ID: 1001088828

View in Genome Browser
Species Human (GRCh38)
Location 5:168722001-168722023
Sequence ATAAAGAAGCAGAAAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1040
Summary {0: 1, 1: 0, 2: 9, 3: 100, 4: 930}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001088825_1001088828 13 Left 1001088825 5:168721965-168721987 CCTCACAAAGGAGGTGCTATTGA 0: 1
1: 0
2: 1
3: 21
4: 194
Right 1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG 0: 1
1: 0
2: 9
3: 100
4: 930
1001088824_1001088828 19 Left 1001088824 5:168721959-168721981 CCTAATCCTCACAAAGGAGGTGC 0: 1
1: 1
2: 0
3: 8
4: 119
Right 1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG 0: 1
1: 0
2: 9
3: 100
4: 930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001088828 Original CRISPR ATAAAGAAGCAGAAAGTTGA AGG Intronic
900935307 1:5762221-5762243 AAAAAGAAGAATAAAGTGGAAGG - Intergenic
901169004 1:7241502-7241524 AAAAAGAAGAACAAAGTTGGAGG + Intronic
902751753 1:18519098-18519120 ATAAATAAGAACAAAGTTGAGGG + Intergenic
903112914 1:21152494-21152516 ATAAAGAAGCTTCATGTTGAAGG - Intronic
903157680 1:21459263-21459285 TTGAAGAAGCAGTAAGTTGGAGG + Intronic
903361747 1:22781332-22781354 AAAAAGAAGAAGAAGGATGAGGG + Intronic
903584341 1:24399155-24399177 ACAAAGAAGTACAAAGTTGAAGG + Intronic
904816418 1:33204411-33204433 AGAAAGAAAAACAAAGTTGAAGG - Intergenic
904816497 1:33205533-33205555 AAAAAAAAGAAGAAAGTTGAAGG + Intergenic
904981070 1:34502217-34502239 ATAAAGAAGCAAAAAATGGTGGG - Intergenic
905078569 1:35296473-35296495 ATATAAAAGCAGAAATCTGAGGG - Intronic
905312785 1:37062026-37062048 ATGGACAAGCTGAAAGTTGATGG + Intergenic
906363744 1:45187157-45187179 AAAAAGAAGAATAAAGTTGGAGG + Intronic
906577998 1:46908253-46908275 AAAATTAAGCAGAAAGTTCAGGG + Intergenic
906594870 1:47067034-47067056 AAAATTAAGCAGAAAGTTCAGGG - Intergenic
906827948 1:49001923-49001945 ATGAAGAAACAGAGAGTTAAGGG - Intronic
907449816 1:54538336-54538358 AAAAAGAAAAACAAAGTTGAAGG + Intergenic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
907938385 1:59063501-59063523 ATTAAAAGGCAGAAACTTGAAGG + Intergenic
907948951 1:59162317-59162339 ATAGAAAACCAGTAAGTTGAGGG - Intergenic
907950284 1:59176693-59176715 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
908223187 1:62029128-62029150 AAAAAGAAAAATAAAGTTGAAGG - Intronic
908372839 1:63500837-63500859 AAAAAGAACAACAAAGTTGAAGG + Intronic
908505590 1:64795252-64795274 AAAAAGAAGAATAAAGTTGAAGG - Intronic
908638321 1:66192906-66192928 ATGAAGAAACAAAAAGTTTAAGG + Intronic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909333362 1:74442395-74442417 ACAAAGAAGAACAAAGTTGGAGG - Intronic
909594005 1:77384635-77384657 ATAAGGAAAAAGAAAGATGAAGG + Intronic
909642971 1:77887904-77887926 AAGAAGAAGAAGAAAGTTGAAGG - Intergenic
909843573 1:80361082-80361104 TTAAAGAAGCTAAAAGTTAAAGG - Intergenic
910378454 1:86598804-86598826 AAAAAGAAGAACAGAGTTGAAGG + Intergenic
910624108 1:89288254-89288276 ATAAAGAGGCAGTAAGCTTAGGG + Intergenic
910716691 1:90239054-90239076 ATAAAGACACAGATAGTTGAAGG - Intergenic
910848719 1:91629600-91629622 AAAAAGAAGAACAAGGTTGAAGG + Intergenic
911546228 1:99220452-99220474 AGAAAGAAGAACAAAGTTGGAGG - Intergenic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
911800000 1:102124210-102124232 AAAAAGATGAACAAAGTTGAAGG + Intergenic
911935507 1:103965216-103965238 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
912111043 1:106344073-106344095 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
912275109 1:108248263-108248285 TTGAAGAAGCAGTAAGTTGTAGG - Intergenic
912293113 1:108446086-108446108 TTGAAGAAGCAGTAAGTTGTAGG + Intronic
912903945 1:113683436-113683458 AAAAAGCAGCAAAAAATTGAAGG + Exonic
913678380 1:121164536-121164558 ATAAAGTAGCAGAAATGTCATGG + Intergenic
914030219 1:143952174-143952196 ATAAAGTAGCAGAAATGTCATGG + Intronic
914159231 1:145115777-145115799 ATAAAGTAGCAGAAATGTCATGG - Intergenic
914330459 1:146665161-146665183 ATAGAAAATCAGAAAGTTAATGG - Intergenic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
915787407 1:158630201-158630223 ACAAAGAAGAACAAAGCTGAAGG + Intronic
916145656 1:161736734-161736756 CTAAAGAAGCAGAAAAATCATGG + Intergenic
916449211 1:164903702-164903724 ATAAAGAAACAGAAGTTTAATGG - Intergenic
916660666 1:166920451-166920473 AAAAACAGGCAGAAAGTTGAAGG - Intronic
916849751 1:168691521-168691543 ATAAAGACACAGAATGCTGAGGG + Intergenic
916863650 1:168833354-168833376 ATAAAGAAGGAAATAGTTCATGG + Intergenic
917543084 1:175934542-175934564 TGAAAGAACCAGAAAGGTGAGGG + Intergenic
917819282 1:178745330-178745352 AAAAAGAAGAACAAAGTTGGAGG + Intronic
918651032 1:186963650-186963672 ATAAAGAAGAATAAATTTTATGG - Intronic
918717599 1:187809800-187809822 ATAAAAAAGCACAACGTTTATGG + Intergenic
918841336 1:189543367-189543389 ACAAAGGAGCAGGAAGTTTAGGG + Intergenic
919328125 1:196135374-196135396 ATAAAGTAGAAGAAAGTTCTGGG - Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
919563379 1:199152842-199152864 AGAAAGAAGAAGAAAGGAGAAGG + Intergenic
919869078 1:201806915-201806937 AAAAAGAAGGAAAAATTTGAGGG - Intronic
920127357 1:203703906-203703928 AGAAAGAAGCTGAAACTTCAGGG + Intronic
920330713 1:205205928-205205950 ATAAAAAAGCAGAATGCTAAGGG - Intronic
920465686 1:206183059-206183081 ATAAAGTAGCAGAAATGTCATGG + Intergenic
920871321 1:209797513-209797535 CTAATGAAGCAGAAGTTTGAGGG - Intronic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
921639153 1:217531093-217531115 ATAACGATGCAGAACCTTGAAGG + Intronic
921689634 1:218133183-218133205 AGAAAAAAGAATAAAGTTGAAGG + Intergenic
921701849 1:218277675-218277697 AAAAAGAAGAAAAAATTTGAAGG - Intergenic
921775571 1:219096311-219096333 ATAAAGAAAAAGAAATTTAATGG - Intergenic
921915366 1:220603943-220603965 ATAAACTAGCAGAAAATTGTGGG + Intronic
921928294 1:220731751-220731773 ATAAAGAAGAAGAGGATTGAGGG - Intergenic
923031232 1:230250434-230250456 CTAAAGAGGCAGAAAGAAGAGGG - Intronic
923212842 1:231821233-231821255 ATAAAGAAGCAGAAGATTCAAGG - Intronic
923239331 1:232065910-232065932 ATAAATAAGCAGGAAGCAGAAGG + Intergenic
923415410 1:233752915-233752937 TAAAAGAAGAACAAAGTTGAAGG - Intergenic
923669401 1:236027232-236027254 TTAAAAAAACAGGAAGTTGAGGG - Intronic
923753641 1:236770468-236770490 AGAAAGAAGCAGAAAGTGAGAGG - Intergenic
923839207 1:237649851-237649873 AAAAAGAATCAGAGAGTAGAAGG - Intronic
924014462 1:239705383-239705405 ATAAAGTAGCAGAGACTGGAAGG + Intronic
924190066 1:241541370-241541392 ATAAGGAGGAAGAAAGTTTATGG + Intronic
924668467 1:246098191-246098213 ATCAAGAACAAGAAAGATGATGG + Intronic
1063025113 10:2170426-2170448 AGAAATAAGCAGAAAGATGGGGG - Intergenic
1063276752 10:4577556-4577578 TTAAAGCAGAAGAAAGTTGGAGG + Intergenic
1064178084 10:13092742-13092764 AGAAAGAAGCAAAATGTTGCTGG + Intronic
1064517117 10:16162987-16163009 AAAAAGAAGAAAAAAGTTGATGG - Intergenic
1064889738 10:20157153-20157175 AAAACGAAGGAGAAAGTTAAGGG + Intronic
1065043099 10:21717542-21717564 AGAAAGAAGAAGAAAGAAGAAGG - Intronic
1065341216 10:24707807-24707829 ATAATCCAGGAGAAAGTTGATGG - Intronic
1065459532 10:25943326-25943348 GTAAAGAAGAACAAAGTTGGAGG - Intronic
1065670345 10:28109307-28109329 ACAAATAAGCAGAAAGTTGTCGG + Intronic
1067033115 10:42893584-42893606 ATTAAGAGACAGAAAGTTGAAGG - Intergenic
1067086893 10:43246473-43246495 AAAAAGAAGTACAAAGTTGGAGG + Intronic
1067360015 10:45571145-45571167 TTAAAAAAGAACAAAGTTGAAGG + Intronic
1067483486 10:46622878-46622900 ATGAAGAAGAACAAATTTGAAGG - Intergenic
1067611269 10:47718768-47718790 ATGAAGAAGAACAAATTTGAAGG + Intergenic
1067827360 10:49586922-49586944 AAAAAGAAGAATAAAGTTCAAGG + Intergenic
1068479115 10:57566500-57566522 ATAAAAAAGAACAAAGTTGGAGG - Intergenic
1068819918 10:61363030-61363052 ATAATGAAACAAAAAGTTAAGGG - Intergenic
1068864289 10:61878718-61878740 AACATGAAGAAGAAAGTTGATGG - Intergenic
1069207870 10:65715396-65715418 ATAAAGGAGCTGAATGTTGATGG - Intergenic
1069302290 10:66923339-66923361 AGCAAGAAGCACAAAGTTAATGG + Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069549804 10:69355362-69355384 AAAAAGAAGAACAAAGCTGAAGG + Intronic
1069731296 10:70616379-70616401 ATAAAGAAGCAAAAACTAGAGGG - Intergenic
1070221400 10:74449483-74449505 AAAAAGAAATAGAAAGTTCAGGG + Intronic
1070269911 10:74943512-74943534 AAAAAGAACAACAAAGTTGAAGG + Intronic
1070377436 10:75847058-75847080 AAAAAGAAGAATAAAGTTGGAGG + Intronic
1071085742 10:81866925-81866947 ATAAAGAACAACAAAGTGGAGGG - Intergenic
1071097530 10:81995792-81995814 ATGAAGAACCAGAAAGTACAAGG - Intronic
1071169664 10:82849388-82849410 ACAAAGCACCAGAAAGTAGAGGG - Intronic
1071318984 10:84433151-84433173 TTGAAGAAGAAGAAAGTCGAAGG - Intronic
1071626688 10:87179015-87179037 ATGAAGAAGAACAAATTTGAAGG + Intronic
1071889770 10:89991106-89991128 AAAAAGAAGAACAAAGTTGAAGG + Intergenic
1072174532 10:92905220-92905242 ATATTGAAGAACAAAGTTGAAGG - Intronic
1072273871 10:93803087-93803109 ATAAAGAAACAGAGATTTAATGG - Intergenic
1073012015 10:100367979-100368001 GCAAAAAAGCACAAAGTTGAAGG + Intergenic
1073740054 10:106396337-106396359 GTACAGAAGCAGAAGCTTGAAGG - Intergenic
1074326889 10:112459131-112459153 ATAAAGAACAAGAAAGTTGTTGG + Intronic
1074589231 10:114796933-114796955 GTCAAGAAGCTGAAAGTTCACGG - Intergenic
1074784070 10:116823451-116823473 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1074879223 10:117640373-117640395 ATAAAGAAGAACAAAGTTGGAGG - Intergenic
1074896638 10:117783026-117783048 ATAAAAAAGTATAAAGTGGAAGG + Intergenic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1075889574 10:125935065-125935087 AGAAACAAGCAGAGAGATGAAGG - Intronic
1076085336 10:127623298-127623320 ATAAAGAAGAACAAAGTTGGAGG - Intergenic
1077553153 11:3212131-3212153 ATGAAGGAACAAAAAGTTGATGG + Intergenic
1078606469 11:12780902-12780924 AAAAAGAAGAACAAAGTTGGAGG + Intronic
1079048903 11:17135574-17135596 ATAAAGGAGCAGACAATAGATGG - Intronic
1079119291 11:17669731-17669753 ATGAAAAAGAACAAAGTTGAAGG - Intergenic
1079141165 11:17810602-17810624 ATAAAGAACTACAAAGTTCATGG - Intronic
1079686730 11:23368250-23368272 AAAAAGAAGAATAAAGTTGGAGG - Intergenic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1080913681 11:36631943-36631965 AAAAAGGAGCAGAAAGGTGGGGG - Intronic
1081517158 11:43844057-43844079 ATAAAGAGGCTGAAAATTCAAGG - Intronic
1081949852 11:47034955-47034977 TTAAAGCAGAAGAAAGGTGAAGG - Intronic
1082042711 11:47699679-47699701 ATAAACAAGCAGGAAATTTAGGG - Intronic
1082860025 11:57846674-57846696 AAAAAGAAAAAGAAAGTTGGAGG + Intergenic
1083014075 11:59433826-59433848 AAATAGAAGAACAAAGTTGAGGG + Intergenic
1083517728 11:63275960-63275982 ACAAAAAAGAACAAAGTTGAAGG - Intronic
1083784506 11:64936050-64936072 AGAAAGAAGCAGAAAGCAGCAGG - Intergenic
1083888114 11:65582498-65582520 AGAAAGAAGCAGCAAGATCAAGG + Exonic
1084314137 11:68334251-68334273 ATAAAGAAGCAGCATGTCGAGGG + Intronic
1084851339 11:71943671-71943693 ATGAAGAAGCAGAGATTTCAGGG + Intronic
1085149862 11:74242417-74242439 AAAAAGAAGAACAAAGTTGGAGG - Intronic
1085268437 11:75252482-75252504 ATAAAGAAGAACAAAGTTGAAGG - Intergenic
1085328182 11:75624619-75624641 AAAGAGAAGCAGAAAATTCAAGG - Intronic
1086258347 11:84907325-84907347 GTAAAGAAAGAGAAAGTTGAGGG + Intronic
1086474473 11:87156297-87156319 AAAAAGAAGAAGAAAGTTGAAGG - Intronic
1086543135 11:87936615-87936637 ACAAAGAAGAATAAAGTGGAAGG - Intergenic
1086798900 11:91145672-91145694 AAAAAGAGTCAGAAAATTGAAGG - Intergenic
1086962564 11:92994259-92994281 AAAAAGAAGAATAAAGTTGGAGG + Intergenic
1086980011 11:93185769-93185791 ATAAATGAGCAGAATTTTGATGG - Exonic
1087043565 11:93825099-93825121 AGAAAGAAGAACAAAGCTGAAGG - Intronic
1087998391 11:104841379-104841401 ATAAAGCTGCAGAGAGTTGGGGG - Intergenic
1088031328 11:105254375-105254397 AGAAAAAAGTAGCAAGTTGAGGG - Intergenic
1088273741 11:108062377-108062399 ATAAACAAGCACACTGTTGATGG - Intronic
1088282607 11:108150760-108150782 ATAGAGAACCAGAAAGTAAATGG - Intergenic
1088621499 11:111689074-111689096 AAACAGAAGCAGAATGTTGCAGG + Intronic
1089855627 11:121541932-121541954 ATTAAAAAGTAAAAAGTTGAAGG - Intronic
1090566708 11:128000896-128000918 CTAAAGAAGAACAAAGTTGAAGG - Intergenic
1091166875 11:133486134-133486156 ATAAAGAACCAGAAGCTTGCAGG + Intronic
1091351138 11:134895683-134895705 ATAAATAACCTGTAAGTTGAAGG - Intergenic
1202812623 11_KI270721v1_random:33597-33619 TTAATGAAACAGATAGTTGAGGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092139794 12:6175676-6175698 ATAAAGAAGTAGAGAAATGAGGG + Intergenic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092509325 12:9137463-9137485 AGAAAGAAGAAGAAAGCTGGAGG - Intergenic
1092641273 12:10513366-10513388 ATAAATAAGCAAGAAGGTGAGGG - Intronic
1092711603 12:11343667-11343689 ATAAAAAAGAAGAAAGTGGCTGG - Intergenic
1093502609 12:19829180-19829202 AAAAGGAAGGAGAAAGTAGAAGG + Intergenic
1093760479 12:22903923-22903945 TTACAGAAGAAGAGAGTTGAAGG + Intergenic
1093819586 12:23597347-23597369 CTTATGATGCAGAAAGTTGAGGG - Intronic
1093984966 12:25520334-25520356 ATAAAGTAGCAGAGATTTGTAGG - Intronic
1094061762 12:26321821-26321843 ATAAATGAGAAGAAAGTTGGAGG + Intergenic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1094394861 12:29994778-29994800 ATGAACAAGGAAAAAGTTGATGG + Intergenic
1094595975 12:31866955-31866977 ATCAAGAAGAACAAAGTTGGAGG + Intergenic
1094754572 12:33452633-33452655 AAAAAAAAGAAGAAATTTGAAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095274414 12:40263625-40263647 ATAAATAACCAGAAATTTTAAGG - Intronic
1095833711 12:46614739-46614761 AAAAAGAAGAACAAAGTTGGTGG + Intergenic
1095901899 12:47336184-47336206 ATAAAGAAAAAGAAATTTAATGG - Intergenic
1096152045 12:49320542-49320564 ACAAAGAACAAGAAAGTAGATGG + Intergenic
1096415982 12:51413859-51413881 AGCAAAAAGAAGAAAGTTGAAGG - Intronic
1096764791 12:53876121-53876143 ATAAATAATAAGAAAGCTGAAGG + Intergenic
1097455187 12:59791718-59791740 TTGAAGAAGAATAAAGTTGAAGG - Intergenic
1097936708 12:65260587-65260609 ACAAAGAAAAACAAAGTTGAAGG - Intergenic
1098039890 12:66343078-66343100 AAAAAGAAGAACAAAGTTGAAGG - Exonic
1098126654 12:67302708-67302730 ATAGAGAAGCAGAAAGTTCTAGG + Intronic
1098234074 12:68401759-68401781 ACAAACAAACAAAAAGTTGATGG + Intergenic
1098635139 12:72774280-72774302 AAAAAGAAGCAGATGGTTGCTGG + Intergenic
1098989496 12:77049091-77049113 ATAAAGAAGCAGGCAGTTTTAGG - Intronic
1099313172 12:81053089-81053111 ATAAGGAACCTGAAAGTTCAGGG + Intronic
1099558230 12:84138826-84138848 AAAAAGAAGGACAAAGTTGGAGG + Intergenic
1099587826 12:84544278-84544300 TTAATGAAGGAGAAAGCTGAGGG - Intergenic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1100522405 12:95387998-95388020 TTAGAGAAGCAGAAAGCTGTAGG + Intergenic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101468501 12:104972955-104972977 ATTAAAAAGCAGAAAGTAAAAGG - Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102031558 12:109742988-109743010 AAAAAGAAGAAGAAAGCAGAGGG - Intronic
1102319841 12:111923119-111923141 CTGAAGAAGCACAAAGTTGAAGG + Intergenic
1102634692 12:114312692-114312714 ATAAAGAAACTTAAAATTGAGGG + Intergenic
1103453970 12:121050252-121050274 ATAAATGGGCAGAAAATTGAAGG + Intergenic
1104360486 12:128128460-128128482 ATCAAGAAACAGAAAATGGATGG - Intergenic
1105334757 13:19456882-19456904 ACAAAGAAGTACAAAGTTGGAGG + Intronic
1106341592 13:28834229-28834251 AAAAAGCAGAACAAAGTTGAAGG + Intronic
1106346112 13:28879911-28879933 ATAAGGAAGCAAGAAGTTGAGGG + Intronic
1106664502 13:31837460-31837482 ACAAGGAAGGAGAAAGTGGAGGG + Intergenic
1106741636 13:32649449-32649471 ATAAAGAAGCATAGTGTTCAAGG + Intronic
1106799284 13:33240321-33240343 AAAAAGAAGGACAAAGTTGGAGG - Intronic
1107131601 13:36902442-36902464 AAAAAGAAGAACAAAGTTGAAGG - Intronic
1107249163 13:38337335-38337357 ATAAAGAAGAAGAATCTTAAAGG - Intergenic
1107266086 13:38556500-38556522 AAAAAGAAGAACAAAGTTAAAGG - Intergenic
1107827855 13:44346319-44346341 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108481472 13:50876874-50876896 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1108533827 13:51352049-51352071 TTGAAAAAGAAGAAAGTTGAAGG - Intronic
1108629376 13:52266439-52266461 ACAAAGAAGTACAAAGTTGGGGG + Intergenic
1108656679 13:52540049-52540071 ACAAAGAAGTACAAAGTTGGGGG - Intergenic
1109029514 13:57175118-57175140 ATAAGGAATCAGTAATTTGATGG + Intergenic
1109364267 13:61335177-61335199 ATGAAGTAGTAGAAAGTTCAGGG + Intergenic
1109599567 13:64606724-64606746 AAAAAGAACCAGAGAGTGGAAGG + Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110110331 13:71737226-71737248 AAAAAGAAAAAAAAAGTTGAAGG + Intronic
1110386790 13:74921484-74921506 AGAAAGAAGCACCAAGATGAAGG + Intergenic
1110763618 13:79256991-79257013 ATAAAGAAGTAGAAACTAAAGGG + Intergenic
1110813100 13:79832058-79832080 ATAAAGAAGCATGAATGTGAGGG + Intergenic
1111287910 13:86119511-86119533 ATAAAGAAGCTGGAAGTCAAAGG + Intergenic
1111400473 13:87727577-87727599 ATAGAGATGCGGAAAGTTGCAGG - Intergenic
1111831504 13:93335822-93335844 ATAAAGTAGTAGAAAGTTCCAGG - Intronic
1112134220 13:96558096-96558118 ATAAAAAAGCAAAAAGGTAAAGG - Intronic
1112612675 13:100971068-100971090 AAAAAGAAGAATAAAGATGAAGG - Intergenic
1113246475 13:108402441-108402463 ACAAATAAGTAGAATGTTGAGGG + Intergenic
1113322201 13:109244984-109245006 TTAAAGAAGCAGAAGCATGATGG + Intergenic
1113611533 13:111648541-111648563 AAAAAGAAGAATAAAGTAGAAGG - Intronic
1114221324 14:20700184-20700206 ATATAGAAGCTCAAAGTTAAGGG + Exonic
1114303893 14:21403389-21403411 ATAAAGCAGCAAAAAGTAGGAGG - Intronic
1114373619 14:22118303-22118325 ATAAAGAAACAGAAAGCTTCAGG - Intergenic
1114649932 14:24278070-24278092 ATAAAGAATCAGGAAGCTGGGGG - Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1114982870 14:28188404-28188426 ATAAAGAAATTGAAAGTTTATGG + Intergenic
1115271718 14:31560271-31560293 AGAAAGAAGAAGAGAGTAGAAGG - Intronic
1115718333 14:36130523-36130545 ATAAAGAAAAAGAAATTTAATGG - Intergenic
1116044271 14:39724256-39724278 ATAGAGAAGCATAAAATTGAAGG + Intergenic
1116120206 14:40712992-40713014 AAAAAGAAAAAGAAAGTTTAGGG + Intergenic
1116359267 14:43972411-43972433 ATATAAAATCAGAAAGTTGTAGG + Intergenic
1116656050 14:47655113-47655135 ATAAACAAGCAGATAGATGCTGG + Intronic
1116683962 14:48013989-48014011 GTATAGAAGCAGAGAGTAGAAGG + Intergenic
1116863137 14:50010353-50010375 ATAAAGAGGGAAAAAGTGGAAGG - Intergenic
1116885483 14:50217008-50217030 CTAAAGAAGAACAAAGTTGAAGG + Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117087533 14:52217046-52217068 AAAGAGAAGAAGAAAGTTGCAGG - Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1118017386 14:61673970-61673992 ATCACTAAGTAGAAAGTTGATGG - Intergenic
1119144351 14:72297211-72297233 AAATAGAAGAACAAAGTTGAAGG - Intronic
1119336432 14:73837319-73837341 AAAAAAAAAAAGAAAGTTGAAGG - Intergenic
1119578603 14:75753200-75753222 TTAAAGAAGAATAAAGTTTAAGG - Intronic
1119748212 14:77059365-77059387 ATACAGAAGCAAAAACTTTAGGG + Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120599513 14:86484517-86484539 ACAAAGAAGAACAAAGTTGGAGG - Intergenic
1121782619 14:96631681-96631703 ATGTAAAAGCAGAAAGGTGATGG - Intergenic
1121857144 14:97280644-97280666 AAAAAGAAGAAGAATGTCGATGG + Intergenic
1122072968 14:99216665-99216687 AGGAAGAATCAGAAAGTTCAGGG + Intronic
1122215173 14:100198762-100198784 AGAAAGAAACATAAAGTAGATGG + Intergenic
1122316756 14:100830007-100830029 TTAAAGAAACAGAAACTTGCTGG + Intergenic
1122361239 14:101166963-101166985 CTGAAGAAGCACAAAATTGAAGG - Intergenic
1123206699 14:106720401-106720423 ATAAGCAAGAAGAAAATTGATGG + Intergenic
1123211721 14:106767405-106767427 ATAAGCAAGAAGAAAATTGATGG + Intergenic
1124178587 15:27451240-27451262 ATAAAGAACAACAAAGTTGGAGG + Intronic
1124415357 15:29469168-29469190 AAAAAGAAGCAGAATCTTGCAGG - Intronic
1125220495 15:37327222-37327244 ATAAAGAAAAACAAAGTTGGAGG + Intergenic
1125418964 15:39484467-39484489 AAAAAGAATAACAAAGTTGATGG + Intergenic
1125547982 15:40522394-40522416 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125762426 15:42105766-42105788 TTAAAGAAGTATAAAGATGAAGG - Intergenic
1126019492 15:44386471-44386493 TTAAAGATGAACAAAGTTGAAGG - Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126279815 15:46932218-46932240 TCAAAGAAGAACAAAGTTGAAGG - Intergenic
1126279823 15:46932403-46932425 TTAAAGAAAAACAAAGTTGAAGG - Intergenic
1126475835 15:49064070-49064092 AGAAAGAAGGAGAAACTTGATGG - Intergenic
1126661884 15:51040395-51040417 AAAAAGAAGAAAAAAGTTGGAGG - Intergenic
1127100957 15:55564465-55564487 ATATAGAATTAGAAAGTAGAGGG + Intronic
1127149926 15:56062988-56063010 ATAAAGAAGAAGAAAAATAAAGG - Intergenic
1127502152 15:59564059-59564081 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
1127502845 15:59570753-59570775 AGAAAGAAGAAAAAAGATGAGGG - Intergenic
1127706457 15:61551955-61551977 GTAGAGAAGCTGAAATTTGATGG + Intergenic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128700731 15:69802379-69802401 AAAAAGGAGCAGAAAGTTTTAGG - Intergenic
1130090925 15:80820596-80820618 ACTGAGAATCAGAAAGTTGAGGG - Intronic
1130775381 15:86975075-86975097 AAAAAGCTCCAGAAAGTTGAGGG - Intronic
1131396794 15:92092651-92092673 AGAAAGCAGCAGGAAGTAGAGGG - Intronic
1131501480 15:92971709-92971731 ACAAAAAAACAGAAAGTTGTAGG - Intronic
1131854379 15:96577925-96577947 ATAAAAAAGAAGAAAATTGGAGG - Intergenic
1132306364 15:100816848-100816870 AAAAAGAAGAACAAAGTTCAAGG + Intergenic
1132472636 16:114396-114418 ATAAAGTGGCAGGAAGTTTAAGG + Intronic
1132920045 16:2383716-2383738 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1133048622 16:3103650-3103672 ATCACAAAGCAGAAAGTTCAAGG - Intergenic
1133445371 16:5855662-5855684 AGCAAGAAGAACAAAGTTGAAGG - Intergenic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1134305280 16:13026259-13026281 TCAAAGAAACAGAAAGTAGAAGG - Intronic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1134654214 16:15935124-15935146 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1134768875 16:16786752-16786774 AAAAAAAAAAAGAAAGTTGAAGG - Intergenic
1135112389 16:19700335-19700357 ATAATGAACCAGAAAGGAGATGG + Intronic
1135651523 16:24210485-24210507 AAAAAGAAGAAGAAAGTCCAGGG - Intronic
1137770042 16:51008824-51008846 ATAACGAGGCAGAAGGTTAACGG + Intergenic
1137817786 16:51415570-51415592 AAAAAAACGCAGAAAGGTGATGG - Intergenic
1137911496 16:52382637-52382659 ATAAAAAAACAGTAAGATGATGG + Intergenic
1138518406 16:57553618-57553640 ATAAAGAAGAATGAAGTTGGAGG - Intronic
1138789823 16:59890354-59890376 AGAAAGAAGGACAAAGTTGGGGG - Intergenic
1138957572 16:61990111-61990133 ATAAAGAAACAAAAATATGATGG + Intronic
1139101304 16:63770789-63770811 ATAAAGAAGCCAATAGATGATGG + Intergenic
1139171991 16:64641982-64642004 ATATAGAAGAACAAAGCTGAAGG - Intergenic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139370249 16:66462909-66462931 ATAAATAAGCAGGATGTTTAGGG + Intronic
1139801288 16:69525120-69525142 AAAAAGAAGAAGAAAATTGATGG + Intergenic
1139817915 16:69691354-69691376 AAAAAGAAACAGAAAGTTATGGG - Intronic
1140003099 16:71045745-71045767 ATAGAAAATCAGAAAGTTAATGG + Intronic
1140060019 16:71560781-71560803 AAAAGGAAGAATAAAGTTGAAGG - Intronic
1140106185 16:71962288-71962310 ATATTGAACCAGAAAGCTGAAGG + Intronic
1140140835 16:72256021-72256043 AAAGAATAGCAGAAAGTTGATGG + Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1140571808 16:76116270-76116292 ATGAAGAAGAACAAAGTTGCTGG - Intergenic
1141013481 16:80425681-80425703 ATAAACAAGCAGAAAGGTCAAGG + Intergenic
1141416329 16:83878252-83878274 GTAAAGATGCAGAAACATGAGGG + Intergenic
1142437279 16:90069062-90069084 AAAAAGAAGGATAAAGTTGAAGG + Intronic
1142894907 17:2967992-2968014 ATAAAGAAGAAGAAGTTTTATGG + Intronic
1143221784 17:5267923-5267945 ACAAAGAAGAATAAAGTTGAAGG + Intergenic
1143918858 17:10315026-10315048 ATAATGAAGAAGAAAGAGGAGGG + Intronic
1144707537 17:17379511-17379533 ATACAGAAACAGAAAGCGGATGG - Intergenic
1145203199 17:20965799-20965821 AAAAAGAAGAACAAAGCTGAAGG - Intergenic
1146139607 17:30353780-30353802 AAAAAGAAGAACAAAGTTGAAGG - Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146744556 17:35315889-35315911 ATTAAGAAGCAGAGGGTTGGGGG - Intergenic
1147871532 17:43591067-43591089 AAAAAGAAGAAGAAATATGATGG + Intergenic
1148132225 17:45268966-45268988 GGAAAAAAGCAGAAAGTTGGTGG - Intronic
1148928749 17:51110711-51110733 ATAGAGAAGTACCAAGTTGAGGG - Intronic
1149103389 17:52933050-52933072 AAGAAGAAGCAGAAAGTCAAGGG + Intergenic
1149115889 17:53096415-53096437 AGAAAGAAGAAGAAAGATGAAGG + Intergenic
1149219083 17:54394152-54394174 ATATACATGAAGAAAGTTGAAGG - Intergenic
1149276166 17:55040192-55040214 ATAACAAAGAAGAAAGTTGGTGG + Intronic
1149344285 17:55718535-55718557 ATAAAAAATCAGAAAGTGAATGG - Intergenic
1150020317 17:61605585-61605607 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1150069006 17:62136895-62136917 AAAAAGAAAAAGAAAGTTGTTGG - Intergenic
1150073918 17:62176311-62176333 ATTAAAAAGAACAAAGTTGAAGG + Intergenic
1151142934 17:72012302-72012324 ATAAAGAAGCAAAATGATTAGGG + Intergenic
1151457661 17:74236041-74236063 AGACAGAAATAGAAAGTTGACGG - Intronic
1152384132 17:79959436-79959458 AAAAAGAAGAACAAAGTTGGAGG + Intronic
1152998996 18:436083-436105 AGCAAGAAGCAAAGAGTTGATGG - Intronic
1153081288 18:1228603-1228625 AGAAAGAAGAAAAAAGTTGGAGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153190203 18:2529599-2529621 AAAAAGAAAAAGAAAGTTTATGG + Intergenic
1153274508 18:3354790-3354812 ATACAGCAGCAGAAAGTTTCAGG - Intergenic
1153655633 18:7279805-7279827 TGAAAGAAGCAGAAAGTTGCCGG + Intergenic
1154282792 18:13021548-13021570 AAAAAGAAGAATTAAGTTGAAGG - Intronic
1154504822 18:15025862-15025884 AGAAAGAAGCAGAAATTAAAAGG + Intergenic
1155076567 18:22362286-22362308 ATAAGGAAGTGGAAATTTGAAGG + Intergenic
1155418760 18:25630761-25630783 AAAAAGTAGCATAAAGTTGGAGG + Intergenic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156440811 18:37185836-37185858 ATAAAGAAAAAGTAAGCTGAAGG - Intronic
1156564471 18:38169730-38169752 AAAGAGAAGGAGAAAGTTAAAGG - Intergenic
1156790047 18:40961019-40961041 AAAAAGAAAAACAAAGTTGATGG - Intergenic
1157103495 18:44751181-44751203 AGAAAGAAGCAGGAAGGTAAGGG + Intronic
1158126664 18:54107088-54107110 AAAAAGAAGAAGAAATTGGATGG + Intergenic
1158289943 18:55929182-55929204 ATCAAGAAATAGAAAGCTGATGG + Intergenic
1158290992 18:55942692-55942714 AAAAAGAAGAATAAAGTTGGAGG - Intergenic
1158503108 18:58021618-58021640 ATAAGAAACCAGAAAGTTGACGG - Intergenic
1158671601 18:59479274-59479296 TTAAACAAGTAGAAAGTAGAGGG - Intronic
1158855575 18:61540402-61540424 ATAAAGAAAAAGAAGGTTAATGG + Intronic
1158923570 18:62224917-62224939 ATAAAGAAGAACAAATTTGGAGG + Intronic
1159005747 18:63008712-63008734 ATAAAGCACCAGAAAATTGAAGG - Intergenic
1159059487 18:63499863-63499885 AAAAATAAGCAGAAAGTACAAGG + Intronic
1159325854 18:66916379-66916401 AGACAGAAGCAGATAGTTCAGGG - Intergenic
1159576540 18:70184903-70184925 AAAAACAAGAACAAAGTTGAAGG + Intronic
1159579843 18:70222781-70222803 AAAAAGAAGAACAAAGTTGAAGG + Intergenic
1159677264 18:71300860-71300882 ATAAAGAAGCAGTAATTTGGGGG - Intergenic
1159695521 18:71552405-71552427 AGAAGGAAACAGAAAGATGATGG + Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159835862 18:73334573-73334595 ATAAAGATGCAAATATTTGATGG + Intergenic
1160196455 18:76759359-76759381 AGATGGAAGCAGAAAGTTCACGG - Intergenic
1160241466 18:77127084-77127106 ATAAAGAATAATAAAGTGGAAGG + Intronic
1160446217 18:78929078-78929100 AAAAAGAAGAACAAAATTGAAGG - Intergenic
1161568642 19:5017612-5017634 GTAAGGAAGCACAAACTTGAAGG - Intronic
1162915205 19:13870994-13871016 ATAAAGAAGAAGCAAAATGAAGG + Intronic
1163349744 19:16768889-16768911 AAAGAGAAGCAGATAGTTCAAGG - Intronic
1163877351 19:19883725-19883747 ATCATAAAACAGAAAGTTGAAGG - Intronic
1164211924 19:23106132-23106154 AAAAAGAAGAAGAAAGCAGAAGG + Intronic
1164657178 19:29931065-29931087 AAAAAGAAGAACAAAGTTGGAGG - Intronic
1164772673 19:30822909-30822931 AAAAAGAAGAACCAAGTTGAAGG + Intergenic
1164880735 19:31730633-31730655 GTAAATAAGCAGTAAGTTAAAGG - Intergenic
1164959212 19:32412933-32412955 AAAAAAAAGAAAAAAGTTGAGGG + Intronic
1165106874 19:33475502-33475524 AGCAAGCAGCAGAAAGTTGATGG - Intronic
1165294119 19:34912428-34912450 ATCAAGAAGCAGGCAGTTGAGGG + Intergenic
1166577722 19:43858511-43858533 TTCCAGAAGGAGAAAGTTGAGGG + Intergenic
1167039421 19:47013997-47014019 AAAAAGAAAAAGAAAATTGATGG - Intergenic
925073863 2:994470-994492 ACAAAGAAGAACAAAGTTGGAGG - Intronic
925220849 2:2139255-2139277 ATAAAGAAGATGAAATTTCATGG - Intronic
925381705 2:3432336-3432358 ATAGAGGAGCAGACAGCTGATGG - Intronic
925819101 2:7782062-7782084 AGAAAGAAGAACAAAGTTGGAGG - Intergenic
925909055 2:8560306-8560328 ATACAGAAGCTGAAAGTGAAGGG + Intergenic
925935600 2:8755916-8755938 AAAAAGAAGAACAAAGTTGGAGG - Intronic
926002156 2:9342216-9342238 AAAAAGAAGAACAAAGTTGGAGG + Intronic
926031385 2:9593169-9593191 ATAAACAAGAAGAAAGTTCTTGG - Intronic
926122229 2:10249130-10249152 ATAAAAAAGAACAAAGTTGGAGG - Intergenic
926257893 2:11225211-11225233 ATAAAGATGGAAAATGTTGAAGG + Intronic
926464702 2:13173597-13173619 AGAAAGAAACACAAAGTTGAAGG - Intergenic
927284853 2:21346050-21346072 ACAAAGAAGGTGAAAGCTGATGG - Intergenic
927595796 2:24395879-24395901 AAACAGAAGAATAAAGTTGAAGG - Intergenic
927835726 2:26397063-26397085 GAAAAGAAGAAGAAAATTGAAGG - Intergenic
928477294 2:31641953-31641975 AAAAAAAAGAATAAAGTTGAAGG + Intergenic
929303082 2:40328457-40328479 ATAAAGAAGGAGAAAACTGCAGG - Intronic
929913075 2:46109134-46109156 CTGAAGAAGAAGAAAGTTGGGGG - Intronic
930444704 2:51455677-51455699 ATACAGATGAAGAAAGTAGATGG + Intergenic
930470916 2:51811911-51811933 AGAAAGAAAAAGTAAGTTGAAGG + Intergenic
930538032 2:52667933-52667955 ATAAAGAAGCACAGAGTTTGAGG + Intergenic
930539853 2:52691413-52691435 GTATAGAAACAGCAAGTTGAAGG + Intergenic
930776139 2:55172152-55172174 ATAAAAAAAAATAAAGTTGATGG + Intergenic
930882449 2:56287502-56287524 ATAAACAACTAGAAAGTTGGTGG - Intronic
931155604 2:59625169-59625191 TAAAAGAAACAGAAAGTTGGTGG - Intergenic
931469538 2:62524587-62524609 AAACAGAAGCAGATACTTGAAGG + Intergenic
931528943 2:63190792-63190814 ACAAAGAAGCAGAATTTTGGTGG + Intronic
931545831 2:63385802-63385824 AAAAAGAAGAATAAAGTTGAAGG + Intronic
931552644 2:63463545-63463567 AAAAAGAAGAACAAAGTTGGAGG + Intronic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
932584890 2:73021588-73021610 ATAAACAACCAGGAAGTTGATGG - Intronic
933226178 2:79751915-79751937 AGAAAGAAGCTAAAAGTTGCAGG + Intronic
933382365 2:81565669-81565691 AGAAAGAAAAAGAAAGCTGAAGG + Intergenic
933968311 2:87448773-87448795 AAAAAGAAGAATAAAGTTGGAGG + Intergenic
934911385 2:98258295-98258317 AAATAGAAGAACAAAGTTGAAGG - Intronic
935443462 2:103131217-103131239 ATAAAGAAGCAAAAAGAAAAGGG + Intergenic
935851616 2:107227619-107227641 ATAAGCAAGCAGAATGTTTAAGG + Intergenic
935988954 2:108702236-108702258 ACAAAGAAGTATAAACTTGAAGG + Intergenic
936242888 2:110803230-110803252 ATAAAGAAGAACAAAGTAGGAGG + Intronic
936325484 2:111501731-111501753 AAAAAGAAGAATAAAGTTGGAGG - Intergenic
936345962 2:111675281-111675303 ATTGAGGAGCAGAAAGTTGTTGG + Intergenic
936439651 2:112540520-112540542 AGAAAGAAGAACAAAGTTGGAGG + Exonic
936486041 2:112926635-112926657 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
936590546 2:113799754-113799776 ACAAAGAAGCAGGAAGTGGGGGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
937018239 2:118626491-118626513 ATAAAGAAGAAGAAAGTTAGAGG - Intergenic
937185928 2:120042599-120042621 ATAATGGAGTAGAAAGTTGGAGG + Intronic
937348794 2:121145920-121145942 AAAAAGAAGAACAAAGTTGAAGG - Intergenic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
937642189 2:124226262-124226284 ATAAAGAAGGAGATAGGTGTTGG - Intronic
937839808 2:126513714-126513736 AAAAATAAGCAGAAATTTCATGG + Intergenic
937934725 2:127233889-127233911 AAAAGGAAGAACAAAGTTGAAGG + Intergenic
938176819 2:129141314-129141336 ATAAATAAGTTGAAAGTTAAAGG - Intergenic
938209225 2:129452156-129452178 AAAAAGAAGAAAAAAGTTGGAGG + Intergenic
938504015 2:131856069-131856091 AGAAAGAAGCAGAAATTAAAAGG + Intergenic
939108976 2:137983884-137983906 ATTAAGAAGCAGCAAATGGAAGG - Intronic
939239730 2:139542220-139542242 ATAAAAAAAAAGAAAGTAGAAGG - Intergenic
939750996 2:146045624-146045646 ATAAAGAAGAAGAAACCTTAGGG + Intergenic
939834453 2:147111622-147111644 ATAAAAAAGCAGATACTTGCAGG - Intergenic
940690513 2:156913907-156913929 AAAAAGAAGAACAATGTTGAAGG - Intergenic
941034153 2:160548530-160548552 AAAAAGAAAAACAAAGTTGAGGG - Intergenic
941118332 2:161498166-161498188 AAAAAGAAAAAGAAAGTTGGGGG - Intronic
941332779 2:164199876-164199898 AGAAAGAAGAACAAAGCTGAAGG + Intergenic
941341142 2:164305375-164305397 AAAAAGAAGAATAAAGTTGGAGG + Intergenic
941853153 2:170204467-170204489 ATAATGTGGAAGAAAGTTGATGG + Intronic
941873979 2:170414518-170414540 AAAAAGAAGAATAAAGTTGAAGG - Intronic
941980700 2:171453382-171453404 AAAAACATGCAGAAAGATGAAGG - Intronic
942053293 2:172161094-172161116 AGAAAGAAGAACAAAGCTGAAGG - Intergenic
942056340 2:172187094-172187116 AAAAAGAAGAACAAAGTTAAAGG - Intergenic
942086885 2:172452147-172452169 ATAAAGAACTGGAAGGTTGAGGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942443883 2:176065553-176065575 ATTAAGAAACAGAAAGTTAGAGG + Intergenic
942902329 2:181136480-181136502 ATAAAAAAGAACAAAGCTGAAGG + Intergenic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
943123804 2:183771579-183771601 AGAAAGAAAAACAAAGTTGAAGG + Intergenic
943178962 2:184517715-184517737 AGAAAGAAGAACAAAGCTGAAGG - Intergenic
943538809 2:189185466-189185488 AGAAAGAAGCAGAAAGATTCAGG + Intergenic
943877960 2:193098114-193098136 ATATAGGAGCAGAGAGTAGATGG - Intergenic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944438333 2:199715554-199715576 ATAAAGAAAAAGAAGTTTGATGG - Intergenic
944937017 2:204579923-204579945 ATAATGTATCAGAAAGTTGTTGG + Intronic
945059922 2:205899946-205899968 GTATAGAAGCAGAGAGATGAGGG + Intergenic
945540235 2:211076457-211076479 ATCTAGAAGCATAAAGTTTAGGG - Intergenic
946035969 2:216742498-216742520 TTAAAGAAGCAGGAACTTCAGGG + Intergenic
946721714 2:222615813-222615835 TTTAAGAAGCACCAAGTTGAAGG - Intronic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
946998910 2:225430039-225430061 TTAAAAAAGCAGAGAGTTGCAGG - Intronic
947002430 2:225472331-225472353 AGTAAGAAGCAGGAATTTGAAGG + Intronic
947119837 2:226801769-226801791 ATAAAGAAGCCTGAAGTTGGTGG + Intergenic
947122263 2:226829308-226829330 AAAAAGAAGAATAAAGTTGGAGG - Intergenic
947412665 2:229857799-229857821 GCAAAGAAACAGAAAGTAGATGG - Intronic
948557996 2:238829432-238829454 AAAAAGAAGTACAAAGTTGGAGG + Intergenic
948928921 2:241118223-241118245 AAAAAAAAACACAAAGTTGAAGG + Intronic
948948074 2:241231579-241231601 GCAAAGAAGCAGGAAGCTGAGGG - Intronic
1169371120 20:5028833-5028855 AAAAAGAAGAGCAAAGTTGAAGG - Intergenic
1169702349 20:8461165-8461187 AAAAAGAATCTGAAAGTCGAGGG + Intronic
1170163489 20:13339416-13339438 ATAAAGAAGGTGAAAAATGATGG - Intergenic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1170288129 20:14734690-14734712 ATAAAGAAGGAGAAAGTTGGAGG + Intronic
1170319989 20:15084970-15084992 AGAAAGAAGAACAAAGTTGTAGG + Intronic
1170708264 20:18765798-18765820 ATAAATAAGCAGAAAGAAGGAGG - Intergenic
1171056111 20:21908585-21908607 ATGAAGAGGCATAAAGTTAATGG + Intergenic
1171148541 20:22806637-22806659 ACAAAGAATCAGACAGTTAAAGG - Intergenic
1171300607 20:24056788-24056810 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1172227040 20:33311966-33311988 ATAAAGGAGCAGAGAGAAGAAGG - Intergenic
1172294347 20:33798001-33798023 ATAAAGAATCAGAAACTTAGTGG + Intergenic
1173925620 20:46779150-46779172 AGAAAGAAGGAGAAACTTGGTGG + Intergenic
1173946782 20:46957806-46957828 AGAAAGAAGCACAAACTTGGTGG - Intronic
1174731370 20:52921320-52921342 TTCAAGAAGCAAAAATTTGAGGG - Intergenic
1174873547 20:54205398-54205420 ATAAAGAAAAAGAGATTTGATGG + Intergenic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175629499 20:60522825-60522847 GTAAAGAAGAACAAAGCTGAAGG + Intergenic
1175898300 20:62349901-62349923 GTAAAGAGGCAGAAAATTGCTGG + Intronic
1176087149 20:63303051-63303073 ATATAGAATCACCAAGTTGATGG - Intronic
1176692943 21:9939395-9939417 AAAAAGAGAGAGAAAGTTGAAGG - Intergenic
1176940666 21:14920636-14920658 ATAAAGAAGAACAAAGTTGATGG - Intergenic
1176954973 21:15091721-15091743 CTAAAGAATCAGAAATGTGAAGG + Intergenic
1177356153 21:20010764-20010786 AAAAAGAAGTGGAAAGTAGAAGG - Intergenic
1177526089 21:22292178-22292200 GTAAAGAAAGAGAAAATTGATGG + Intergenic
1177532009 21:22372804-22372826 AGAAAGAAGAACAAAGCTGAAGG - Intergenic
1177532077 21:22373605-22373627 AGAAAGAAGAACAAAGCTGAAGG + Intergenic
1177753308 21:25313970-25313992 ATAAAAAAGCATAGAGTTTATGG + Intergenic
1177777496 21:25584927-25584949 ACAAAGAAGCAGAAACTTTTTGG + Intergenic
1177839518 21:26220198-26220220 ATAAAGAAAAAGAAATTTCATGG + Intergenic
1177992423 21:28054111-28054133 AAAAAGAAGCAGAAATTAAAAGG - Intergenic
1178018413 21:28379024-28379046 ATCAGAAAGCAGAAAGTTGGGGG + Intergenic
1178257597 21:31068888-31068910 ATAAAAATGCTGAAACTTGAGGG - Intergenic
1178338907 21:31768768-31768790 ATAAACCTGAAGAAAGTTGAAGG - Intergenic
1178715975 21:34964609-34964631 TTGAAGAAGTACAAAGTTGAGGG + Intronic
1178756519 21:35355122-35355144 ATAAAGAACAAGAAATTTAATGG - Intronic
1178829045 21:36039957-36039979 ATCTAGCAGCAGAAGGTTGAAGG + Intronic
1178945739 21:36946229-36946251 ATAAAAAATAAAAAAGTTGAGGG - Intronic
1178961292 21:37068532-37068554 ATGAAAAAGCAGAAAATTAAAGG - Intronic
1179081847 21:38178699-38178721 AGAAAGAAGAAGAAAGAAGAAGG + Intronic
1180028797 21:45186966-45186988 AAAAAGAAGAATAAAGTTGGAGG - Intronic
1180686350 22:17670199-17670221 AAAAGGAAGAACAAAGTTGAAGG - Intronic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1181383681 22:22527676-22527698 ATAAAGAAAAATAAATTTGATGG - Intergenic
1181386553 22:22550191-22550213 ACAAAGAAGCGAAAAGTAGATGG - Exonic
1182173176 22:28254421-28254443 ATAAAGAATCAGAAAAGTCAAGG + Intronic
1182595696 22:31418481-31418503 ATGAGGAACTAGAAAGTTGATGG + Intronic
1182613899 22:31572800-31572822 ATCAACAAGCAGAAAGCAGATGG - Intronic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1182936011 22:34222266-34222288 ATAAAGAAGAAAAAAGTCGTGGG + Intergenic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184448213 22:44566359-44566381 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1184836567 22:47026939-47026961 AAAAAGATGAACAAAGTTGAAGG + Intronic
1185160307 22:49222714-49222736 AAAGAGAAGAACAAAGTTGAAGG + Intergenic
1185230834 22:49680503-49680525 AAAAAGAAGAAGGAAGTTGGAGG - Intergenic
949300437 3:2577119-2577141 GTAAAGAAGAAAAAAGTAGAAGG - Intronic
950320646 3:12049541-12049563 ATAAAAAAACTGAAAGATGAGGG + Intronic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950976030 3:17246473-17246495 ATAAAAAAGAACAAAGTTGGAGG + Intronic
951061396 3:18211052-18211074 ATATAAAAACAGAAAGTAGATGG + Intronic
951569346 3:24045851-24045873 CTTAAGAAGCAGAAAATTAAGGG - Intergenic
951821373 3:26816449-26816471 AAAAAAAAGAACAAAGTTGAAGG + Intergenic
952245405 3:31584363-31584385 AAAAAGAACAACAAAGTTGAAGG - Intronic
952443316 3:33355540-33355562 ATGAAGAAGAACAAAGTTGAAGG + Intronic
952653709 3:35758265-35758287 ATAAAGAAGCATATACTTGGGGG + Intronic
952731838 3:36645417-36645439 AGAAAGAAAAAGGAAGTTGAAGG - Intergenic
952735388 3:36685649-36685671 AGAAAGAAGAACAAAGCTGAAGG + Intergenic
952772171 3:37011631-37011653 ATAAACCAGCAGAAACTTCATGG - Intronic
953440556 3:42913061-42913083 ATAGATAAGCAGAAATTTGATGG - Intronic
953617450 3:44503841-44503863 AAAAAGAGGAATAAAGTTGAAGG + Intronic
954087205 3:48254411-48254433 ATACTGAAGAATAAAGTTGAAGG - Intronic
954495870 3:50961146-50961168 AAAAAGAAGAACAAAGCTGAAGG - Intronic
954606175 3:51911645-51911667 AAAAAAAAGAACAAAGTTGAAGG + Intergenic
955227266 3:57071008-57071030 AAAAAGAAGGACAAAGTTGGAGG + Intronic
955377244 3:58408312-58408334 AAAAAGAAAAATAAAGTTGAAGG - Intronic
955568885 3:60281385-60281407 ATATTGAAGAACAAAGTTGAAGG + Intronic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956331891 3:68119811-68119833 AAAAAGAAGAAAAAGGTTGACGG - Intronic
956376503 3:68618927-68618949 ACAAAGCAGCAGAAAGATGAAGG - Intergenic
956492536 3:69788650-69788672 AGAAAGAAGAACAAATTTGAAGG + Intronic
956573417 3:70723458-70723480 ATAAGCAAACAGAAAGGTGAGGG + Intergenic
956739811 3:72267018-72267040 ATAAAGAAGAAGAGATTTAATGG + Intergenic
956856466 3:73280020-73280042 ATAAAGCAGCAGTCAGTTCATGG - Intergenic
956928074 3:74010785-74010807 ATAAAGAATCATTGAGTTGAAGG - Intergenic
957131727 3:76231287-76231309 ATAAAGCAGCAGAAGGTAAATGG - Intronic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957413290 3:79868019-79868041 ATAAAGAAGAACAAATTTTAGGG - Intergenic
957659781 3:83133791-83133813 ATAAAGCAGAGGCAAGTTGAAGG - Intergenic
957960399 3:87242872-87242894 AAAAAGAAGTACAAAGTGGAAGG - Intronic
958058340 3:88443577-88443599 ATAGAGAAACAGAAATTAGATGG + Intergenic
958722525 3:97862054-97862076 GCAAAGAAGCAGACAGTTAAGGG + Intronic
958722887 3:97867178-97867200 GCAAAGAAGCAGACAGTTAACGG + Intronic
958772458 3:98442258-98442280 CTGAAGAAGAACAAAGTTGAAGG - Intergenic
958792763 3:98670891-98670913 AAAAAAAAGAAAAAAGTTGAGGG + Intergenic
959428791 3:106225625-106225647 AAAAAGAAGCACAAAGTTGGAGG - Intergenic
959488300 3:106954899-106954921 AGAAAGAAGAAGAAAGTGTATGG - Intergenic
959490510 3:106982221-106982243 ATAATGATGCAGATATTTGAAGG - Intergenic
959531713 3:107440976-107440998 AGAAAGAGGCAGAAAATTAATGG + Intergenic
959598680 3:108154929-108154951 AAAAAGAAGAACAAAGTGGAGGG - Intergenic
959769588 3:110076729-110076751 ATAAAGTGGCAGAGAGTTGAAGG - Intergenic
959884845 3:111487816-111487838 AAAAAAAAACAGAAAATTGAGGG + Intronic
960072745 3:113450392-113450414 ATAGAGCAGCAGAAACTTGTTGG - Exonic
960423336 3:117476032-117476054 ATAAGGAACGAGAAAGTTTAGGG + Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
960625313 3:119676762-119676784 ATAAAGGAGCTTAAAGTTAATGG - Intronic
960705517 3:120477199-120477221 AAAAAGAAGAAGAAACTCGAGGG + Intergenic
960880957 3:122344413-122344435 AAAAAGAAGTGCAAAGTTGAGGG + Intergenic
961122905 3:124388592-124388614 AAAAAGAAGAAGAAAAATGAGGG + Intronic
961408573 3:126701703-126701725 AGAAAGAAGCAGAAAGCTGAAGG - Intergenic
961852395 3:129834189-129834211 ATAAATAAGCAGAAAGATGTGGG + Intronic
961970622 3:130961543-130961565 ATAAGAAAGCAGAAAAATGATGG + Intronic
962048356 3:131785390-131785412 AAAAATAAGCAGAAACATGAAGG - Intronic
962148139 3:132862908-132862930 ATAAAGAAGAATAAAGTTGGAGG - Intergenic
962569785 3:136701333-136701355 ATCAAGAAGCAAAAAGGTCAAGG - Intronic
962768303 3:138587798-138587820 AAAAAGAAGAACAAAGTTGAAGG + Intronic
963709549 3:148731198-148731220 CTAAAGAACCAGAAAATAGAGGG + Intronic
964071659 3:152641891-152641913 ATAAAGAAGCAGAAGCTTAAAGG + Intergenic
964649732 3:158996963-158996985 ATAGAGAAGCAGCAAGATAAAGG - Intronic
964774464 3:160260369-160260391 ATAGAGAAGACGAAACTTGATGG + Intronic
965006649 3:163034998-163035020 ATATAGAAGAAAAAAGTAGAAGG - Intergenic
965099279 3:164276195-164276217 ATACAGACGCTGAAAGTGGATGG + Intergenic
965265808 3:166541621-166541643 AAAAGAAAGCACAAAGTTGAAGG + Intergenic
965276986 3:166696810-166696832 ACAAAGAAACAGAAGGTTGATGG - Intergenic
965463210 3:168994826-168994848 TTAAAAAAGCTAAAAGTTGAAGG + Intergenic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
965860516 3:173143923-173143945 GAAAAGAAGAACAAAGTTGAAGG - Intergenic
966296920 3:178434603-178434625 AGGAACAAGCAGAAAATTGAAGG + Intronic
966520098 3:180864454-180864476 ATAAAGAAACTGAAAGTTTCTGG - Intronic
966829592 3:183995712-183995734 AAAAGGAAGGATAAAGTTGAAGG - Intronic
967178875 3:186885935-186885957 TTAAAGAAGAACAAAGTTGAAGG - Intergenic
967302406 3:188027974-188027996 AAAAAGAAGAATAAAGTTGGAGG + Intergenic
967418522 3:189246390-189246412 ATAAATAAGTAGAAAGTAAACGG - Intronic
967476860 3:189931989-189932011 AAAGAGAAGAACAAAGTTGAAGG - Intergenic
967531968 3:190558646-190558668 AAAAAGAAGAATAAAGTTGGAGG - Intronic
968707182 4:2084956-2084978 TTAAAGAAAGAGAAAGTTGTGGG - Intronic
969037428 4:4265973-4265995 ATAAAGAAGAAGAAGTTTAATGG - Intergenic
969452567 4:7283236-7283258 ATAAAGCAGCTGAGAGTTGGAGG + Intronic
970676479 4:18455955-18455977 ACAGAGAAGCAAAAAGTTCAGGG + Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970972062 4:21996486-21996508 TCATAGAAACAGAAAGTTGAAGG + Intergenic
971005343 4:22368138-22368160 AAAAAGAAGAACAAAGTTGGAGG + Intronic
971249042 4:24956780-24956802 AGAAGGAAGCAGAAACTTGGCGG + Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971678261 4:29664048-29664070 ATACAAAAACAGAAAATTGAGGG + Intergenic
971945847 4:33276008-33276030 ATAGATCAGCAGAAAGCTGAAGG + Intergenic
972616945 4:40708081-40708103 AAAAAGAAGAAAAAAGTTGAAGG + Intergenic
972731456 4:41799036-41799058 AAAAAAAAGTAGAAATTTGAGGG + Intergenic
973561288 4:52138890-52138912 AAAAACAAGAAAAAAGTTGAAGG + Intergenic
973681537 4:53325420-53325442 ATAAAAAAGAAGAAAGATGAAGG + Intronic
974016167 4:56651168-56651190 GTAATGAAGCAGAATATTGATGG + Intronic
974646515 4:64701219-64701241 ATTAAGATGCATAAAGTTGATGG - Intergenic
974734215 4:65908449-65908471 ATGAAGAAAAAGAAAGTTGGGGG + Intergenic
975152747 4:71038839-71038861 TTAAAGAAGAACAAAGTTGTAGG - Intergenic
975279005 4:72538716-72538738 AAAAAGAAGCATAAAGCTGGAGG + Intronic
975393264 4:73845491-73845513 AAAAAGGAGGAGAAAGATGAAGG + Intronic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
975944406 4:79687430-79687452 ATTAAAGAGCAGAAAGCTGAAGG - Intergenic
976316079 4:83660256-83660278 ATAAATAAACAAACAGTTGAGGG + Intergenic
976655079 4:87479930-87479952 ATCAAGAATGAGAAAGTTGGAGG + Intronic
977116709 4:93037876-93037898 ATAAAAAAGAAGAAAGCTGGAGG - Intronic
977152951 4:93536257-93536279 ACAAAGAAGCACAAAGCTGGAGG + Intronic
977284326 4:95083331-95083353 ATAAAGACACAGAAAGATCATGG + Intronic
977483350 4:97608302-97608324 ATAATGTAGCATAAAATTGAAGG + Intronic
978207922 4:106102226-106102248 ATACAGAAGAAGAAAGCTGAAGG - Intronic
978218676 4:106241913-106241935 TAAAAGAATCAAAAAGTTGAAGG + Intronic
978917604 4:114145957-114145979 ATAAAGACTCAGAAATTTTAAGG + Intergenic
978976196 4:114877186-114877208 AAAATGAAGCAGAAAATAGACGG - Intronic
979528345 4:121741128-121741150 AGAAAGCAGCAGCAAGTGGAGGG - Intergenic
979688191 4:123534236-123534258 AGAAAGAAAAATAAAGTTGAAGG + Intergenic
979757092 4:124354480-124354502 AAGAAGAAGAAGAAAGTTGGAGG - Intergenic
979776961 4:124601832-124601854 AAAAAAAAGCAGAGATTTGAGGG - Intergenic
979799459 4:124890064-124890086 ATAAAGATGCAAAAGGTTAAAGG - Intergenic
979981994 4:127268100-127268122 AGAAAGAAGAATAAAGTTGGAGG + Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980201465 4:129660522-129660544 TTGAAGAAGAAGAAAGTTGGAGG - Intergenic
980213895 4:129826258-129826280 ATAAAGAAGGAGAACTTTGTGGG - Intergenic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
981105784 4:140879179-140879201 AGAAAGAAGAACAAAATTGAAGG - Intronic
981193586 4:141892129-141892151 ACAAACAAGGAGAAAGTTGTGGG - Intergenic
981464418 4:145051246-145051268 ATAAAAAAGCAGCCAGTTGGTGG + Intronic
982223838 4:153147742-153147764 AAAAAGAAGCAAAAATTAGATGG + Intergenic
982374605 4:154675661-154675683 ATAAAAAAGCAAAAAGTTCAAGG - Intronic
982546660 4:156741622-156741644 ATAATAAAGCATAAAGTTCATGG - Intergenic
982744100 4:159088402-159088424 ATAAAAAAGAATGAAGTTGAAGG - Intergenic
982786457 4:159542933-159542955 ATAGAGAAAAAGAAAGGTGAGGG + Intergenic
982976796 4:162073532-162073554 CTCAAGAAGCAGAAAATTGTAGG + Intronic
983111419 4:163754901-163754923 AGAAGGAAGCAGAAAGGAGACGG + Intronic
983326267 4:166260754-166260776 ATTATGAATCAGAAAGTTGAAGG - Intergenic
984028817 4:174577347-174577369 ATAAAGAAAAAGAAATTTAATGG - Intergenic
984207745 4:176806504-176806526 ATGAACAAGAAGAAAGTTGTAGG + Intergenic
984404906 4:179315752-179315774 AAAGAGAAGAAAAAAGTTGAAGG - Intergenic
984414985 4:179446615-179446637 ACAAAGAAGCACAAACTGGATGG + Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984730292 4:183062091-183062113 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
984872374 4:184337788-184337810 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
984957686 4:185061964-185061986 TTACAGAAGCAGAAAGCAGATGG + Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986117354 5:4790121-4790143 ATGAAGAAGAACAAAGTTGGAGG + Intergenic
986272269 5:6243729-6243751 ATAAAGTAGCATAAATTTGGTGG - Intergenic
986618456 5:9644493-9644515 TTCAAGAAGGAGAAGGTTGAAGG + Intronic
986791971 5:11170798-11170820 ATAAAGAAACAGAGATTTAATGG + Intronic
986890311 5:12296107-12296129 ATCAAAAAGCACAAAGTTGGAGG - Intergenic
987039649 5:14049851-14049873 ATAAAGAAGAACAAAGTTGAAGG + Intergenic
987678358 5:21104775-21104797 ATAGAGGAGCAGGAAGATGAAGG + Intergenic
987712954 5:21527861-21527883 CTAGAGAAACAGAAAGCTGATGG - Intergenic
987860234 5:23476903-23476925 ATAAATTAGCTGAAAGTTAATGG + Intergenic
987863803 5:23515949-23515971 AAAAAGAAGAATAAAGTTAAAGG - Intronic
987910447 5:24137028-24137050 ATAATGAAACTGGAAGTTGAGGG - Intronic
988031622 5:25770670-25770692 TAGAAGAAACAGAAAGTTGAGGG + Intergenic
988235161 5:28533940-28533962 AGCAAGAAGAAGAAAGTTGGAGG - Intergenic
988272884 5:29039987-29040009 AGAAAGAAGTAAAAAGTTGGTGG - Intergenic
988994117 5:36697965-36697987 CTAAAGAAGCATATAGTTGGTGG - Intergenic
989093403 5:37757829-37757851 ATAAAAAAGAAAAAAATTGAAGG - Intergenic
989264532 5:39457832-39457854 ATGAAGAGGCAGCAGGTTGATGG - Intronic
989416837 5:41188323-41188345 AGAAAGAAGGACAAAGTTCAAGG + Intronic
989563213 5:42874736-42874758 ATAAAGAAGCACAAGGCTGTTGG - Intronic
990219272 5:53569549-53569571 ATCAAGAAGCAGGAAGTTCTAGG - Intronic
990993695 5:61710107-61710129 ATCAAAAAGCACAAAGTTGGAGG + Intronic
991189984 5:63859352-63859374 AGAAACAAACACAAAGTTGAAGG + Intergenic
992011842 5:72535825-72535847 AAAAAGAAGAACACAGTTGAAGG + Intergenic
992203909 5:74411330-74411352 GAAAAGAAACAGAAAGTGGAAGG - Intergenic
992605021 5:78447314-78447336 AAAAAGAACAATAAAGTTGATGG + Intronic
992823179 5:80519121-80519143 AAAATGAAACAGAAACTTGAAGG + Intronic
992983027 5:82196830-82196852 AAAAAGAAGAACAAAGTTGGTGG - Intronic
993087793 5:83384970-83384992 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
993494540 5:88593106-88593128 ATAATGAGGCAGAAAGTGGAAGG + Intergenic
993721478 5:91325536-91325558 ATAAATGAGAAAAAAGTTGAAGG - Intergenic
994018803 5:95000588-95000610 TTAAAAAAGAAAAAAGTTGATGG + Intronic
994475241 5:100260142-100260164 AAAAAGAAGAATAAACTTGAGGG - Intergenic
994541061 5:101098008-101098030 TTGAAGAAGAATAAAGTTGATGG - Intergenic
994667369 5:102722222-102722244 ACAAAGAAGGAGAAATATGAAGG + Intergenic
994738790 5:103592783-103592805 TTAAAGAAGAACAAAGTTGGAGG - Intergenic
994868540 5:105313294-105313316 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
995167216 5:109058362-109058384 ATAAAGAAGAAAAAAGTAAAAGG + Intronic
995402815 5:111760651-111760673 AGAAAGAGTCAGCAAGTTGAAGG + Intronic
995735007 5:115290413-115290435 AAAAAGAAGAACAAAGTTGAAGG - Intronic
996149684 5:120020361-120020383 ATTTAGAAACAGAAAGTTCATGG + Intergenic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
997247166 5:132359561-132359583 ATAAAGAAAAAGAAAGTAGATGG - Intergenic
997719799 5:136068953-136068975 AAAAAGAAGAACAAAGTTGAAGG - Intergenic
997735126 5:136207626-136207648 AGCAGGAAGCAGAAAGGTGAAGG - Intergenic
997740651 5:136250509-136250531 AGAAAGATGTTGAAAGTTGAAGG - Intronic
998700594 5:144694467-144694489 AAAAAGAAGAACAAAGTTGAAGG + Intergenic
998853520 5:146373387-146373409 ACATAGATGCAGAAAGGTGAGGG + Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999363872 5:151008431-151008453 ATGAACAAACAGAAAGTTGTAGG + Intergenic
999382865 5:151133854-151133876 ATAAAGAAGTAGAAAGCTATGGG - Intronic
999804195 5:155066829-155066851 AAAAGGAAGCAGAGAGGTGAAGG - Intergenic
1000463925 5:161552301-161552323 ATAAAGGAGCAGATATTTCATGG + Intronic
1000832069 5:166114980-166115002 ATATAAAAGCAGAATGCTGAGGG - Intergenic
1000862511 5:166473356-166473378 AGAAAGAAGTAGAAATTGGAGGG + Intergenic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001426536 5:171626156-171626178 AAGAAGAAGAAGAAAGGTGAAGG - Intergenic
1002578112 5:180189428-180189450 AAAAAGTAGAACAAAGTTGAAGG + Intronic
1002863011 6:1096649-1096671 AAGAAGAAGAAGAAAATTGAGGG - Intergenic
1002880612 6:1248533-1248555 AAAAAGAAGAACAAATTTGAAGG + Intergenic
1002902518 6:1421596-1421618 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003189299 6:3859734-3859756 AAAAAGAAGAACAAAGTTGTAGG - Intergenic
1004893473 6:20124095-20124117 GTAAAGCAGTGGAAAGTTGAGGG - Intronic
1005260112 6:24050005-24050027 AAAAAGGAGGAGAGAGTTGATGG + Intergenic
1005558877 6:27017409-27017431 AGAAAGAAGAACAAAGTTGGAGG + Intergenic
1005610702 6:27521649-27521671 ATAATGAAAGAGAAAATTGATGG - Intergenic
1005621310 6:27623052-27623074 ATAAAGAAGCAGACAGTACAAGG + Intergenic
1005625049 6:27654427-27654449 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1005658094 6:27964579-27964601 ATAATGAAGGACAAAGTTGAAGG - Intergenic
1005780807 6:29189941-29189963 AGCAAGAAGGAGAAAGTTGGAGG - Intergenic
1006469183 6:34216948-34216970 AAAAAGAAGAATAAAGTTGGAGG - Intergenic
1007184400 6:39956013-39956035 AGAAACAAGAAGAAAGTTGGAGG + Intergenic
1008189145 6:48433029-48433051 ATAAAGAAAAAGAGATTTGATGG + Intergenic
1008237296 6:49065597-49065619 ATTAAGAATTAGAAAGTTTAAGG + Intergenic
1008238548 6:49079049-49079071 ATAAAGAAAAGCAAAGTTGAAGG - Intergenic
1009317333 6:62237513-62237535 ATCAAAAAGCAGAAACATGATGG + Intronic
1009777472 6:68223026-68223048 ATAAAGAAGCTGATAGCTGGAGG + Intergenic
1009860636 6:69326569-69326591 CTAAAGTATCAGAAAGTTTATGG + Intronic
1010126107 6:72433700-72433722 ATAAGGAAGAAGGAAGATGAGGG + Intergenic
1010618529 6:78044298-78044320 AAAAAGAAGAACAAAATTGAAGG - Intergenic
1011094654 6:83646640-83646662 TTGAAGAAGAACAAAGTTGAAGG - Intronic
1011113126 6:83860059-83860081 ATAAAGGACCAGAAAGAAGAGGG - Intronic
1011425828 6:87228864-87228886 ACAAAGAACAACAAAGTTGAAGG - Intronic
1011526826 6:88274903-88274925 AAAAAGAAGCAAAATTTTGATGG + Intergenic
1011853223 6:91656132-91656154 ATACAGATGCACAAAGTTGGTGG - Intergenic
1012044999 6:94262605-94262627 ATAAAGGAACAGAAAACTGAAGG + Intergenic
1012062667 6:94508930-94508952 AAAAAGAAAAAGAAAGGTGAGGG - Intergenic
1012735622 6:102937866-102937888 AAGAAGAAGAACAAAGTTGAAGG - Intergenic
1012760640 6:103295999-103296021 ATAATGATGTAGAAAGTAGAAGG - Intergenic
1013046505 6:106490787-106490809 CTAAGGGAGCAGAAAGTAGAAGG + Intergenic
1013349452 6:109292122-109292144 ACAAAGCAGCAGAGAATTGAAGG + Intergenic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1013944837 6:115709652-115709674 ATAAATACTCAGAAAGTTAATGG + Intergenic
1014134097 6:117867530-117867552 ATAAAGAAGGAGAGGTTTGATGG + Intergenic
1014397865 6:120948796-120948818 ATAAAGAGGAAGAAAGTAAAAGG - Intergenic
1014483377 6:121966682-121966704 AAAAAGAAGCATGAAGTTGGAGG - Intergenic
1014594028 6:123310579-123310601 TTAAAGAAAAAGAAAGGTGAAGG + Intronic
1014934503 6:127371668-127371690 ATAAATAACAAGAAATTTGAGGG - Intergenic
1015220443 6:130798588-130798610 AGAAAGAAGAAGAATGTTGAAGG - Intergenic
1015481579 6:133717013-133717035 AAAAAGAAGAATAAAGTTGGAGG + Intergenic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1015669319 6:135670496-135670518 AGAAAGAAGGACAAAGTTGGAGG + Intergenic
1016591361 6:145747976-145747998 AAAAAGAAGAACAAAGTTGCAGG + Intergenic
1016769992 6:147838584-147838606 ATCAAGGAACAAAAAGTTGAGGG - Intergenic
1016943527 6:149505651-149505673 ATGAAGAAGAAGAAAGCTGTTGG - Exonic
1017380073 6:153817924-153817946 ATGAAGAAGCAGAATCTTCAGGG + Intergenic
1017397655 6:154021399-154021421 TTGAAGAAGCACAAAGTTGGAGG - Intronic
1017624366 6:156333147-156333169 AAATAGAAGAACAAAGTTGAAGG - Intergenic
1018409631 6:163530924-163530946 ATAAAGAAAAAGAAAGCAGAGGG - Intronic
1018497861 6:164368641-164368663 ATAAAGAAGCTGAAAGAACAGGG - Intergenic
1018531073 6:164763883-164763905 ATAAAGAAAAAGAGATTTGATGG - Intergenic
1018579121 6:165292502-165292524 ACAAAAAAGCAGAAACTTAAGGG - Intronic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019053719 6:169204891-169204913 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1019092268 6:169548603-169548625 AAAGAGAAGAACAAAGTTGAAGG + Intronic
1019797435 7:3061892-3061914 AAAATGAAGAACAAAGTTGAAGG - Intergenic
1019797661 7:3063691-3063713 AGAAAGAAGAAGAAAGAAGAAGG - Intergenic
1019875236 7:3804505-3804527 AAAAAGAAGCAAAAAGTGGGAGG - Intronic
1020593560 7:10174082-10174104 AAAAAGAAGAAGAAAGTTGAAGG - Intergenic
1020663273 7:11007355-11007377 ATAAAAAATCACAAAGTTAAAGG - Intronic
1020923250 7:14291830-14291852 TTAAAGAAGCAAAATGTTCAGGG - Intronic
1021902911 7:25305223-25305245 ATAAAGGAGAAGGCAGTTGAAGG - Intergenic
1022032046 7:26500881-26500903 AAAATGAAGAACAAAGTTGAAGG - Intergenic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022233041 7:28432740-28432762 TTTAAAAAGAAGAAAGTTGAGGG - Intronic
1022646579 7:32235851-32235873 TTAAAGAAGAATAAAGTTGTAGG + Intronic
1022822818 7:33977972-33977994 ATGAAGAAGCAGCCAGTTGAGGG + Intronic
1022879255 7:34568689-34568711 TTAAACAATAAGAAAGTTGATGG + Intergenic
1022949604 7:35323612-35323634 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1023293898 7:38695047-38695069 ATAAAGAAAAAGAAGGTTAATGG + Intergenic
1023996831 7:45163706-45163728 ACAAAGGACCAGAAAGGTGAAGG + Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024432478 7:49304998-49305020 ATAAAGAAGAACAAGGTTAAAGG - Intergenic
1024844640 7:53628241-53628263 AGAAAGAAGAACAAAGTTGGAGG + Intergenic
1024909712 7:54432326-54432348 ATAAATAAGAACAAATTTGAAGG + Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025860661 7:65324350-65324372 AGAAAGAAGAAAACAGTTGAGGG - Intergenic
1026597463 7:71745984-71746006 ATAAGGAAGCAGAGATTTAATGG - Intergenic
1026792416 7:73342878-73342900 CTACAGCAGGAGAAAGTTGAAGG + Exonic
1026908263 7:74076651-74076673 AGAAAGAAGAACAAAGTTGGAGG + Intergenic
1027663476 7:81015980-81016002 ACAAAGATGTAGAAAATTGACGG + Intergenic
1027743578 7:82043813-82043835 TCAAAGAAGCAGAAAGTTACGGG + Intronic
1027768424 7:82375683-82375705 ATAAAGAAGTAGATTTTTGAGGG + Intronic
1027821540 7:83051756-83051778 AAGAAGAAGAAGAAAGTTGAAGG + Intronic
1028091172 7:86703715-86703737 AAAAAGAAATGGAAAGTTGACGG + Intronic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1028441954 7:90873689-90873711 CTAAAAAAGTGGAAAGTTGAAGG - Intronic
1028962457 7:96764358-96764380 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1030158788 7:106485676-106485698 ATAAAGGGGCTGACAGTTGAAGG + Intergenic
1030224529 7:107134546-107134568 AAAAAGAAGAACAAAGTTGCAGG + Intronic
1030295387 7:107920816-107920838 ATAAACAAGTGGAAAGTAGAGGG - Exonic
1030565970 7:111156437-111156459 AAAAAGAAGAATAAAGTTGGAGG - Intronic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1030814792 7:114022853-114022875 ATAGAAAAGCAGAAAGTCGCAGG - Intronic
1030940129 7:115636334-115636356 ACAAAGGAAAAGAAAGTTGAAGG + Intergenic
1030980140 7:116176552-116176574 ATACAGTAGCAGCAAATTGATGG - Intergenic
1031191640 7:118560330-118560352 AAAAAGAAGAACAAATTTGAAGG + Intergenic
1031219127 7:118941287-118941309 ACAAAGAGGCAGATTGTTGAGGG - Intergenic
1031291327 7:119939792-119939814 ATAAAGAAGAACAAATTTGAAGG - Intergenic
1031609252 7:123806072-123806094 CAAAAGAAACATAAAGTTGAAGG + Intergenic
1031614579 7:123865836-123865858 ATAAAGAAAAAGAGAGTTAATGG + Intronic
1031723406 7:125206322-125206344 ATTAAAAAATAGAAAGTTGAGGG + Intergenic
1032452759 7:132047413-132047435 ATAAAGAAATAGAAATTTAATGG - Intergenic
1032650824 7:133876508-133876530 AGAAAGAAGAAGAAAAATGAAGG - Intronic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1034013411 7:147555458-147555480 ATAAAAGAGCAGAAAGGTGAGGG + Intronic
1034272000 7:149807806-149807828 ATAAAGAAGGAGGAAATCGAAGG - Intergenic
1034545891 7:151789086-151789108 AAAAAGAAGAACAAAGTTGGAGG - Intronic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035188778 7:157146982-157147004 CTAAAGAAGAAGGAAGTCGAAGG - Intronic
1035822462 8:2608472-2608494 AAAAAGAAGGACATAGTTGAAGG - Intergenic
1036071598 8:5446552-5446574 CTGAAGAAGAACAAAGTTGAAGG + Intergenic
1037081011 8:14786662-14786684 ATAAACAAACAGAAAGTCTATGG + Intronic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1038033705 8:23667834-23667856 AAAAAGAAGAAGGAAGTTGAAGG - Intergenic
1038207454 8:25480568-25480590 ATGAGGAAAGAGAAAGTTGATGG + Intronic
1038330012 8:26600888-26600910 ATCAGGAAGCAGAAAGAAGAAGG - Intronic
1038789129 8:30651775-30651797 ATAAAAAAGAACTAAGTTGATGG + Intronic
1039133313 8:34292580-34292602 ACAAAGCAGCACAAACTTGATGG - Intergenic
1039134637 8:34307538-34307560 AGAAAGAAGAAAAAAGTTGGAGG + Intergenic
1039189944 8:34962473-34962495 ATAAATAAATAGAAGGTTGAAGG - Intergenic
1039338759 8:36623704-36623726 ATTCATGAGCAGAAAGTTGAAGG + Intergenic
1039378789 8:37065034-37065056 AAAAAGAAGAACAAAGCTGAAGG - Intergenic
1039901224 8:41753858-41753880 AGAAAGGAGCAGAGGGTTGAAGG - Intronic
1039969064 8:42306313-42306335 AAAAGGAAGGAGAAAGCTGAGGG - Intronic
1040773381 8:51008191-51008213 AAAAAAAAGAACAAAGTTGAAGG + Intergenic
1041025222 8:53678363-53678385 ATAAAGAAGTTGAAAGTAAAAGG + Intergenic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1041335470 8:56777313-56777335 ATAAGGAAACAGAAAATAGAAGG + Intergenic
1041470377 8:58201917-58201939 AAAAAGAAGAACAAAATTGAAGG + Intronic
1041647381 8:60267250-60267272 AGAAAGAGGCAGAAAATAGATGG + Intronic
1041709525 8:60880918-60880940 AAAAAGAAGAATAAAGTTGGAGG - Intergenic
1041743496 8:61181534-61181556 AGCAAAAAGAAGAAAGTTGAAGG + Intronic
1041827514 8:62113074-62113096 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1042573314 8:70191083-70191105 ATGATGAAGCTGAAAGTTTATGG - Intronic
1042836454 8:73083269-73083291 AAAGAGAATCAGAAAGTTGTAGG + Intronic
1043314410 8:78902210-78902232 ATAAAAAATAAGAAAGGTGATGG + Intergenic
1043323765 8:79024528-79024550 ATGAAGAGGAAGGAAGTTGAGGG + Intergenic
1043343014 8:79264647-79264669 ATAAAGAAACAGAAGTCTGAAGG + Intergenic
1043602378 8:81956001-81956023 TTAAAGGAGAAGAAAGTTTAGGG + Intergenic
1044181099 8:89195810-89195832 AAAAAGAAGCATAAGGTTGGAGG + Intergenic
1044536026 8:93357195-93357217 AAAAAAAAAAAGAAAGTTGAAGG - Intergenic
1044789052 8:95827413-95827435 AAAAAGAAGGAAAAAGTTGGAGG - Intergenic
1045144902 8:99330980-99331002 AGAATGAAGCTGAAAGGTGAAGG - Intronic
1045714843 8:105029618-105029640 TTAATGAAGCAGACAGTGGAGGG - Intronic
1045733716 8:105271191-105271213 ATAAGCAAGCAACAAGTTGAGGG - Intronic
1045790938 8:105983620-105983642 AATAAGAAGAACAAAGTTGAAGG + Intergenic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1046008742 8:108519313-108519335 AGAAAGCAGAACAAAGTTGAAGG - Intergenic
1046227495 8:111303520-111303542 GTAAAAAAGCAGACATTTGATGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046825528 8:118687273-118687295 ACAAAGAAGAATAAAGTTGGAGG - Intergenic
1046868977 8:119183429-119183451 AAAAAGGAGAAAAAAGTTGAAGG + Intronic
1046897833 8:119492202-119492224 ACAAAGAAGCTGAAAGCTGGGGG - Intergenic
1046919268 8:119710570-119710592 ATAAAGAAGAACAAAGTTGAAGG - Intergenic
1047155826 8:122317019-122317041 ATAAAGAAAGAGAAAGGTCATGG + Intergenic
1047364098 8:124196406-124196428 AGAGAAAAGCAGATAGTTGAGGG - Intergenic
1047983814 8:130212113-130212135 AAAGGGAAGCAGAAAGTTGCTGG + Intronic
1048645572 8:136415737-136415759 ATTCAGAAGCTGAGAGTTGAAGG - Intergenic
1048691196 8:136965516-136965538 TTAACGAAGAAGAAAATTGAAGG - Intergenic
1049179485 8:141214637-141214659 TTGAAGAAGAACAAAGTTGAGGG + Intronic
1049736442 8:144209240-144209262 TTGAAGAAGAATAAAGTTGAAGG - Intronic
1050327618 9:4512575-4512597 ATGAAAAAGAAGAAAGTTGGAGG + Intronic
1050516314 9:6447503-6447525 ATAAAGAAGCAGAAAATATGGGG + Intronic
1050707836 9:8423806-8423828 AAAAAAAAGCAGATGGTTGATGG - Intronic
1050748776 9:8911163-8911185 AAAAAGAACAACAAAGTTGAAGG + Intronic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1050942172 9:11473187-11473209 AAGAAGAAGAAGAAAGTAGAAGG + Intergenic
1051085947 9:13349259-13349281 ATAAAGAGTCAGAAATTAGATGG + Intergenic
1051267709 9:15324476-15324498 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1051342295 9:16122745-16122767 ATAAAGAAGAAGAAAACTCAGGG - Intergenic
1051427598 9:16949526-16949548 AAAAACAAGAACAAAGTTGAAGG + Intergenic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051803946 9:20969904-20969926 ATACAGAAAAACAAAGTTGAGGG - Intronic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1051898362 9:22011931-22011953 AGAAAGAAAGAGAAAGTTAATGG + Intronic
1051938663 9:22476382-22476404 AAAATGAAGCAGAAAAATGAAGG - Intergenic
1051990929 9:23152310-23152332 AGAAACAAGCAGAAATTTTAGGG - Intergenic
1052235274 9:26205794-26205816 AAAAAGAAGAAGAAAGTAGTTGG - Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053031143 9:34779565-34779587 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1053378318 9:37627218-37627240 ACAAAGAAGGAGGAAGATGAGGG - Intronic
1053775879 9:41538069-41538091 AAAAAGAGAGAGAAAGTTGAAGG + Intergenic
1054740266 9:68799445-68799467 AGAAAGAAGAGCAAAGTTGAAGG + Intronic
1055384948 9:75751114-75751136 AAACAGAAGAACAAAGTTGAAGG + Intergenic
1055722593 9:79192529-79192551 AAAAAGAAAAACAAAGTTGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056277713 9:85009337-85009359 AGAAAGAAGTAAACAGTTGAGGG - Intronic
1056546212 9:87616100-87616122 AGAAGGAAGCAGAAAGGTGAGGG - Intronic
1057664608 9:97035211-97035233 ATAAACAAACAAAAACTTGAAGG + Intronic
1058107784 9:100992639-100992661 AGAAAGAGGCAGAAATTTTATGG + Intergenic
1058391527 9:104500842-104500864 AAAAAGAAGAATAAAGTTGGAGG + Intergenic
1058469881 9:105266743-105266765 AAAAGGAAGCAAAAAGTTAAAGG - Intronic
1058502939 9:105640071-105640093 AGATAGAAACAGAAATTTGAGGG - Exonic
1058782442 9:108351889-108351911 ATACAGAAGGAGATAGGTGAGGG - Intergenic
1059016726 9:110525619-110525641 ATAAAGAAGAATACAGTAGAAGG + Intronic
1059594480 9:115703606-115703628 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1059608187 9:115859324-115859346 AGCAAGAAGAACAAAGTTGAAGG - Intergenic
1059614832 9:115938218-115938240 AAATAGAAGAAGAAAGATGATGG + Intergenic
1059625709 9:116063008-116063030 TTAAAGAAGGAGAAAAGTGAAGG - Intergenic
1060162587 9:121379057-121379079 TTGAAGAAGCACAAAGTTGGAGG + Intergenic
1060247083 9:121956262-121956284 CTAACGAAGGAGAAAGTTGCAGG - Intronic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1061329520 9:129883730-129883752 ATCAAGGAGCAGAAAGTTGCTGG - Intergenic
1061437236 9:130572091-130572113 AAAAAGAAGAACAAAGTTGAAGG + Intergenic
1185720871 X:2380410-2380432 ATAAGGAAGCAGGATGTTGAAGG + Intronic
1185954057 X:4469747-4469769 AGAAAGTAGCAGAAAGTACAAGG - Intergenic
1186106439 X:6212527-6212549 ATAAAGAGGTATAAAGTTGAAGG - Intronic
1187021624 X:15388449-15388471 ATGAAGAAGCAGAAGGTCAAAGG - Intronic
1187061112 X:15788151-15788173 GTCAAGAAGCAGAAAGGTAAAGG + Intergenic
1187129230 X:16485543-16485565 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1187194171 X:17066211-17066233 AAAAAGAAGAAAAAAGTTAAAGG - Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187438743 X:19297517-19297539 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1187629685 X:21155333-21155355 ATATAGATACAGAAGGTTGAAGG + Intergenic
1187766354 X:22646940-22646962 AAAAAAAAGAAGAAGGTTGAGGG + Intergenic
1188648880 X:32605102-32605124 AGCAAGAAGAATAAAGTTGAAGG + Intronic
1189736636 X:44077613-44077635 AAAAAGAAGAAAAAAGTTGGAGG + Intergenic
1189903407 X:45732456-45732478 AAAAAGAGGAATAAAGTTGATGG + Intergenic
1190412313 X:50149033-50149055 ATAAAGAAGTAGAAATTATAAGG + Intergenic
1190590954 X:52000363-52000385 AAAAAGAAGAGCAAAGTTGAAGG - Intergenic
1190618697 X:52264176-52264198 ATAAAGAAACACAAAATGGAAGG - Intergenic
1191628417 X:63294062-63294084 TTAAAAAAGCACAAAGCTGAGGG + Intergenic
1191855431 X:65621544-65621566 AAAAAGATGAAGAAAGTTGGAGG - Intronic
1191942598 X:66497545-66497567 ATAAAGAAAATGAAAATTGATGG + Intergenic
1192112193 X:68376477-68376499 ATAAAGAAAGAGAAAGATCATGG + Intronic
1192193091 X:69007086-69007108 CCAAAGAAGAACAAAGTTGAAGG - Intergenic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1192506471 X:71687558-71687580 ATAAAAAAGAATAAAGTTGAAGG - Intergenic
1192520226 X:71793988-71794010 ATAAAAAAGAATAAAGTTGAAGG + Intergenic
1192586507 X:72322857-72322879 AAAAAGAAGGACAAAGTTGGAGG - Intergenic
1192622379 X:72691346-72691368 TTAAAAAAGAAGAAAGTTGAAGG - Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193455114 X:81722318-81722340 AAAAAGAAGAATAAAGTTGGAGG + Intergenic
1193633985 X:83925595-83925617 AGAAAGAACCACAAAGTTGCAGG - Intergenic
1193789297 X:85799321-85799343 ATAAAGAATCAAAATATTGATGG - Intergenic
1193891942 X:87058523-87058545 ATAAAGAAGAACAAAATTGGAGG + Intergenic
1194052341 X:89086369-89086391 ATAAAGAAGAACAAAGTTGGAGG + Intergenic
1194062097 X:89216360-89216382 ATAAAGAAGCAAAACATTTATGG - Intergenic
1194692147 X:97000015-97000037 ATAAAGAAAAAGAAATTTAATGG - Intronic
1194850817 X:98866315-98866337 ATAAAGAAGCAGAGGTTTAATGG + Intergenic
1195204947 X:102588870-102588892 AAAAAGAAGAGCAAAGTTGAAGG - Intergenic
1195304593 X:103568075-103568097 AGAAAGAAGAACAAAGTTGGAGG + Intergenic
1195577338 X:106466763-106466785 ATCAAGAAGCAAAAATGTGAGGG - Intergenic
1195972242 X:110485865-110485887 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1196261059 X:113581981-113582003 AAAAATAAGCAAAAAGTAGATGG + Intergenic
1196265203 X:113635696-113635718 AAAAAGGAGAACAAAGTTGAAGG + Intergenic
1196675011 X:118410569-118410591 ATAAAGGAGCAGAAAGGTTCAGG - Intronic
1196689966 X:118548808-118548830 ATAAATTAGCACAAATTTGATGG - Intronic
1196732988 X:118960021-118960043 AAAAAGAAGAACAAAGTAGAAGG + Intergenic
1196805706 X:119583812-119583834 GGCAAGAAGGAGAAAGTTGAAGG + Exonic
1197080824 X:122413428-122413450 ATAAAGAAGAATAAAGTTGGTGG + Intergenic
1197116183 X:122836398-122836420 ATAAAGAACTAGAAATTTCATGG + Intergenic
1197242384 X:124133785-124133807 ATAGACAACCAGAAATTTGAGGG - Intronic
1197354132 X:125414686-125414708 ATAAAGAAAAACAAAGTGGAGGG - Intergenic
1197493529 X:127149320-127149342 AAAAAGAAGAAAAAATTTGAAGG + Intergenic
1197496419 X:127187856-127187878 AAAAAGAAGAACAAAGTTGGAGG - Intergenic
1197659936 X:129159481-129159503 ATGAAAAAGAACAAAGTTGAAGG - Intergenic
1197730329 X:129804303-129804325 AAAAAGAAGCAGACAGGAGAGGG + Exonic
1197730849 X:129808271-129808293 AAAAAGAAGTATAAAGTTGGAGG + Intronic
1197899195 X:131351230-131351252 AAAAAAAAGAACAAAGTTGAAGG + Intronic
1198390072 X:136165163-136165185 ATAAACAAGCAAAAACTGGAAGG - Intronic
1198451565 X:136771400-136771422 AAAATGAAGAACAAAGTTGAAGG + Intronic
1198513832 X:137383859-137383881 AAAAAGAAGAACAAAGTTGGAGG + Intergenic
1198652720 X:138880864-138880886 AAAAAGAAGAACAAAGTTGGAGG - Intronic
1198672458 X:139095741-139095763 ACAAAGATGCAGAAAGTGGTGGG - Intronic
1198697663 X:139359921-139359943 ATAAAGAAGTAGAATTTTGGAGG + Intergenic
1198818751 X:140622389-140622411 AAAAAGAAGAAGAAAGATGAAGG + Intergenic
1198885951 X:141337423-141337445 ATATAGAAACAGAGAGTAGAAGG - Intergenic
1198959272 X:142167101-142167123 ATAAAGTAACAGTAAGCTGATGG + Intergenic
1199334833 X:146606511-146606533 AGAAAAAGACAGAAAGTTGAGGG - Intergenic
1199704678 X:150413525-150413547 AAAAAGAAACAAACAGTTGAAGG + Intronic
1199884041 X:152001423-152001445 ACAAAGAAGAATAAAGTTGGAGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200716021 Y:6545653-6545675 ATAAAGAAGCAAAACATTTATGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201169722 Y:11246204-11246226 AAAAAGAAGCAGGAAGCTGGGGG - Intergenic
1201376330 Y:13324498-13324520 ATAAAGACTCAGAATGTTGGGGG + Intronic
1201479242 Y:14419983-14420005 AAAAAGAAGAACAAATTTGAAGG - Intergenic
1201798695 Y:17929000-17929022 ATAAAGAAAAAGAAAAATGAAGG - Intergenic
1201802858 Y:17976957-17976979 ATAAAGAAAAAGAAAAATGAAGG + Intergenic
1202597048 Y:26551234-26551256 ACAAAGAAGTACAAAGTTGGAGG - Intergenic