACAGCAGGTCCCAGGGGCCTGG + Intergenic
906006964 1:42481966-42481988 CCCAGCACTTTGGAAGGCCCAGG + Intronic
906235339 1:44204167-44204189 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
906977507 1:50591420-50591442 CCCAGCACTTTGGAAGGGCGTGG + Intronic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
907539318 1:55198230-55198252 CCCAGCACGTTGGAAGGCCAAGG - Intronic
908571151 1:65411716-65411738 CCCAGCACTTTGGGGGGGGCAGG + Intronic
908760851 1:67510661-67510683 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
909409991 1:75339030-75339052 CACAGAACCTTGGAGAGGGCAGG + Intronic
909749535 1:79141691-79141713 CACAGCACTTTGGGAGGCCCAGG - Intergenic
910017901 1:82550112-82550134 AACAGCACTTCGGAGTGGCCTGG + Intergenic
910137414 1:83988956-83988978 CCCAGCACTTTGGAGGGCCGAGG - Intronic
910411110 1:86945816-86945838 CTCAGCACTTTGGAAGGGCGAGG + Intronic
911019411 1:93371959-93371981 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
911177510 1:94831921-94831943 CCCAGCACTTTGGAAGGGCGAGG + Intronic
911182247 1:94871441-94871463 CCCAGCACTTTCCAGGGGCCTGG + Intronic
911600666 1:99844791-99844813 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
911608997 1:99939863-99939885 CCCAGCACTTTGGGGGGCCCAGG - Intergenic
911641595 1:100295657-100295679 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
911895981 1:103435953-103435975 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
912233373 1:107821631-107821653 CAGAGGAGGTTGGAGGGGCCAGG + Intronic
912375665 1:109207869-109207891 CCCAGCACTTTGGGAGGGCCAGG + Intergenic
912692376 1:111813954-111813976 GCCAGCACGTTGGTGGGGCACGG - Intronic
912837976 1:113013590-113013612 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
913006567 1:114638506-114638528 CCCAGCACTTTGGGGGGCCCAGG + Intronic
913542911 1:119839033-119839055 CACAGCACTTTGGGAGGCCCAGG - Intergenic
913668029 1:121068421-121068443 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
913965591 1:143374650-143374672 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
914019719 1:143855551-143855573 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
914059965 1:144200252-144200274 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
914119185 1:144766117-144766139 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
914336995 1:146724564-146724586 CACAGCTCATTGGTGGGACCAGG + Intergenic
914658271 1:149763767-149763789 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
915159616 1:153908716-153908738 CCCAGCACTTTGGGAGGGCCAGG - Intronic
915335559 1:155139086-155139108 CACAGCACTTTGGGAGGCCCAGG + Intergenic
916755267 1:167763262-167763284 CCCAGCACTTTGGGGGGGCCGGG + Intronic
917089307 1:171336850-171336872 CCCAGCACGTTGGGAGGGCAAGG - Intronic
918211142 1:182351873-182351895 CACAGCCAAATGGAGGGGCCAGG + Intergenic
918441923 1:184576373-184576395 CCCAGCACTTTGGAAGGCCCAGG - Intronic
918448317 1:184635710-184635732 CAGAGCACTCTGGAGGGGCAGGG - Intergenic
918453939 1:184687863-184687885 CAGAGCAAGTTAGATGGGCCTGG - Intergenic
918996621 1:191769559-191769581 CCCAGCATGTTGGAAGGCCCTGG - Intergenic
919380406 1:196853162-196853184 CCCAGCACTTTGGAGGGCCAAGG + Intronic
919458516 1:197847979-197848001 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
920069392 1:203291297-203291319 CACAGCACATGGGTGTGGCCCGG - Intergenic
921607385 1:217171636-217171658 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
923352190 1:233119307-233119329 CACAGCACTTTGGGAGGGCGAGG + Intronic
923800098 1:237200513-237200535 CCCAGCACGTTGGAGGGCCAAGG - Intronic
924416971 1:243865871-243865893 CCCAGCACGTTGGGAGGCCCAGG - Intergenic
924511615 1:244732700-244732722 CAGAGCAAGGTGGAAGGGCCAGG - Intergenic
924725961 1:246670910-246670932 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1063006540 10:1976935-1976957 CCCAGCACTTTGGAAGGGCCAGG - Intergenic
1063397492 10:5703970-5703992 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1063439767 10:6063175-6063197 CACATCACGTTGACTGGGCCTGG + Intergenic
1063705898 10:8430547-8430569 CTCAGCACGTTGGAAGGTCGAGG - Intergenic
1063968051 10:11362223-11362245 CACAGCACCAGGAAGGGGCCTGG + Intergenic
1064041585 10:11970559-11970581 CACAGCACTTTGGAAGGCCAAGG + Intronic
1064195898 10:13243885-13243907 CACAGCACTTTGGGGGGCCAAGG + Intergenic
1065248987 10:23790983-23791005 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1065488748 10:26260376-26260398 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1065514549 10:26512078-26512100 CACAGCACTTTGGGAGGCCCAGG - Intronic
1065706423 10:28475265-28475287 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1066274942 10:33859575-33859597 CTCAGAGCGTTGGAGGTGCCAGG + Intergenic
1066446900 10:35491862-35491884 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1067048700 10:43000063-43000085 CACTGCCCAGTGGAGGGGCCTGG - Intergenic
1067628768 10:47944541-47944563 CACATGTCGTGGGAGGGGCCTGG + Intergenic
1067867926 10:49928019-49928041 CCCAGCACATTGGGGGGCCCAGG + Intronic
1068036238 10:51763501-51763523 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1069011483 10:63378339-63378361 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1069310813 10:67034020-67034042 CTCAGCACGTTGGAAGGCCGAGG - Intronic
1069314335 10:67078764-67078786 CTCAGCACGTTGGGGGGCCGAGG - Intronic
1069448995 10:68500999-68501021 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1069455597 10:68551532-68551554 CCCAGCACTTTGGAGGGCCTAGG - Intergenic
1069477764 10:68750473-68750495 CCCAGCACTTTGGGAGGGCCAGG - Intronic
1069498719 10:68930366-68930388 CCCAGCACTTTGGAAGGGCAAGG - Intronic
1070034754 10:72711469-72711491 CACAGCACTTTGGAAGGCCGAGG - Intronic
1070071300 10:73092606-73092628 CACAGCACTTTGGAAGGCCGAGG - Intronic
1070181129 10:74015300-74015322 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1071002900 10:80851199-80851221 CACAGCACTTTGGGAGGCCCAGG - Intergenic
1071610642 10:87028229-87028251 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1072074703 10:91958304-91958326 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1072259627 10:93656817-93656839 CCCAGCACTTTGGGAGGGCCAGG - Intronic
1072598288 10:96896672-96896694 CCCAGCACTTTGGAAGGGCAGGG - Intronic
1072977339 10:100070176-100070198 CTCAGCACTTTGGAAGGGCGAGG - Intronic
1073224882 10:101909708-101909730 CCCAGCACTTTGGAAGGGCAAGG - Intronic
1073226802 10:101927820-101927842 CCCAGCACTTTGGAGGGCCAGGG + Intronic
1074134302 10:110613577-110613599 CACATCTCGTGGGAGGGACCAGG - Intergenic
1074195498 10:111180887-111180909 CACACGTCGTGGGAGGGGCCTGG + Intergenic
1075695785 10:124434172-124434194 CCCAGCACGTTGGAAGGCCAAGG + Intergenic
1076046607 10:127299352-127299374 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1077257470 11:1593763-1593785 CCCAGCACTTTGGGAGGGCCAGG + Intergenic
1077504454 11:2923665-2923687 GGCAGCACTTTGGAGAGGCCAGG + Intronic
1078296244 11:10073460-10073482 CTCAGCACTTTGGAAGGGCCAGG + Intronic
1078370282 11:10738803-10738825 CCCAGCACCTTGGAAGGCCCAGG + Intergenic
1079057018 11:17215086-17215108 CACAGCACTTTGGGGGGCCGAGG + Intronic
1079115088 11:17635532-17635554 CACAGCACGTTGCTGGGGGTGGG - Intronic
1079196959 11:18336999-18337021 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1079494936 11:21031796-21031818 CCCAGCACTTTGGAAGGGCGAGG + Intronic
1079498793 11:21077490-21077512 CACAGCACTTTGGGAGGGCGAGG + Intronic
1080094163 11:28384558-28384580 CACAGCACGTTGGGAGGCCAAGG - Intergenic
1080412408 11:32038185-32038207 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1080468462 11:32521360-32521382 CCCAGCACTTTGGAAGGTCCAGG + Intergenic
1081404553 11:42681442-42681464 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1081456460 11:43228092-43228114 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1082032283 11:47613835-47613857 CACAGCACTTTGGGAGGCCCAGG + Intergenic
1082082677 11:48024446-48024468 CCCAGCACTTTGGAAGGGCAAGG - Intronic
1082868243 11:57919339-57919361 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1083398344 11:62406689-62406711 CACAGCACATTGGGAGGGCTAGG - Intronic
1083699175 11:64463438-64463460 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1083725884 11:64627822-64627844 CAGTGCACGCTGGTGGGGCCAGG + Intronic
1083906213 11:65673072-65673094 GACAGCAGGTTGGAGAGGACAGG - Intergenic
1084019128 11:66407241-66407263 CACAGCACTTTGGGAGGCCCAGG + Intergenic
1084136567 11:67187822-67187844 CCCAGCACCTTGGAAGGCCCAGG - Intronic
1084176800 11:67426771-67426793 CACAGCACTTTGGAAGGCCAAGG + Intergenic
1084607847 11:70182856-70182878 CCCAGCACTTTGGGAGGGCCAGG + Intronic
1085872277 11:80364402-80364424 CCCAGCACGTTGGGAGGCCCAGG + Intergenic
1086164588 11:83762829-83762851 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1086166899 11:83789794-83789816 CCCAGCACGTTGGAAGGCCGAGG - Intronic
1086549584 11:88040463-88040485 CCCAGCACTTTGGGAGGGCCAGG + Intergenic
1087037747 11:93772070-93772092 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1087638432 11:100729017-100729039 CACAGCACTTTGGAAGGCCGAGG - Intronic
1088279127 11:108119451-108119473 CACAGCACTTTGGGAGGCCCAGG - Intergenic
1088308238 11:108433204-108433226 CCCAGCACTTTGGAGGGGCGAGG + Intronic
1088691439 11:112331941-112331963 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1089241157 11:117081371-117081393 CACAGCACTTTGGAAGGCCGAGG + Intronic
1089636304 11:119814878-119814900 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1089796442 11:120985077-120985099 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1090015534 11:123082855-123082877 CCCAGCACTTTGGGAGGGCCAGG - Intronic
1090541905 11:127715795-127715817 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1090911933 11:131128978-131129000 AACAGCAGGTTGGATGGGCCTGG + Intergenic
1091224554 11:133949801-133949823 CACAGCAGCTCAGAGGGGCCAGG + Intronic
1091658909 12:2367013-2367035 CACATGTCGGTGGAGGGGCCTGG - Intronic
1092151577 12:6252524-6252546 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1092243523 12:6850266-6850288 CCCAGCACGTTGGAAGGCCGGGG - Intronic
1092352954 12:7770860-7770882 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1092609012 12:10152713-10152735 CACAGCACTTTGGAAGGCCAAGG + Intergenic
1093263387 12:16969369-16969391 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
1093365519 12:18291956-18291978 CCCAGCACTTTGGAAGGGCGAGG + Intronic
1094205588 12:27837222-27837244 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
1095376908 12:41541178-41541200 CCCAGCACGTTGGAAGGCCAAGG - Intronic
1095457488 12:42404276-42404298 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1095742145 12:45619147-45619169 CCCAGCACGTTGGGAGGGCGAGG - Intergenic
1095902202 12:47339515-47339537 CCCAGCACTTTGGAGGGCCATGG - Intergenic
1096072648 12:48783832-48783854 CCCAGCACTTTGGAAGGCCCTGG + Exonic
1096100783 12:48969552-48969574 CACAGCACAGAGGAGGGGACTGG + Intronic
1096152201 12:49321742-49321764 CCCAGCACTTTGGATGGCCCAGG - Intergenic
1096271399 12:50168407-50168429 CCCAGCACGTTGGAAGGCCAAGG + Intergenic
1096365743 12:51026924-51026946 CCCAGCACTTTGGAGGGCCCAGG + Intronic
1096415053 12:51405644-51405666 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1097197678 12:57252775-57252797 CACAGCACTTTGGAAGGCCGAGG + Intronic
1097211065 12:57370378-57370400 CACAGCACTTTGGGAGGCCCGGG + Intronic
1097256311 12:57677873-57677895 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1097359704 12:58645542-58645564 CACAGCACTTTGGGAGGCCCAGG - Intronic
1097789584 12:63800668-63800690 CCCAGCACGTTGGAAGGCCAAGG + Intronic
1098147052 12:67508209-67508231 CACAGCACGTTGGGAGGCCGAGG - Intergenic
1098255171 12:68609328-68609350 CCCAGCACTTTGGGGGGCCCAGG + Intergenic
1098277897 12:68831815-68831837 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1098279088 12:68845016-68845038 CACAGCACTTTGGGGGGCCAAGG - Exonic
1098667470 12:73181356-73181378 CCCAGCACTTTGGAAGGGCAAGG - Intergenic
1099190857 12:79560941-79560963 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1099320382 12:81139883-81139905 CCCAGCACTTTGGGGGGCCCAGG - Intronic
1100240888 12:92709790-92709812 CCCAGCACTGTGGAAGGGCCAGG + Intergenic
1100252817 12:92847203-92847225 CCCAGCACGTTGGGAGGCCCAGG - Intronic
1100289738 12:93202340-93202362 CCCAGCACTTTGGAGGGCCAGGG + Intergenic
1101009576 12:100435569-100435591 CACAGCACTTTGGGAGGCCCAGG - Intergenic
1101382598 12:104227515-104227537 CACAGCACTTTGGGAGGCCCAGG - Intronic
1101465117 12:104940665-104940687 CCCAGCACTTTGGAGGGCCAAGG + Intronic
1101751501 12:107586134-107586156 CTCAGGACGTTGCAGGGGCAGGG + Intronic
1102119876 12:110431659-110431681 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1102276154 12:111583513-111583535 CCCAGCACGTTGGGAGGCCCAGG + Intronic
1102476892 12:113194571-113194593 CCCAGCACTTTGGGGGGCCCAGG + Intergenic
1102497243 12:113328277-113328299 CCCAGCACGTTGGAAGGCCGAGG - Intronic
1103569932 12:121838339-121838361 TAAAGCAGGTAGGAGGGGCCTGG - Intergenic
1103809935 12:123605271-123605293 CACAGCACTTTGGGAGGCCCAGG - Intronic
1103912466 12:124360004-124360026 CTCAGCCCGTTGGTGTGGCCAGG - Intronic
1104001915 12:124865292-124865314 CCCAGCACTTTGGAAGGTCCAGG + Intronic
1104119413 12:125784692-125784714 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1104325899 12:127798016-127798038 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1104363608 12:128156429-128156451 CCCAGCACTTTGGGGGGCCCAGG - Intergenic
1104877017 12:132042199-132042221 CACAGCACTTTGGAAGGCCAAGG - Intronic
1105014354 12:132777123-132777145 CACAGCACACTGGAGGAGCGTGG - Intronic
1105391819 13:19986850-19986872 CACAGCACTTTGGAAGGCCGAGG + Intronic
1105751992 13:23429611-23429633 CCCAGCACTTTGGGAGGGCCAGG - Intronic
1105962308 13:25353423-25353445 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1106058678 13:26263995-26264017 CCCAGCACTTTGGGGGGCCCAGG - Intronic
1106110546 13:26772798-26772820 CACTGCAGGTTGGAAGTGCCAGG + Intergenic
1106838411 13:33660832-33660854 CCCAGCACGTTGGAAGGCCAAGG - Intergenic
1107902938 13:45035912-45035934 CTCAGCACTTTGGAGGGCCAAGG + Intronic
1108016788 13:46085098-46085120 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1108399959 13:50030885-50030907 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1108544013 13:51472727-51472749 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1108974334 13:56419069-56419091 CACAGCACTTTGGAAGGCCCAGG - Intergenic
1109568284 13:64149378-64149400 CTCAGCACTTTGGTGGGGGCGGG + Intergenic
1109917436 13:69009182-69009204 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1110222573 13:73089295-73089317 CTCAGCACTTTGGAAGGGCAAGG - Intergenic
1110300701 13:73923505-73923527 CACAGCCTGTTAGAGGAGCCAGG - Intronic
1110428395 13:75395578-75395600 CCCAGCACGTTGGAAGGACGAGG + Intronic
1111294918 13:86265775-86265797 CCCAGCACTTTGGAGGGACAAGG - Intergenic
1111920949 13:94410746-94410768 CACAGCACTTTGGGAGGCCCGGG + Intergenic
1112270300 13:97962564-97962586 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1112379220 13:98872855-98872877 CACAGCATAGTGGTGGGGCCAGG - Intronic
1113090976 13:106617395-106617417 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1113248376 13:108424306-108424328 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1113475008 13:110574325-110574347 CCCAGCACACTGGAGGTGCCGGG + Intergenic
1114579850 14:23747524-23747546 CCCAGCACGTTGGAAGGCCAAGG + Intergenic
1114867404 14:26613636-26613658 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1115739041 14:36368021-36368043 CAGCGCACTTTGGAGGGGCAAGG - Intergenic
1115915577 14:38309632-38309654 CACAGCACTTTGGGGGGCCAAGG + Intergenic
1116850912 14:49908356-49908378 CCCAGCACGTTGGGAGGCCCAGG - Intergenic
1117108039 14:52418894-52418916 CCCAGCACTTTGGAGGGTCAAGG - Intergenic
1117652325 14:57919764-57919786 CACAGCACTTTGGAGGGTCATGG + Intronic
1117700846 14:58411785-58411807 CCCAGCACGTTGGGAGGCCCAGG - Intronic
1118015872 14:61660231-61660253 CCCAGCACGTTGGAAGGGTAAGG - Intergenic
1118056978 14:62089065-62089087 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1118397984 14:65354002-65354024 CCCAGCACTTTGGAAGGGCGAGG + Intergenic
1118600446 14:67468293-67468315 TACAGCAGGTTAGAGGAGCCAGG - Intronic
1120912164 14:89677075-89677097 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1121334813 14:93070742-93070764 CACAGAGAGTTGAAGGGGCCTGG + Intronic
1121368855 14:93338654-93338676 CCCAGCAGGTTGGAAGGCCCAGG + Intronic
1121555045 14:94830035-94830057 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1121560735 14:94873565-94873587 CACAGGAGGTTGGAGCTGCCGGG + Intergenic
1122133628 14:99620336-99620358 TCCAGCAGGTTGGAGAGGCCAGG - Intergenic
1122512442 14:102280459-102280481 CCCAGCACGTTGGAAGGCCTAGG - Intronic
1122518004 14:102322010-102322032 CACAGCATGTTGGATGGAACTGG - Intronic
1122555173 14:102575051-102575073 CACAGCACGGGGGCGGGGCGGGG - Intergenic
1122615453 14:103014667-103014689 CACAGAAGGTTCCAGGGGCCTGG + Intronic
1122667435 14:103341761-103341783 CATTGCACGTTGGATGAGCCAGG + Exonic
1122698034 14:103567120-103567142 CTCAGCACGTTGGAAGGCCGAGG + Intronic
1123688963 15:22821213-22821235 CCCAGCACTTTGGAAGGGCGAGG - Intronic
1123702616 15:22927084-22927106 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1124269968 15:28271410-28271432 CCCAGCACTTTGGGAGGGCCAGG + Intronic
1124381358 15:29170055-29170077 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1125020260 15:34977968-34977990 CACAGCACTTTGGAAGGCCGAGG - Intergenic
1125592480 15:40863561-40863583 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
1125683024 15:41544699-41544721 CACAGCACTTTGGGGGGCCGAGG - Intergenic
1126459518 15:48900255-48900277 CCCAGCACTTTGGAAGGGCTAGG + Intronic
1127320328 15:57838639-57838661 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1127374378 15:58369527-58369549 CACAGAAGCTTGGATGGGCCTGG - Intronic
1127401082 15:58586484-58586506 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1127585353 15:60372903-60372925 CCCAGCACTTTGGGAGGGCCTGG - Intronic
1127738665 15:61874024-61874046 CACAGCAACTTGGATGAGCCTGG + Intronic
1127860361 15:62988924-62988946 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1128583537 15:68826709-68826731 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1128704395 15:69828168-69828190 CACAGCAGGTTAGAGGGACGGGG - Intergenic
1128849995 15:70944653-70944675 CACAGCACGTTGGGAGGCCAAGG - Intronic
1129033617 15:72636894-72636916 CGCAGCCCGCTGGAGGTGCCGGG - Intergenic
1129216268 15:74100339-74100361 CGCAGCCCGCTGGAGGTGCCGGG + Intronic
1129575140 15:76735093-76735115 CCCAGCACGTTAGGAGGGCCGGG + Intronic
1129648920 15:77465643-77465665 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1129733429 15:77944693-77944715 CGCAGCCCGCTGGAGGTGCCGGG + Intergenic
1129864631 15:78896224-78896246 CACAGCACTTTGGGGGGCCGAGG - Intronic
1130351975 15:83100824-83100846 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1132169973 15:99640797-99640819 CCCAGCACTTTGGGAGGGCCAGG - Intronic
1132776402 16:1597222-1597244 GAGAGCACGTTAGACGGGCCAGG - Intronic
1133069103 16:3234153-3234175 CCCAGCACTTTGGAAGGCCCTGG + Intronic
1133141901 16:3751335-3751357 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1133555665 16:6904348-6904370 CCCAGCACCTTGGAAGGCCCAGG + Intronic
1133687925 16:8184395-8184417 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1134029117 16:10977766-10977788 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1134390779 16:13817988-13818010 CACAGCACTTTGGAAGGTCGAGG + Intergenic
1134602204 16:15542311-15542333 CACAGCACTTTGGGAGGTCCAGG - Intronic
1134608526 16:15589886-15589908 CACTGCACGTTGGAGCGGGAGGG - Intronic
1134921038 16:18116693-18116715 CACATGACATTGGAGGGGCAGGG + Intergenic
1135123831 16:19789965-19789987 CCCAGCACTTTGGAGGGACAAGG + Intronic
1135340996 16:21647879-21647901 CACAGCACTCTGGGGAGGCCAGG - Intronic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136145957 16:28316927-28316949 CCCAGCACTTTGGGAGGGCCAGG + Intronic
1136329531 16:29562701-29562723 CCCAGCACTTTGGAAGGGCAAGG + Intergenic
1136359458 16:29769106-29769128 CTCAGCACTTTGGAGGGCCAAGG + Intergenic
1136444160 16:30302408-30302430 CCCAGCACTTTGGAAGGGCAAGG + Intergenic
1136589993 16:31212710-31212732 CCCAGCACTTTGGGGGGCCCAGG - Intergenic
1138118086 16:54376273-54376295 CACAGCACGTTGGGAGGCCAAGG - Intergenic
1138487697 16:57357458-57357480 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1138515385 16:57533163-57533185 CCCAGCCCCTAGGAGGGGCCTGG - Intronic
1139079421 16:63497320-63497342 CACAGCACTTTGGAGGGCCAAGG - Intergenic
1139353540 16:66353102-66353124 CACAGCACCTGGGAGGGCCTGGG + Intergenic
1139579830 16:67865966-67865988 CCCAGCACGTTGGAAGGCCAAGG - Intronic
1139758123 16:69161911-69161933 TACAGCACTTCGGAAGGGCCAGG - Intronic
1139997274 16:70992755-70992777 CACAGCTCATTGGTGGGACCAGG - Intronic
1140068631 16:71629989-71630011 CTCAGCACTTTGGAAGGCCCAGG + Intronic
1140133993 16:72189084-72189106 CACAGTACTTTGGATGTGCCAGG + Intergenic
1140171291 16:72607611-72607633 CCCAGCACTTTGTAGGGGCGGGG + Intergenic
1140459249 16:75125571-75125593 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1140658409 16:77164029-77164051 CAAAGCCCTATGGAGGGGCCAGG - Intergenic
1141108216 16:81250829-81250851 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1141585550 16:85031227-85031249 ACCAGCACTTTGTAGGGGCCAGG + Intronic
1141875575 16:86822031-86822053 TACTGCATGTAGGAGGGGCCAGG - Intergenic
1141957581 16:87383218-87383240 GACACCACGTTGAGGGGGCCAGG - Intronic
1141980777 16:87548756-87548778 CCCAGCACGTTGGGAGGGCAAGG + Intergenic
1143156545 17:4840921-4840943 CACAGCCTGTGGGAGGAGCCTGG + Intronic
1143332858 17:6150262-6150284 CACAGCAGGTGGGATGGGCTGGG + Intergenic
1143823133 17:9581064-9581086 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1144088208 17:11829721-11829743 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1144292361 17:13838824-13838846 CACAGCACTTTGGGGGGCCGAGG + Intergenic
1144303610 17:13947087-13947109 CACAGCACTTTGGAAGGCCGAGG - Intergenic
1144497357 17:15757079-15757101 CCCAGGGCCTTGGAGGGGCCTGG + Intergenic
1144629146 17:16861563-16861585 CCCAGGGCCTTGGAGGGGCCTGG + Intergenic
1144652272 17:17014551-17014573 CCCAGGGCCTTGGAGGGGCCTGG - Intergenic
1145031115 17:19506112-19506134 TCCAGCACATTGGAGGGACCAGG - Intronic
1145245438 17:21266109-21266131 CCCAGCACTTTGGGGGGGCAAGG + Intergenic
1146139461 17:30352607-30352629 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1146140243 17:30361466-30361488 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1146353235 17:32113207-32113229 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1146994644 17:37308685-37308707 CCCAGCACGTTGGAAGGCCAAGG + Intronic
1147294977 17:39475083-39475105 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1147681449 17:42249910-42249932 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1148234976 17:45962673-45962695 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1148273117 17:46279432-46279454 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1148515289 17:48211189-48211211 CCCAGCACTTTGGAGGGCCAAGG + Intronic
1148727401 17:49803672-49803694 CACAGCACTTTGGGAGGGCGAGG - Intronic
1148888949 17:50793891-50793913 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1150017473 17:61572850-61572872 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1150412702 17:64960190-64960212 CACAGCACTTTGGAAGGCCATGG - Intergenic
1150679774 17:67275467-67275489 CCCAGCACTTTGGGGGGCCCAGG - Intergenic
1150806329 17:68322226-68322248 CACAGCACCTTGGTGGGGCAGGG - Intronic
1151224326 17:72637538-72637560 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1151283256 17:73092214-73092236 CAGAGCAAGTGGGAGGGGCCTGG + Intronic
1151782886 17:76259027-76259049 CCCAGCACGTTGGAAGGCCAAGG + Intergenic
1151831851 17:76557444-76557466 CACAGAAAGTTCGAGGGGGCAGG - Intergenic
1151931724 17:77236521-77236543 CACAGCACTTTGGAAGGCCAAGG + Intergenic
1152117614 17:78398368-78398390 CACAGGAAGCAGGAGGGGCCAGG - Intronic
1152375139 17:79914980-79915002 CACAGCGGGTTGGGGGGGCTTGG - Intergenic
1152402260 17:80074258-80074280 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1152670465 17:81601505-81601527 CCCAGCACTTTGTAGGGGCAAGG - Intronic
1152706187 17:81844798-81844820 CCCAGCCCGCTGGCGGGGCCCGG - Intronic
1152717534 17:81907156-81907178 CACAGCCCTTGGGAGGGACCTGG + Intronic
1152776319 17:82204218-82204240 CGCAGCAGCTTGGAGGAGCCAGG - Intronic
1153476549 18:5504903-5504925 CACAGCACGTTCAAGGGCACTGG - Intronic
1153563839 18:6399187-6399209 CCCAGCACGTTGGAAGGCCGAGG + Intronic
1154130793 18:11735299-11735321 CCCAGCACTTTGGAAGGGCAAGG - Intronic
1154192347 18:12241298-12241320 CTCAGCACTTTGGAAGGGCGAGG - Intergenic
1155465891 18:26134702-26134724 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1155493148 18:26419183-26419205 CTCAGCACTTTGGGAGGGCCTGG - Intergenic
1156321050 18:36022710-36022732 CACAGCACTTTGGGAGGCCCAGG + Intronic
1156542472 18:37928564-37928586 CACAGCATGATATAGGGGCCAGG + Intergenic
1157204671 18:45688035-45688057 CACAGGTCTTTAGAGGGGCCAGG - Intergenic
1157232044 18:45926574-45926596 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1158472717 18:57751953-57751975 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1159294938 18:66472660-66472682 CTCAGCACTTTGGGGGGCCCAGG - Intergenic
1159314016 18:66747564-66747586 CCCAGCACTTTGGAAGGGCAAGG - Intergenic
1159730812 18:72024567-72024589 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1159898653 18:74021345-74021367 CCCAGCACTTTGGATGGCCCAGG + Intergenic
1160099153 18:75904348-75904370 CACAGCACATGGCAGAGGCCAGG + Intergenic
1160273104 18:77405431-77405453 CCCAGCACTTTGGAGGGCCGGGG - Intergenic
1160686275 19:438441-438463 CTCAGCACCCTGCAGGGGCCAGG - Intronic
1160806599 19:994836-994858 CACAGCAGACCGGAGGGGCCTGG - Intronic
1160875004 19:1292823-1292845 CACCGCAGCCTGGAGGGGCCCGG + Intronic
1160959275 19:1711547-1711569 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1161225001 19:3139783-3139805 CACAGCACTTTGGGGGGCCGAGG + Intronic
1161408965 19:4105950-4105972 CACAGCAAGATGCGGGGGCCAGG - Intronic
1161643547 19:5438421-5438443 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1161765983 19:6209160-6209182 CACTGCACCTTGGAGGGTCTGGG + Intergenic
1162211013 19:9092168-9092190 CACAGCACTTTGGGAGGGCGAGG - Intergenic
1162388556 19:10375664-10375686 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1162406306 19:10476442-10476464 CCCAGCACTTTGGGGGGGCGAGG - Intergenic
1162567860 19:11454096-11454118 CCCAGCACCTAGGTGGGGCCTGG - Exonic
1162580295 19:11525649-11525671 CCCAGCACGTTGGGAGGTCCAGG + Intronic
1162721877 19:12667362-12667384 CCCAGCACTTTGGGAGGGCCAGG + Intronic
1162755624 19:12857660-12857682 CACAGCACTTTGGAAGGCCAAGG - Intronic
1163033551 19:14559354-14559376 AAAAGCAAATTGGAGGGGCCAGG - Intronic
1163175382 19:15561049-15561071 TAGAGCACGTTGGAGGGCCCTGG - Intergenic
1163258788 19:16174004-16174026 CCCAGCACTTTGGGAGGGCCAGG + Intergenic
1163357059 19:16820511-16820533 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1163652704 19:18527879-18527901 CACAGCACTTTGGAAGGCCGAGG + Intergenic
1163948632 19:20563913-20563935 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1164061377 19:21678269-21678291 CACAGGATGGTGCAGGGGCCCGG + Intergenic
1164065278 19:21709443-21709465 CACAGGATGGTGCAGGGGCCTGG - Intergenic
1164185555 19:22864783-22864805 CCCAGCACTTTGGAAGGCCCTGG - Intergenic
1164253790 19:23509447-23509469 CTCAGCACTTTGGAAGGCCCAGG + Intergenic
1164502784 19:28833396-28833418 CACAGCACGAGGGCGGGTCCAGG - Intergenic
1164596643 19:29534462-29534484 CACAGCACTTTGGAAGGCCGAGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165505289 19:36223611-36223633 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1165567268 19:36741784-36741806 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1165761272 19:38322564-38322586 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1165908080 19:39205854-39205876 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1165997207 19:39852679-39852701 CACAGCACGTTGGGAGGCCGAGG - Intergenic
1166015538 19:39976757-39976779 CACAGCACTTTGGAAGGCCCAGG - Intronic
1166376812 19:42332106-42332128 CCCAGCACTTTTGAGAGGCCAGG - Intronic
1166678973 19:44756228-44756250 CACAGCAATATGGAGAGGCCTGG - Exonic
1166725023 19:45021823-45021845 CCCAGCACGTTGGAAGGCCGAGG - Intronic
1166731776 19:45063255-45063277 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1166943888 19:46385391-46385413 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1166960245 19:46492681-46492703 CACAGCCTATGGGAGGGGCCAGG + Exonic
1167262778 19:48468410-48468432 CCCAGCACTTTGGAGGGCCAAGG + Intronic
1167306593 19:48713499-48713521 GACAGCACGTCGAAGGAGCCAGG + Exonic
1167385687 19:49161878-49161900 CCCAGCACGTTGGGAGGCCCAGG - Intronic
1202699370 1_KI270712v1_random:152135-152157 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
925056588 2:861585-861607 CTCAGAACGCTGGAGGAGCCTGG + Intergenic
926090606 2:10046604-10046626 CCCAGCACTTTGGGAGGGCCAGG + Intronic
926123347 2:10256526-10256548 CACAGCAGGTGCCAGGGGCCTGG + Intergenic
926184983 2:10683031-10683053 CCCAGCACTTTGGAAGGCCCAGG - Intronic
926423039 2:12717291-12717313 CGCCGCGCGTTGGAAGGGCCAGG + Exonic
926875121 2:17467590-17467612 CACAGCACTTTGGAAGGCCAAGG + Intergenic
927140068 2:20123982-20124004 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
927198351 2:20563436-20563458 CACAGCTCATTGCAGGGGCCAGG - Intronic
927748259 2:25642660-25642682 CTCAGCACTTTGGAAGGGCAAGG - Intronic
928068662 2:28192770-28192792 CACAGCACTTTGGGAGGCCCAGG - Intronic
928555902 2:32424761-32424783 CCCAGCACGTTGGGTGGGCGAGG - Intronic
928567684 2:32569620-32569642 CACAGCACTTTGGGAGGTCCAGG - Intronic
928809947 2:35211436-35211458 CTCAGCACTTTGGAAGGCCCAGG - Intergenic
929194727 2:39173424-39173446 CCCAGCACTTTGGAAGGGCCAGG + Intergenic
929216051 2:39414623-39414645 CACAGCACTTTGGGAGGCCCAGG + Intronic
929216146 2:39415699-39415721 CACAGCACTTTGGAAGGCCGAGG + Intronic
929306955 2:40374259-40374281 CACAGCACTTTGGAAGGCCAAGG + Intronic
929486490 2:42359973-42359995 CACAGCACTTTGGAAGGCCGAGG - Intronic
929518713 2:42627826-42627848 CCCAGCACTTTGGAAGGCCCAGG - Intronic
930050920 2:47215697-47215719 CCCAGCACGTTGGGAGGGCAAGG + Intergenic
930239519 2:48921669-48921691 AACAGCACCTTGGAGAGACCTGG - Intergenic
930794184 2:55370389-55370411 CCCAGCACGTTGGAAGGCCGAGG + Intronic
930865057 2:56114502-56114524 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
931062716 2:58548953-58548975 CCCAGCACTTTGGAAGGGCGAGG + Intergenic
931398744 2:61911221-61911243 CCCAGCACTTTGGGGAGGCCAGG + Intronic
931472522 2:62553391-62553413 CTCAGCACCTTGGTGGGCCCAGG + Intergenic
931701053 2:64909354-64909376 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
931727430 2:65124695-65124717 CACAGCACTTTGGGAGGCCCAGG - Intronic
932184514 2:69681580-69681602 CCCAGCACTTTGGAAGGCCCAGG - Intronic
932465806 2:71923387-71923409 CACAGCAAGTTGGAGGAGCTTGG - Intergenic
932590937 2:73066748-73066770 CCCAGCACTTTGGGAGGGCCAGG + Intronic
932602795 2:73140764-73140786 CCCAGCACTTTGGAGGGCCGAGG - Intronic
932603768 2:73149597-73149619 CCCAGCACTTTGGAAGGCCCAGG - Intronic
932615898 2:73231367-73231389 CCCAGCACTTTGGAAGGCCCAGG - Intronic
932975321 2:76592814-76592836 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
933208988 2:79544186-79544208 CACAGCACTTTGGAAGGCCAAGG - Intronic
933278475 2:80306556-80306578 CGCAGCACCTTGGAGGTGCCAGG - Intronic
934754949 2:96818331-96818353 CACAGCACTTTGGGAGGGCGAGG - Intronic
937128857 2:119491759-119491781 CCCAGCACTTTGGAGGGCCGAGG - Intronic
937184579 2:120028282-120028304 CCCAGCACTTTTGAGAGGCCAGG + Intronic
937945486 2:127331854-127331876 CCCAGCACTTTGGAAGGCCCAGG - Intronic
938044623 2:128106798-128106820 CCCAGCACTTTGGAAGGGGCAGG - Intronic
938048789 2:128148326-128148348 CACAGCACTTTGGAAGGCCGAGG - Intronic
938210593 2:129463297-129463319 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
938734769 2:134176071-134176093 GCTAGCACGTTGGAGGGGCTGGG + Intronic
940667606 2:156627650-156627672 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
941260192 2:163287873-163287895 CCCAGCACTTTGGAAGGGCTAGG - Intergenic
941472553 2:165906692-165906714 CCCAGCACGTTGGAAGGCCGTGG + Intronic
941908293 2:170737991-170738013 CACAGCATGGTGGCTGGGCCCGG + Intergenic
941940941 2:171036640-171036662 CACAGTACGATGGAGGAACCAGG - Intronic
942060425 2:172224140-172224162 CCCAGCACGTTGGAAGGCCGAGG + Intergenic
942279725 2:174347863-174347885 CACAGCACTTTGGGAGGCCCAGG - Intergenic
942342477 2:174962644-174962666 CCCAGCACTTTGGAAGGCCCGGG + Intronic
942456211 2:176140303-176140325 CACAGCACATTCGAGGGCTCTGG + Intergenic
943203887 2:184865128-184865150 CCCAGCACTTTGGAAGGCCCAGG - Intronic
943269602 2:185782084-185782106 CCCAGCACTTTGGGGGGCCCAGG - Intronic
943880573 2:193139772-193139794 CACAAGACTTAGGAGGGGCCAGG - Intergenic
943900366 2:193426251-193426273 CACAGCACTTTGGAAGGCCGAGG + Intergenic
944024251 2:195144333-195144355 CACAGGTTGTTGGAGGGACCTGG + Intergenic
944559725 2:200924094-200924116 CCCAGCACTTTGGAAGGCCCAGG + Intronic
944727558 2:202486376-202486398 CCCAGCACTTTGGTGGGGCAAGG + Intronic
944851920 2:203728058-203728080 CACAGCACTTTGGGAGGCCCAGG - Intronic
945413391 2:209540381-209540403 CCCAGCACTTTGGAAGGCCCAGG + Intronic
946226837 2:218268590-218268612 CACAGCACTTTGGAAGGCCAAGG - Intronic
946619915 2:221549734-221549756 CCCAGCACTTTGGGGGGCCCAGG + Intronic
947076893 2:226354770-226354792 CACAGCACTAAGCAGGGGCCTGG - Intergenic
947332486 2:229044721-229044743 CAAAGCAAAATGGAGGGGCCTGG - Intronic
947359879 2:229335904-229335926 CACAGGATGTGGGAGGGCCCAGG + Intergenic
947474139 2:230427409-230427431 CCCAGCACTTTGGAAGGCCCAGG - Intronic
947559962 2:231140625-231140647 CACAGCACTTTGGGAGGCCCAGG + Intronic
948564402 2:238874633-238874655 CATAGCACGTTGAAAAGGCCTGG + Intronic
948683357 2:239652913-239652935 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
948835309 2:240623571-240623593 AACAGCGCTCTGGAGGGGCCCGG + Intronic
1169455433 20:5748500-5748522 CACAGCACTTTGGGAGGCCCAGG + Intergenic
1169920143 20:10726444-10726466 CACATCTCGTGGGAGGGACCTGG + Intergenic
1170011032 20:11724155-11724177 CACAGCAGGCTGGAAGTGCCAGG - Intergenic
1170046505 20:12091054-12091076 CACAGCAGCTTGGAGGAGACAGG - Intergenic
1170310463 20:14985887-14985909 CCCAGCACTTTGGAAGGACCAGG - Intronic
1170373271 20:15672837-15672859 CACATGTCGTGGGAGGGGCCCGG + Intronic
1170839069 20:19909112-19909134 CACAGCACTTTGGGAGGCCCAGG - Intronic
1171497740 20:25568977-25568999 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1172023325 20:31931327-31931349 CCCAGCACTTTGGAAGGGCAAGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172346051 20:34200581-34200603 CATTGCACGTTGGATGAGCCAGG + Intronic
1172410043 20:34714283-34714305 CCCAGCACTTTGGAGGGCCTAGG - Intronic
1172449389 20:35011008-35011030 CCCAGCACTTTGGAAGGTCCAGG + Intronic
1173966620 20:47117258-47117280 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1174016696 20:47494450-47494472 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1174132044 20:48352046-48352068 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1174243735 20:49159810-49159832 CACAGCACTTTGGAAGGCCAAGG - Intronic
1174469490 20:50745755-50745777 CCCAGCACTTTGGAAGGGCGAGG - Intronic
1174836006 20:53855673-53855695 CCCAGCACTTTGGAAGGGCAAGG - Intergenic
1175005186 20:55674405-55674427 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1175351613 20:58325226-58325248 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1175988077 20:62774081-62774103 CACAGCAAGTTGGAAGGCCGGGG - Intergenic
1176704215 21:10099057-10099079 CACAGCACTTTGGGGGGCCGAGG - Intergenic
1176956136 21:15106181-15106203 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1177200170 21:17944958-17944980 CCCAGCACTTTGGAGGGCCAAGG + Intronic
1177347388 21:19891099-19891121 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1177699544 21:24619235-24619257 CACAGCACGTTGGAAGGCCAAGG - Intergenic
1178533669 21:33395255-33395277 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
1178571484 21:33741640-33741662 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1178955174 21:37015412-37015434 CACAGCACTTTGGAAGGCCAAGG - Intronic
1179227590 21:39468687-39468709 CCCAGCACGTTGGGGGGTCAAGG - Intronic
1179453747 21:41483877-41483899 CTCAGCACTTTGGAAGGGCAAGG + Intronic
1179468700 21:41596278-41596300 GACAGCACGATGGAGATGCCAGG - Intergenic
1179516322 21:41910082-41910104 CCCAGCACGTTGGGGGGCCGAGG - Intronic
1180013240 21:45065078-45065100 CACCGCACGGTGGAGGGTGCTGG + Intergenic
1180218501 21:46342355-46342377 CACAGCACTTTGGGAGGGCGAGG - Intronic
1180948687 22:19710603-19710625 CACAGCACTTTGCAGGAGTCAGG + Intergenic
1181177648 22:21046839-21046861 CACAGCACTTTGGGAGGCCCAGG + Intronic
1181664580 22:24383901-24383923 CCCAGCACTTTGGGGGGCCCAGG - Intronic
1181795494 22:25306063-25306085 CACAGCACTTTGGGAGGCCCAGG - Intergenic
1181836031 22:25609578-25609600 CACAGCACTTTGGGAGGCCCAGG - Intronic
1182515260 22:30855060-30855082 CACATGTCGTGGGAGGGGCCAGG - Intronic
1182614376 22:31576893-31576915 CACAGCACTTTGGAAGGCCGAGG - Intronic
1182627236 22:31656398-31656420 CCCAGCACGTTGGAAGGCCAAGG + Intronic
1183085109 22:35481989-35482011 CCCAGCACTTTGGGGGGCCCAGG - Intergenic
1183156978 22:36083173-36083195 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1183405595 22:37629214-37629236 CACAGAGCTTTGGAGTGGCCTGG + Intronic
1183488224 22:38101601-38101623 CACAGCACTTTGGAAGGCCAAGG + Intronic
1183525622 22:38320811-38320833 CACAGCACTTTGGGAGGGCGAGG - Intronic
1183668003 22:39256260-39256282 CGCAGGACGTAGGAGGGACCAGG - Intergenic
1184535361 22:45082957-45082979 CATAGCAGGCTGCAGGGGCCAGG - Intergenic
1184802294 22:46768841-46768863 CTCAGCACTTTGGGGGGCCCAGG + Intronic
1184831937 22:46994340-46994362 CACAGCAGGTGGGCAGGGCCCGG - Intronic
1185029661 22:48435004-48435026 CACAGGATGTTGGAGGGGCCCGG + Intergenic
1185363159 22:50421456-50421478 CCCAGCACTTTGGGGGGGACAGG - Intronic
949356779 3:3189436-3189458 GAGAGCTTGTTGGAGGGGCCTGG - Intergenic
949946764 3:9195703-9195725 CTCAGCACGTTGGAAGGTCAAGG + Intronic
950170400 3:10835122-10835144 CAGACCACCTCGGAGGGGCCAGG + Intronic
950360617 3:12446944-12446966 CCCAGCACTTTGGATGGCCCAGG + Intergenic
950386397 3:12663822-12663844 GACAGGACGTTGGGGCGGCCTGG - Exonic
950484044 3:13262371-13262393 GCCAGCACACTGGAGGGGCCTGG + Intergenic
951482287 3:23174187-23174209 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
951605504 3:24429757-24429779 CACAGCACTTTGGAAGGCCGAGG - Intronic
951995353 3:28721852-28721874 CACAGGACATGGGAGGGACCAGG + Intergenic
952438003 3:33292127-33292149 CACAGCACTTTGGAAGGCCGAGG + Intronic
952438091 3:33293104-33293126 CCCAGCACTTTGGAGGGCCAAGG - Intronic
952757516 3:36884680-36884702 CACAGCACTTTGGGAGGCCCAGG + Intronic
952872641 3:37914998-37915020 CACAGCACTTTGGAAGGCCAAGG - Intronic
953213600 3:40897672-40897694 CACAGCAGGTTGTAGCAGCCTGG - Intergenic
953262278 3:41351601-41351623 TACAGCATTTTGGAGAGGCCAGG - Intronic
953739827 3:45528084-45528106 CCCAGCACTTTGGAAGGCCCAGG + Intronic
953955691 3:47230325-47230347 CCCAGCACTTTGGAAGGCCCAGG + Intronic
954057912 3:48043349-48043371 CACAGCACTTTGGAAGGCCGAGG - Intronic
954152900 3:48667102-48667124 CTCAGCACTTTGGAGGGCCAAGG + Intergenic
954374742 3:50188346-50188368 CCCAGCCAGTTGGTGGGGCCAGG + Exonic
954770459 3:52963243-52963265 CCCAGCACTTTGGAAGGGCGAGG - Intronic
955236769 3:57146498-57146520 CCCAGCACGTTGGAAGGCCAAGG + Intronic
955327868 3:58023331-58023353 CCCAGCACTTTGGGAGGGCCAGG - Intronic
955331962 3:58054681-58054703 CACAGGTCATTGGAGGGACCTGG - Intronic
955861649 3:63336979-63337001 CCCAGCACTTTGGAAGGTCCAGG + Intronic
956567194 3:70652228-70652250 CACATGTCGTGGGAGGGGCCCGG - Intergenic
956611385 3:71127075-71127097 CACAGTAGGGTGGAGGTGCCTGG - Intronic
957593030 3:82225200-82225222 TGCAGCATGTTGGAGGGGCAAGG + Intergenic
957630793 3:82714444-82714466 CCCAGCACGTTGGAAGGCCGAGG + Intergenic
957826197 3:85448079-85448101 CCCAGCACTTTGGAAGGGCGAGG + Intronic
958632069 3:96697582-96697604 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
958962222 3:100521501-100521523 CCCAGCACGTTGGAAGGCCCAGG - Intronic
959549781 3:107641333-107641355 CCCAGCACTTTGGAAGGCCCAGG - Intronic
960020407 3:112945777-112945799 CACAGCACTTTGGAAGGCCGAGG + Intronic
960084474 3:113575904-113575926 CAGGGCACATTGGAGGGGCAGGG + Intronic
960374126 3:116877840-116877862 CCCAGCACTTTGGAAGGCCCAGG + Intronic
960415054 3:117374695-117374717 CACAGCACTTTGGGGGGCCGAGG + Intergenic
960802928 3:121557007-121557029 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
961364609 3:126391237-126391259 GACAGCACTTTTGAGGGTCCTGG - Intergenic
961548790 3:127654834-127654856 CCCAGCACTTTGGAGGGCCAAGG + Intronic
961582843 3:127897110-127897132 CTCAGCACTTTGGAGAGGCCAGG + Intergenic
961689030 3:128654930-128654952 CACAGCACTTTGGAAGGCCAAGG + Intronic
961697523 3:128716072-128716094 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
962321938 3:134397454-134397476 CACAGCACTTTGGGAGGCCCAGG + Intergenic
962729229 3:138264666-138264688 CCCAGCACTTTGGAGGGCCGAGG - Intronic
964519415 3:157546982-157547004 CCCAGCACTTTGGAAGGCCCAGG - Intronic
965269996 3:166602713-166602735 CACAGCACTTTGGAAGGTCGTGG - Intergenic
965800064 3:172483334-172483356 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
966320519 3:178696244-178696266 CACAGGTCATGGGAGGGGCCAGG - Intronic
966401986 3:179557064-179557086 CCCAGCACTTTGGAAGGCCCTGG - Intergenic
966802261 3:183775345-183775367 CCCAGCACTTTGGAGGGCCAAGG + Intronic
966874801 3:184315602-184315624 GACAGCATGTTGGTGGGGACAGG + Exonic
967136448 3:186516613-186516635 CCCAGCACTTTGGAAGGGCAAGG - Intergenic
967325020 3:188230332-188230354 CCCAGCACTTTGGAGGGCCAAGG - Intronic
968211700 3:196854327-196854349 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
968351869 3:198064344-198064366 CTCAGCACTTTGGAAGGCCCAGG + Intergenic
969352066 4:6603773-6603795 TACAGCAAGTTGCAGGGGCTGGG + Intronic
969564662 4:7970816-7970838 CACAGCAACAGGGAGGGGCCGGG + Intronic
970060621 4:12029412-12029434 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
970905695 4:21213550-21213572 CACAGCACTTTGGGAGGGCAAGG - Intronic
971705542 4:30037890-30037912 CCCAGCACTTTGGAAGGGCGAGG + Intergenic
972490391 4:39581811-39581833 CCCAGCACTTTGGAAGGCCCAGG - Intronic
972530352 4:39955862-39955884 CACAGCACTTTGGGGGGCCAAGG + Intronic
972597709 4:40544817-40544839 CACAGCACTTTGGAAGGCCGAGG + Intronic
972711105 4:41595805-41595827 CCCAGCACGTTGCAGGGCCAAGG + Intronic
974272960 4:59676941-59676963 CACAGCACTTTGGGAGGCCCAGG + Intergenic
975060861 4:69997194-69997216 CACAGCACTTTGGAAGGCCAAGG - Intronic
975180232 4:71335573-71335595 CCCAGCACTTTGGAGGGCCGAGG + Intronic
975572898 4:75836209-75836231 CACAGAAAGATGGAGGCGCCGGG + Intergenic
975588354 4:75974463-75974485 CCCAGCACTTTGGAGGGCCAAGG + Intronic
975618977 4:76276611-76276633 CACAGCACTTTGGAAGGCCAAGG - Intronic
976557759 4:86468601-86468623 CCCAGCACTTTGGAAGGCCCAGG + Intronic
976913067 4:90332484-90332506 TACAGCACTTTGGAGGGCCAAGG - Intronic
978105598 4:104898503-104898525 CACAGCACTTTGGAAGGCCAAGG + Intergenic
978877604 4:113660639-113660661 CCCAGCACTTTGGAGGGGTGAGG - Intronic
979288744 4:118956792-118956814 CACAGCACTTTGGGAGGGCGAGG + Intronic
979661003 4:123255213-123255235 CCCAGCACTTTGGAAGGGCAAGG - Intronic
979951472 4:126898501-126898523 CACAGGTCGAGGGAGGGGCCTGG - Intergenic
980113802 4:128659892-128659914 CCCAGCACTTTGGAGGGCCATGG + Intergenic
981164856 4:141545670-141545692 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
981722495 4:147815604-147815626 CCCAGCACTTTGGAGGGCCAAGG + Intronic
982431941 4:155332788-155332810 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
983729009 4:170970855-170970877 CCCAGCACTTTGGGGGGCCCAGG + Intergenic
983752265 4:171289670-171289692 CCCAGCACTTTGGGGGGCCCAGG + Intergenic
984093974 4:175411236-175411258 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
984334738 4:178376667-178376689 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
984619821 4:181939716-181939738 CTCAGCACATGGCAGGGGCCAGG + Intergenic
984774384 4:183467824-183467846 GACAGAAATTTGGAGGGGCCAGG + Intergenic
984783852 4:183550922-183550944 CCCAGCACTTTGGAAGGGCTAGG + Intergenic
985156001 4:186987811-186987833 CACAGCACTTTGGAAGGCCAAGG - Intergenic
985923868 5:3000553-3000575 CACAGGACGCAGGAGGGACCTGG - Intergenic
986015550 5:3754359-3754381 CACAGAACCCTGGAGTGGCCAGG + Intergenic
987326159 5:16813267-16813289 CCCAACACGTTGGAAGGCCCAGG + Intronic
987350088 5:17014424-17014446 CCCAGCACTTTGGAAGGGCAAGG + Intergenic
987817578 5:22922789-22922811 CACATGCCGTGGGAGGGGCCTGG - Intergenic
987948669 5:24649004-24649026 CACAGCACTTTGGAAGGCCCAGG - Intergenic
988422185 5:31019437-31019459 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
988573793 5:32399023-32399045 CACAGCACTTTGGAAGGCCGAGG + Intronic
989391262 5:40903122-40903144 CACAGCACTTTGGAAGGCCAAGG + Intergenic
989621854 5:43392365-43392387 CTCAGCACTTTGGAAGGGCGAGG - Intronic
990451137 5:55932747-55932769 CACAGCACTTTGGAAGGCCAAGG + Intergenic
991669468 5:69033375-69033397 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
991709495 5:69394311-69394333 CCCAGCACTTTTGAGAGGCCAGG - Intronic
992194430 5:74325537-74325559 CCCAGCACTTTGGAAGGGCGAGG - Intergenic
992688403 5:79219784-79219806 CCCAGCACTTTGGAAGGGCGAGG - Intronic
992746125 5:79822536-79822558 CTCAGCACTTTGGGGGGCCCAGG - Intergenic
992781747 5:80134233-80134255 CCCAGCACGTTGGAAGGCCGAGG + Intronic
993009480 5:82464001-82464023 CACAGCACTTTGGAAGGCCCAGG + Intergenic
993738550 5:91507610-91507632 CCCAGCACTTTGGGGGGCCCAGG - Intergenic
996378437 5:122840056-122840078 CCCAGCACTTTGGAAGGGCAAGG + Intergenic
996730365 5:126711752-126711774 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
996856068 5:128008889-128008911 CCCAGCACTTTGGAAGGGCAAGG + Intergenic
996994333 5:129677223-129677245 CACAGCACTTTGGAAGGCCAAGG + Intronic
997130797 5:131274018-131274040 CCCAGCACTTTGGGGGGCCCAGG - Intronic
997130949 5:131275542-131275564 CCCAGCACTTTGGAAGGCCCAGG - Intronic
997322581 5:132990810-132990832 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
997550297 5:134746725-134746747 CCCAGCACTTTGGAAGGCCCAGG - Intronic
997576452 5:134981238-134981260 CACAGCACTTTGGGAGGCCCAGG + Intronic
997627911 5:135343532-135343554 CACAGGGCATTGGAGGGCCCAGG - Exonic
997957940 5:138294752-138294774 CCCAGCACTTTGGAGGGCCGAGG - Intronic
998516063 5:142755366-142755388 CCCAGCACTTTGGAGGGCCAGGG - Intergenic
999378438 5:151103245-151103267 CACAGCACGTTGGAAGGCCAAGG - Intronic
999567284 5:152878627-152878649 CACAGCACTTTGGAAGGCCGAGG + Intergenic
999915251 5:156251762-156251784 CCCAGCACGTTGGGAGGGCGAGG - Intronic
1000326140 5:160173859-160173881 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1000351202 5:160354325-160354347 CCCAGCACTTTGGAAGGGCGAGG + Intronic
1000559655 5:162770293-162770315 CACAGCACTGTGGAAGGCCCAGG + Intergenic
1000708607 5:164542613-164542635 CCCAGCACGTTGGGAGGGCGAGG - Intergenic
1001087710 5:168713218-168713240 CACAGCACGTTGGAGGGGCCGGG + Intronic
1001244328 5:170094628-170094650 CCCAGCACTTTGGAGGGCTCAGG + Intergenic
1001622512 5:173100224-173100246 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1002498257 5:179630659-179630681 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1002630282 5:180570105-180570127 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1003379887 6:5614647-5614669 CACAGCACTTTGGGAGGCCCAGG - Intronic
1003511482 6:6784834-6784856 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1003750449 6:9049290-9049312 CCCAGCACTTTGGAGGGTCGAGG - Intergenic
1004261807 6:14114942-14114964 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1004293884 6:14392716-14392738 CCCAGCACTTTGGAGGGTCAAGG - Intergenic
1006512006 6:34526476-34526498 CCCAGGGCTTTGGAGGGGCCTGG - Intronic
1006816947 6:36857977-36857999 CCCAGCACGTTGGAAGGCCAAGG + Intronic
1007228601 6:40332060-40332082 CACAAGAAGTTGGAAGGGCCTGG + Intergenic
1007589637 6:43013581-43013603 CGGAGCAAGTTGGTGGGGCCTGG - Intronic
1008141124 6:47833589-47833611 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1008662723 6:53684883-53684905 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1008846193 6:55966860-55966882 CCCAGCACTTTGGGGAGGCCGGG - Intergenic
1010415254 6:75604379-75604401 CACAGCATTTTGGAGGGCCGAGG + Intronic
1012225543 6:96699594-96699616 CCCAGCACGTTGGAAGGCCAAGG - Intergenic
1012623951 6:101383651-101383673 CGCAGCACGTTGGAAGGCCAAGG + Intergenic
1012909041 6:105099107-105099129 CACAGCACTTTGGGGGGCCAAGG - Exonic
1013103312 6:107005658-107005680 CCCAGCACGTTGGGAGGCCCAGG - Intergenic
1013499847 6:110738257-110738279 CACAGCACTTTGGAAGGCCAAGG + Intronic
1013786096 6:113782903-113782925 CCCAGCATCTTGGAGGGCCCAGG + Intergenic
1014241580 6:119023642-119023664 CCCAGCACTTTGGGGGGCCCAGG - Intronic
1014249691 6:119102535-119102557 CACAGCACTTTGGAAGGCCGAGG + Intronic
1014700222 6:124677217-124677239 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1014774021 6:125488062-125488084 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1014808846 6:125862751-125862773 CACAGCACTTTGGGGGGCCAAGG + Intronic
1015477381 6:133668966-133668988 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1015724621 6:136287777-136287799 CCCAGCACTTTGGGTGGGCCAGG + Intronic
1016062633 6:139646377-139646399 CCCAGCACGTTGGAAGGCCGAGG - Intergenic
1016107214 6:140177724-140177746 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1016434984 6:144026959-144026981 CACAGCACTTTGGAAGGCCGAGG + Intronic
1016493880 6:144637218-144637240 CCCAGCACTTTGGAGGGACGAGG - Intronic
1016536987 6:145118453-145118475 CACAGCACTTTGGAAGGCCAAGG + Intergenic
1017072968 6:150592703-150592725 CCCAGCAAGTTGGAAGGGCCAGG - Intergenic
1017117351 6:150990710-150990732 CCCAGCACGTTGGAAGGCCAAGG - Intronic
1017328985 6:153173616-153173638 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1018309810 6:162495985-162496007 CACAGCACTTTGGAAGGCCAAGG + Intronic
1019541752 7:1554789-1554811 CACAGCTTGTTAGAGGGACCGGG - Intronic
1019745283 7:2696505-2696527 CACAGCACTTTGGGAGGCCCAGG - Intronic
1020187056 7:5967350-5967372 CTCAGCACGTTGAAGGGCCAAGG + Exonic
1020192727 7:6012800-6012822 CTCAGCACTTTGGAAGGGCGAGG - Intronic
1020290350 7:6718118-6718140 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1020295861 7:6757422-6757444 CTCAGCACGTTGAAGGGCCAAGG - Exonic
1020807409 7:12807641-12807663 CCCAGCACTTTGGAAGGGCAAGG - Intergenic
1021661497 7:22923904-22923926 CACAGCACTTTGGAAAGCCCAGG + Intergenic
1021888741 7:25166335-25166357 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1022085035 7:27058346-27058368 CCTAGCACTTTGGAAGGGCCAGG - Intergenic
1022256340 7:28662274-28662296 GACAAGACGTTGAAGGGGCCTGG + Intronic
1022558070 7:31320003-31320025 CCCAGCACTTTGGAAGGGCGAGG - Intergenic
1022724118 7:32965379-32965401 CCCAGCACGTTGGGAGGCCCAGG - Intronic
1023004158 7:35844971-35844993 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1023042584 7:36184979-36185001 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1024116321 7:46197239-46197261 CTCAGCACTTTGGAGGGCCGAGG - Intergenic
1025112411 7:56229846-56229868 CCCAGCACGCCGGAGGGGCTGGG - Intergenic
1025909082 7:65812955-65812977 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1025922003 7:65921935-65921957 CACAGCACGTTGGGAGGCCAAGG - Intronic
1025944108 7:66093064-66093086 CCCAGCACTTTGGAAGGGCAAGG + Exonic
1026021787 7:66713376-66713398 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1026110596 7:67456101-67456123 CCCAGCACTTTGGAGGGCCGAGG - Intergenic
1026172012 7:67962256-67962278 CCCAGCACTTTGGAAGGGCGAGG + Intergenic
1026188765 7:68105401-68105423 CTCAGCACGTTGGGAGGGCAAGG - Intergenic
1026607243 7:71826610-71826632 CAGACCATGTTGGAGGGGACAGG + Intronic
1027123753 7:75541144-75541166 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1027163154 7:75816810-75816832 CCCAGCACGTTGGGGGGCCGAGG - Intronic
1027249075 7:76387529-76387551 CCCAGCACTTTGGTGGGTCCAGG + Intergenic
1027338698 7:77182519-77182541 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1028484811 7:91346078-91346100 CACAGCACGTTGGGAGGCCGAGG - Intergenic
1029154584 7:98506288-98506310 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1029527476 7:101103801-101103823 CCCAGCACTTTGGGAGGGCCAGG + Intergenic
1029716490 7:102330228-102330250 CCCAGCACTTTGGAAGGGCAAGG + Intergenic
1029723222 7:102384095-102384117 CCCAGCACTTTGGAAGGGCAAGG + Intronic
1029907075 7:104103021-104103043 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1029986069 7:104924540-104924562 CCCAGCACGTTGGGGGGCCGAGG + Intergenic
1030263279 7:107588968-107588990 CTCATCACGTTAGAGGGGCTTGG + Intronic
1030265549 7:107616987-107617009 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1030828851 7:114196258-114196280 CACAGCACTTTGGAAGGCCGAGG - Intronic
1032063303 7:128743752-128743774 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1032152500 7:129441864-129441886 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1032300827 7:130685101-130685123 CACAGCACGTTGAATGGTGCTGG - Intronic
1032388039 7:131538150-131538172 CAGAGCACAGGGGAGGGGCCAGG - Intronic
1032650504 7:133873057-133873079 CCCAGCATTTTGGAGGGCCCAGG + Intronic
1033330415 7:140412616-140412638 CCCAGCACTTTGGGAGGGCCAGG - Intronic
1033756764 7:144403005-144403027 CCCAGCACGTTGGGAGGGCGAGG - Intronic
1033813465 7:145045209-145045231 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1034103543 7:148471648-148471670 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1034255646 7:149723281-149723303 GACAGCATGGTGGAGGGGCCGGG + Intronic
1034917445 7:155052524-155052546 CCCAGCACCTTGGGAGGGCCAGG + Intergenic
1035147265 7:156831659-156831681 CACAGCACGTGCGAGGGGTTTGG - Intronic
1035213099 7:157343403-157343425 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1035429313 7:158806069-158806091 CACACCGCGTGGGAGGCGCCGGG + Intronic
1035429321 7:158806093-158806115 CACACCGCGTGGGAGGCGCCGGG + Intronic
1035429329 7:158806117-158806139 CACACCGCGTGGGAGGTGCCGGG + Intronic
1035434787 7:158851280-158851302 CACAGCACTTTGGGAGGCCCAGG + Intergenic
1035545527 8:479483-479505 CTGAGCCCGTTGGAGGGGCACGG - Intergenic
1035743977 8:1948205-1948227 CCCAGGATGTTGGAGGGGCCCGG - Intronic
1036096279 8:5727669-5727691 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1036649388 8:10632673-10632695 CACAGCACCTTGTAGGTGCTCGG + Intronic
1036653168 8:10658778-10658800 CACAGCTTGTTGCTGGGGCCTGG + Intronic
1037488773 8:19376369-19376391 CACAGCACTTTGGAAGGCCGAGG + Intronic
1037504462 8:19516477-19516499 CATGCCACGTTTGAGGGGCCAGG - Intronic
1037815783 8:22111025-22111047 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1039439076 8:37582139-37582161 CCCTGCTGGTTGGAGGGGCCGGG - Intergenic
1039873947 8:41569671-41569693 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1040006269 8:42623535-42623557 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1040053268 8:43035918-43035940 CACAGCACTTTGGAAGGCCGAGG - Intronic
1040469216 8:47723116-47723138 CACAGCACTTTGGAAGGCCAAGG - Intronic
1040604177 8:48913617-48913639 CTCAGCACGTTGGGAGGCCCAGG + Intergenic
1041099940 8:54385983-54386005 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1043445692 8:80317380-80317402 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1043683059 8:83055493-83055515 CCCAGCACTTTGGAAGGGCGAGG + Intergenic
1043768206 8:84163921-84163943 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1043942127 8:86207857-86207879 CCCAGCACTTTGGGGGGCCCAGG + Intergenic
1045616013 8:103912865-103912887 CACAACACTTTGGAAGGCCCAGG + Intronic
1045811095 8:106220922-106220944 CCCAGCACGTTGGAAGGCCAAGG + Intergenic
1045922556 8:107548176-107548198 CACATATCGTGGGAGGGGCCCGG - Intergenic
1046313213 8:112465722-112465744 CCCAGCATGTTGGAAGGCCCAGG + Intronic
1046855996 8:119032649-119032671 CCCAGCACGTTGGGAGGCCCAGG + Intronic
1047504728 8:125470068-125470090 CCCAGCACTTTGGAGGGCCAAGG - Intergenic
1048005771 8:130418297-130418319 CCCAGCACTTTGGGAGGGCCAGG + Intronic
1048483673 8:134827515-134827537 CCCAGCACTTTGGGGGGCCCAGG + Intergenic
1049759269 8:144324615-144324637 CAGAGCTCGTGGGAGAGGCCTGG - Intronic
1049804883 8:144534274-144534296 CACAGCTCCTTCGAGGGCCCTGG + Intronic
1049915332 9:311960-311982 CACAGCACGTTTAAGTGGCGGGG - Exonic
1050345942 9:4687426-4687448 CCCAGCACGTTGGAAGGCCAAGG + Intronic
1050528838 9:6569723-6569745 CACAGCACGTTGGGAGGCCGAGG + Intronic
1050541748 9:6676306-6676328 CCCAGCACTTTGGGAGGGCCAGG - Intergenic
1051059623 9:13031061-13031083 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1051394651 9:16606806-16606828 CCCAGCACGTTGGGAGGCCCAGG - Intronic
1051399018 9:16659357-16659379 CACAGCACTTTGGGGGGCCGAGG + Intronic
1051534793 9:18144454-18144476 CCCAGCACTTTGGAAGGGCGAGG - Intergenic
1051595341 9:18819203-18819225 CACAGCACTTTGGGGGGCCAAGG + Intronic
1051748083 9:20314689-20314711 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1052353443 9:27480679-27480701 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1052874355 9:33542623-33542645 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1053026511 9:34733751-34733773 CACAGCAATTTGGAGGGCCGAGG - Intergenic
1053501677 9:38601738-38601760 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1054830057 9:69614946-69614968 CCCAGCACGTTGGAGGGCTGAGG + Intronic
1055177219 9:73334835-73334857 CCCAGCACTTTGGAAGGCCCAGG - Intergenic
1055439464 9:76324174-76324196 CCCAGCACTTTGGAAGGGCGAGG - Intronic
1056039072 9:82642199-82642221 CTCAGCACTTTGGAAGGCCCAGG + Intergenic
1056246446 9:84700092-84700114 CACAGCTGGTAGGAGGGGACAGG + Intronic
1057169456 9:92952485-92952507 CCCAGCACTTTGGAAGGGCGAGG - Intronic
1057499781 9:95587527-95587549 CACAGCACACTGGTGGGTCCTGG + Intergenic
1057681065 9:97186055-97186077 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1057742371 9:97723057-97723079 GAGAGCACGTCTGAGGGGCCAGG - Intergenic
1058021070 9:100089328-100089350 CCCAGCACTTTGGAGGGCCAAGG + Intronic
1058491725 9:105508425-105508447 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1060161814 9:121370898-121370920 CCCAGCACGTTGGAAGGCCGAGG + Intergenic
1060615118 9:125006263-125006285 CCCAGCACTTTGGAGGGCCAAGG + Intronic
1060635050 9:125193564-125193586 CACAGCACTTTGGGAGGCCCAGG + Intergenic
1061116477 9:128616373-128616395 CACAGCACTTTGGGAGGCCCAGG - Intronic
1061138080 9:128747867-128747889 CTCAGCACTTTGGAGGGCCGAGG - Intronic
1061213771 9:129208585-129208607 GACAGGAAGTGGGAGGGGCCAGG - Intergenic
1061464606 9:130767581-130767603 CCCAGCACTTTGGAGGGCCCAGG - Intronic
1061557310 9:131378967-131378989 CCCAGCACGTTGGAAGGCCGAGG - Intergenic
1061862304 9:133474213-133474235 CCCAGCACGCTGCAGGTGCCAGG - Intronic
1061886510 9:133593719-133593741 CACAGCCCGGTGCTGGGGCCAGG + Intergenic
1061917463 9:133762808-133762830 CACAGCCTGTGGGAGGTGCCCGG - Exonic
1061969785 9:134038538-134038560 CCCAGCACTTTGGGAGGGCCAGG - Intronic
1062283496 9:135762495-135762517 CCCAGCACTTTGGAGGGCCGAGG + Intronic
1062362874 9:136195812-136195834 CACAGCAAGTTAGAAGAGCCAGG + Intergenic
1062730170 9:138104176-138104198 CACTGCACCTTGGAGGGCCCAGG + Intronic
1202789251 9_KI270719v1_random:69158-69180 CACAGCACTTTGGGGGGCCGAGG - Intergenic
1185469211 X:372706-372728 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1185546465 X:949497-949519 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1185604981 X:1363536-1363558 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1186470470 X:9817502-9817524 CACTGCACGTTGGGTGAGCCAGG - Intronic
1187206810 X:17189535-17189557 CACAGCACTTTGGGAGGCCCAGG - Intergenic
1187233096 X:17441190-17441212 ACCAGCACGGAGGAGGGGCCAGG - Intronic
1187382909 X:18821660-18821682 CACAGCACTTTGGGGGGCCAAGG - Intronic
1187407661 X:19018371-19018393 CTCAGCACTTTGGAAGGCCCAGG - Intronic
1187476561 X:19616210-19616232 CCCAGCACTTTGGAGGGCCGAGG - Intronic
1188398191 X:29711431-29711453 CCCAGCACTTTGGAAGGCCCAGG - Intronic
1188461509 X:30432476-30432498 CACAGCACTTTGGAAGGTCAAGG - Intergenic
1189496265 X:41511731-41511753 CCCAGCACTTTGGGGGGCCCAGG + Intergenic
1190040345 X:47066269-47066291 CACAGCACTTTGGGAGGGCAAGG + Intergenic
1190128126 X:47723810-47723832 CACAGGACAATGGAGGGACCAGG - Intergenic
1190287370 X:48970458-48970480 TACAGAACCTAGGAGGGGCCTGG + Exonic
1190634296 X:52419280-52419302 CCCAGCACTTTGGAGGGCCAAGG + Intergenic
1191652709 X:63558625-63558647 CACAGCACTTTGGGAGGCCCAGG + Intergenic
1192230464 X:69261085-69261107 CACAGGAAGTTGGAGAGGACTGG - Intergenic
1192422982 X:71050379-71050401 CACAGCACTTTGGGAGGCCCAGG - Intergenic
1192467816 X:71369972-71369994 CCCAGCACTTTGGGGGGCCCAGG + Intronic
1192773420 X:74217009-74217031 CACAGCACTTTGGAAGGCCAAGG - Intergenic
1194700578 X:97109166-97109188 CCCAGCACTTTGGAAGGCCCAGG + Intronic
1194721320 X:97343416-97343438 CCCAGCACGTTGGGTGGCCCAGG + Intronic
1195751420 X:108164548-108164570 CAGAGCTCGAGGGAGGGGCCTGG - Intronic
1196080593 X:111626692-111626714 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1196226133 X:113169340-113169362 CACAGCACTTTGGAAGGCCGAGG - Intergenic
1197108359 X:122742917-122742939 CACAGCACGTTGGGAGGCCGAGG - Intergenic
1197312014 X:124916561-124916583 CACAGCACTTTGGGAGGCCCAGG - Intronic
1198241400 X:134790820-134790842 CCCAGCACTTTGGAGGGCCAAGG - Intronic
1198428573 X:136543527-136543549 CGCAGCACTTTGGGAGGGCCAGG + Intronic
1198454157 X:136798918-136798940 CAAAGCAGGTAGGAGGGGCCAGG + Intergenic
1198795902 X:140393931-140393953 CCCAGCACTTTGGAAGGCCCAGG + Intergenic
1199477740 X:148264336-148264358 CCCAGCACTTTGGAGGGCCGAGG + Intergenic
1199744592 X:150764003-150764025 CACGGCACATGGGAGGGGCATGG - Intronic
1200207930 X:154331076-154331098 CCCAGCACCTTGGAAGGTCCAGG - Intergenic
1200748763 Y:6925664-6925686 CCCAGCACTTTGGAAGGTCCAGG - Intronic
1202049141 Y:20762808-20762830 CCCAGCACTTTGGAAGGCCCAGG - Intronic