ID: 1001088860

View in Genome Browser
Species Human (GRCh38)
Location 5:168722162-168722184
Sequence CTTTGGGCAGAGAGTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 1, 2: 7, 3: 58, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001088860 Original CRISPR CTTTGGGCAGAGAGTGGGGA AGG Intronic
900126867 1:1072639-1072661 CTCTGGGGCGAGAGAGGGGAGGG - Intronic
900336807 1:2168395-2168417 CTTTGGGGAGCGGCTGGGGAAGG - Intronic
900628996 1:3624039-3624061 CTTCAGTCAGGGAGTGGGGATGG - Intergenic
900706203 1:4081929-4081951 GTTGGGGCAGAGTGAGGGGAGGG + Intergenic
900760308 1:4466092-4466114 CTGGGGGCAGAGGGTGGGCATGG + Intergenic
900916875 1:5645386-5645408 CAAAGGGCAGGGAGTGGGGAGGG + Intergenic
900951359 1:5859859-5859881 CTGTGGGCAGACAGTAGGGTGGG - Intergenic
901426356 1:9184063-9184085 CTCTGGACTGAGAGTGGGTATGG - Intergenic
901838773 1:11940676-11940698 CTTTGGGCAGTAGGTGGGGAGGG + Intronic
902489754 1:16772720-16772742 TTTTGGGCAGAGGATTGGGAAGG + Intronic
902778149 1:18687718-18687740 CTCTGGACACTGAGTGGGGAGGG - Intronic
903022874 1:20406127-20406149 GTTTGGGCAGCGAGGGGGTAGGG + Intergenic
903183698 1:21618053-21618075 CTCAGGGCTGAGAGTGCGGATGG + Intronic
903220381 1:21865921-21865943 GTTTGGGCAGGGAGGGGGGTGGG - Intronic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
904083398 1:27886322-27886344 CTTGGGGGTGAGAGTGGGGGTGG - Exonic
904268797 1:29334887-29334909 CTTTGGGGACTCAGTGGGGAAGG + Intergenic
904419272 1:30381152-30381174 CTTTGGGTTGAGACTGGGGGCGG - Intergenic
904619521 1:31766854-31766876 CCTGGGGCAGAGACTGGGCATGG + Intergenic
905008937 1:34733752-34733774 ATTGGTGAAGAGAGTGGGGAAGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905071158 1:35226538-35226560 TTTTGTGTAGAGATTGGGGAGGG + Intergenic
905075689 1:35268900-35268922 CCTTGCGCCGAGAGTGGGGAGGG - Intergenic
905476134 1:38229480-38229502 CATTCTGCAGAGAGTGGGGCAGG + Intergenic
905545982 1:38801121-38801143 CTTTGCTCAGAGATTGGGGCGGG - Intergenic
905726634 1:40258017-40258039 CTTTGGGCCGGAAGTGAGGAAGG + Intergenic
906202360 1:43968211-43968233 CTTTGGGCTGCAAGTGGGGTAGG + Intergenic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
908283848 1:62571900-62571922 CGTTGGGGGGAGTGTGGGGAAGG + Intronic
911525074 1:98974565-98974587 CTTCGTGAAGAGAGTGGGGATGG - Intronic
911724133 1:101223908-101223930 CTTTGGGAAGTGATTGAGGATGG + Intergenic
912760214 1:112359769-112359791 ATTTGGGCAGAGAGGAGGGATGG - Intergenic
913340755 1:117755744-117755766 CCTGGGGCAGGGGGTGGGGAGGG + Intergenic
914215456 1:145623688-145623710 TTTTGGGCTGAGAATGGGAAAGG - Exonic
914467406 1:147944072-147944094 TTTTGGGCTGAGAATGGGAAAGG - Exonic
915941402 1:160120767-160120789 CTTGGGGGAGATAGGGGGGATGG - Intronic
916734541 1:167596320-167596342 CTTTGTGGAGAGAGCAGGGAGGG + Intergenic
917664358 1:177209368-177209390 ATTAGGGCAGAGAGTGAGGATGG + Intronic
918493932 1:185112815-185112837 GTTTGGGCATAGAGTGGGATTGG + Intergenic
919980608 1:202640619-202640641 GGTGTGGCAGAGAGTGGGGAAGG + Intronic
920293952 1:204944445-204944467 TTTTGGGCAGAGGGGTGGGAGGG + Intronic
920387774 1:205580533-205580555 CATGGGGCAGAGGGTGGGGCTGG + Intronic
920671235 1:208004973-208004995 CCTTGGGGAGACCGTGGGGAAGG - Intergenic
921299046 1:213732805-213732827 CTAGGGGCTGAGATTGGGGAGGG - Intergenic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
921898892 1:220429460-220429482 TGTGGGGAAGAGAGTGGGGAAGG + Intergenic
922205611 1:223443523-223443545 CTGTGGGCAGAGGGTATGGATGG + Intergenic
922989836 1:229897164-229897186 CTTTAGGCTGAGAGTGGGCTGGG + Intergenic
923097128 1:230784508-230784530 CTTTGAGCAGAGACTGGAGCTGG - Intronic
923110913 1:230889269-230889291 CCATGGACAGAGGGTGGGGAGGG + Intergenic
923245799 1:232130914-232130936 CTTTAGGCAAACAGTAGGGAAGG + Intergenic
923530688 1:234809808-234809830 TTTTGGGCAGAGGATTGGGAAGG - Intergenic
923714542 1:236413777-236413799 CTTTGTGCAGTCAGTAGGGAAGG + Intronic
923765446 1:236888907-236888929 TCTTGGGCAGGGGGTGGGGATGG + Intronic
923884593 1:238140535-238140557 CTATGGGCAGGGAGAGGGCAGGG + Intergenic
924033464 1:239910731-239910753 GTTTGGGGAGAGGGAGGGGAGGG + Exonic
924039913 1:239974269-239974291 CTTTGGTGTGAGGGTGGGGATGG + Intergenic
924146375 1:241079805-241079827 CTATGGGGTGAGGGTGGGGATGG - Intronic
924454159 1:244204790-244204812 CTTTGGTCAGTCACTGGGGAAGG + Intergenic
924534568 1:244923880-244923902 CTCTGGGCAGTGGGTTGGGAAGG - Intergenic
924875745 1:248102208-248102230 CTTAGGTCAGAGAGCTGGGAAGG + Intergenic
1064116395 10:12581036-12581058 CTTGGGGGAAAGGGTGGGGATGG - Intronic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1064648306 10:17482599-17482621 CATGGGGCAGTGAGTGAGGAAGG + Intergenic
1065177710 10:23095479-23095501 GTGTGGGCGGAGCGTGGGGAGGG + Intergenic
1065961658 10:30738746-30738768 CTTTGGACAGAGTCTGTGGAAGG + Intergenic
1066496974 10:35951652-35951674 ATATCGACAGAGAGTGGGGAGGG + Intergenic
1066694967 10:38069238-38069260 CATTGGGCAGTGAGTGGGCAGGG - Intergenic
1066997543 10:42577941-42577963 CATTAGGCAGTGAGTGGGCAGGG + Intronic
1067063440 10:43089905-43089927 CTTGGGGCAGAGATCGGGGCTGG + Intronic
1067564326 10:47325912-47325934 CTTTGGGTGGGGTGTGGGGAGGG - Exonic
1068011532 10:51457410-51457432 CTTTGGGGACTCAGTGGGGAGGG + Intronic
1068774295 10:60854299-60854321 CTTAGGGCTGGGAGTGGGGATGG + Intergenic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069557379 10:69407048-69407070 CTGAGGGCAGAGGGTGGGGCTGG + Intronic
1070597784 10:77844858-77844880 CACTGGGCAGAGAGGGGGGCAGG + Intronic
1071564871 10:86666637-86666659 CACTGGGGAGTGAGTGGGGATGG - Intronic
1073006573 10:100329787-100329809 TTTTGGGCAGGGGGTGGGGGTGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073498427 10:103915281-103915303 CTTTGGGAAGGGAGTGGGGCTGG - Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1075280681 10:121135667-121135689 CTGTGGGCGGAGTGTGGGGTGGG + Intergenic
1075382399 10:122029905-122029927 CGGTGGGCAGGGGGTGGGGAGGG + Intronic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1075719149 10:124574876-124574898 CCCTGGGGAGAGAGTGGAGAAGG - Intronic
1075980280 10:126732498-126732520 CTATGGGATGCGAGTGGGGAGGG - Intergenic
1076058064 10:127391792-127391814 CTTGGGGAGGAGAGTGGGTAGGG - Intronic
1076444083 10:130500083-130500105 AGGTGGGCAGAGTGTGGGGATGG + Intergenic
1076542958 10:131225742-131225764 CTGTGTGCAGGGAGTTGGGAGGG - Intronic
1076688138 10:132207392-132207414 CTTGGGGCAGCCAGTGGGGTGGG - Intergenic
1076799039 10:132812253-132812275 CTTTTGGCAGGAGGTGGGGATGG - Intronic
1076819235 10:132930533-132930555 CTGTGTGCGGAGTGTGGGGAAGG - Intronic
1077612066 11:3649432-3649454 CATTGGGCAGAGACTAGGGAGGG - Intronic
1077766503 11:5164499-5164521 CATTGGGAAGAGACTAGGGAGGG + Intronic
1078386371 11:10896481-10896503 CATGGGGCTGAGAGTGGGGAAGG + Intergenic
1081606756 11:44531965-44531987 CTATGGACAGAGCGTGGGGCAGG + Intergenic
1082565799 11:54676771-54676793 GATGGGGAAGAGAGTGGGGAGGG - Intergenic
1082728891 11:56771055-56771077 CTCTGGGGAAAGAGTGGGAAGGG - Intergenic
1083064039 11:59905201-59905223 CTTGGGGCGAAGAGTGGGGAGGG - Intergenic
1083234199 11:61341533-61341555 GCTGGGGAAGAGAGTGGGGAAGG + Intronic
1083430961 11:62613263-62613285 CCTTGGGCAGAGATGGGAGATGG + Exonic
1083488047 11:62995820-62995842 CTTCGGGCAGAGGAGGGGGAGGG + Intronic
1083877627 11:65532634-65532656 CTATGGGGATAGAGTGGGAAGGG + Intronic
1084012943 11:66362793-66362815 CTTCGGTGAGAGAGTGGGTATGG + Exonic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1085325537 11:75603581-75603603 CCTGGGGCAGTGAGTGGGGGCGG + Intronic
1085513951 11:77101749-77101771 AGTTGGGGAGAGAGTGGGGATGG - Intronic
1085737697 11:79053685-79053707 CTTTGGGGAGAGTTTTGGGAAGG + Intronic
1086594862 11:88558521-88558543 CTAAGGGGAGAGAGTGGGAAAGG + Intronic
1087102725 11:94380774-94380796 CTGGGGGCAGGAAGTGGGGAGGG + Intronic
1087942432 11:104115045-104115067 CTCAGGGAAGAGGGTGGGGAGGG - Intronic
1088544726 11:110947806-110947828 CTCTAAGAAGAGAGTGGGGAAGG + Intergenic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089147081 11:116336889-116336911 GTTTGGGATGAGAGTGGGGTGGG - Intergenic
1089888123 11:121849637-121849659 GTTTGGGGAGAGAGTGAGGGTGG + Intergenic
1090221115 11:125026885-125026907 CTTTGGGGGAAGAGTGGGAAGGG - Intronic
1090489726 11:127148086-127148108 CTTTAGGCAGTGAGTGTGAATGG + Intergenic
1090634143 11:128678848-128678870 CTCTGGTCAGAGCTTGGGGAGGG + Intergenic
1090880392 11:130827587-130827609 CTTTGGGAAGAGTGTGTGGGGGG + Intergenic
1091088405 11:132746068-132746090 CTTTGTGAAGAGCTTGGGGAGGG - Intronic
1091259833 11:134225137-134225159 CTTCGGGCAGAGCGTGGAGGTGG + Exonic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091334417 11:134755596-134755618 GTTTGGGTAGAGCATGGGGACGG + Intergenic
1091362336 11:134987535-134987557 CCTGGGGCGGAGGGTGGGGAGGG - Intergenic
1091454691 12:598352-598374 CTCTGGGCAGAGGGAGGGCAAGG - Intronic
1091692270 12:2605351-2605373 CTTAGGGCAGACACTTGGGATGG - Intronic
1091983891 12:4891812-4891834 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1091999579 12:5021238-5021260 CTTTGGGCAGACAGAGGGGAGGG - Intergenic
1092230361 12:6772682-6772704 CCTTGGAGAGAGGGTGGGGAGGG - Exonic
1093079400 12:14791966-14791988 CTTTGGGGACTCAGTGGGGAAGG + Intronic
1093080929 12:14810161-14810183 CCTTGGGTGGGGAGTGGGGAGGG + Intronic
1093578703 12:20764922-20764944 CATTGGGCAGAGACTAGGAAGGG - Intergenic
1093584632 12:20821168-20821190 CATTGGGCAGAGACTAGGAAGGG + Intronic
1093601704 12:21034251-21034273 GTTTGGGGGGAAAGTGGGGATGG - Intronic
1093812964 12:23510227-23510249 CTGTGAGCAGAGACTAGGGAGGG + Intergenic
1094120495 12:26969057-26969079 TTTAGGGGAGAGAGTGAGGAGGG + Intergenic
1094304545 12:29003241-29003263 CTTGAGGCAGAGTGTGGGAATGG + Intergenic
1094317065 12:29146484-29146506 CTTTAGGCAGACAGTAAGGAAGG - Intergenic
1094480059 12:30874543-30874565 CTGGGGGCAGTGAGTGGGGTGGG - Intergenic
1094798988 12:34008465-34008487 CTTGGGGGAGAGTGTAGGGAGGG - Intergenic
1095111007 12:38295005-38295027 CCTTGGGCAGAGACTGTGGCAGG - Intergenic
1095776427 12:46015518-46015540 CTTTGGGGACTCAGTGGGGAGGG - Intergenic
1096215656 12:49796349-49796371 CTTCGGGCCAACAGTGGGGAGGG + Exonic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1096460178 12:51818112-51818134 CCAGGGGCAGGGAGTGGGGAGGG - Intergenic
1096739874 12:53685263-53685285 CTTGGGGGTGATAGTGGGGATGG + Intergenic
1096809939 12:54162802-54162824 CTTTGGCCATGGGGTGGGGAGGG - Intergenic
1096968471 12:55647217-55647239 CGCAGAGCAGAGAGTGGGGAGGG + Intergenic
1097125880 12:56774498-56774520 CCATGGACAGGGAGTGGGGATGG + Intronic
1097650518 12:62292404-62292426 CTCTAGGCAGAGAGTGGGACAGG + Intronic
1100593236 12:96049100-96049122 CTTTGGGAACAGAGTGAGAAAGG - Intergenic
1101058386 12:100944491-100944513 CTTTTGGGGGAAAGTGGGGAGGG - Intronic
1101926207 12:108973313-108973335 CCGAGGGCAGGGAGTGGGGATGG + Intronic
1102163531 12:110788072-110788094 CTTTGGGGAGAGAATGGAGCAGG + Intergenic
1102248258 12:111368716-111368738 CTATGGGCTGAGAGAGGGGAGGG + Intronic
1102549064 12:113677839-113677861 TTTTTGGCAGAGAGTGAGGGCGG + Intergenic
1103006327 12:117423251-117423273 CTTTGGCCAGTCATTGGGGATGG + Intronic
1103774168 12:123353161-123353183 TTTTGGGCAGGGAGTGAGGAAGG + Intronic
1104079555 12:125417935-125417957 GCTTGGGCAGAGAGTGGGGGAGG + Intronic
1104484673 12:129140412-129140434 CTGTGGTCAGGGATTGGGGAGGG - Intronic
1106314617 13:28582433-28582455 CTTAGGGCAGAGTGGGGGAAAGG - Intergenic
1107511600 13:41091202-41091224 CTTTGGGGATTCAGTGGGGAAGG + Intergenic
1107786493 13:43962997-43963019 CATTGGGCAGAGGGTGGGGAAGG - Intergenic
1110719711 13:78747536-78747558 TTATGGGCAGGGATTGGGGATGG + Intergenic
1110926142 13:81154534-81154556 TTTTGGGGGGAGAATGGGGAAGG - Intergenic
1111657776 13:91174834-91174856 CTTTGGAAAGACACTGGGGATGG - Intergenic
1111885042 13:94009742-94009764 CTGTGGGCAGAGAATGGAAATGG + Intronic
1111941489 13:94613234-94613256 CATTGGCCATAGAGTGGGGTGGG + Intronic
1112094433 13:96116531-96116553 GTTTGGGAATGGAGTGGGGATGG - Intronic
1112537258 13:100271546-100271568 CCTTGGCCAGAAAATGGGGAAGG + Intronic
1112683844 13:101799689-101799711 CTTTGGGAAGGAAGTGGGAAGGG - Intronic
1112746099 13:102528858-102528880 CTTTGGGCAGAGATGTGGGAAGG - Intergenic
1113772405 13:112918496-112918518 CCATGGGGAGAGAGTAGGGAGGG + Intronic
1113801278 13:113087684-113087706 CTGCGAGCAGAGAGTGGAGATGG - Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117251661 14:53946104-53946126 CTTTGGAGAGGGAGTGGGGGCGG + Intergenic
1117268433 14:54115326-54115348 CTTTGAGAAGAGAGTGGAGTGGG - Intergenic
1117469734 14:56030935-56030957 CTTTTCCCAGAGAGTGAGGAGGG - Intergenic
1117720672 14:58625908-58625930 CTTTGGGAAGAGAAGCGGGATGG + Intergenic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1118835350 14:69473954-69473976 CTAGGGGCAGAGGGTGGGAATGG + Intergenic
1119380312 14:74224208-74224230 CCTTGAGCAGAAGGTGGGGAGGG - Intergenic
1119380352 14:74224404-74224426 CTGAGGGGAGAGGGTGGGGAGGG + Intergenic
1121112412 14:91321347-91321369 CTTGGGGCAGAGAGTGGAAGTGG - Intronic
1121670259 14:95704280-95704302 CTTTGGAGAGAGAGAGGGGTGGG + Intergenic
1121978930 14:98436117-98436139 CGTGGGGAAGAGGGTGGGGAAGG - Intergenic
1121979750 14:98444223-98444245 CTCTGGGCAGGAAGTGGGGGTGG + Intergenic
1122012057 14:98758580-98758602 CCTAGGGCAGAGAGTGGTCAGGG - Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122125057 14:99574464-99574486 CTGTGAGGAGTGAGTGGGGATGG - Intronic
1122448539 14:101784748-101784770 CTTTGGGCAGAAAGAAGGGTGGG + Intronic
1122792680 14:104190937-104190959 CTGGGGGCAGAGGGTGGGGCTGG + Intergenic
1122817527 14:104320935-104320957 CTCTCGGCAGAGGCTGGGGAAGG + Intergenic
1202863850 14_GL000225v1_random:103037-103059 CTTTGGGCAGAGGGTAGACAAGG - Intergenic
1124156805 15:27233146-27233168 CACTGGGGAGAGGGTGGGGAAGG + Intronic
1124496305 15:30189438-30189460 GGTGTGGCAGAGAGTGGGGAAGG + Intergenic
1124747269 15:32349209-32349231 GGTGTGGCAGAGAGTGGGGAAGG - Intergenic
1125396021 15:39248817-39248839 CTTTGGGAAGAGAAAGGTGAAGG + Intergenic
1125492632 15:40159621-40159643 CTTGGGACTGAGAGAGGGGAAGG - Intergenic
1125676534 15:41505156-41505178 CCTTGGGGAGGGAGTTGGGATGG + Intronic
1125911069 15:43439732-43439754 CTTTGAGCAGAGGGTTGGAATGG - Intronic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1126867745 15:52954702-52954724 CTCTGGAAAGAGACTGGGGAAGG - Intergenic
1127314815 15:57784990-57785012 CTCTGGGCTGAGAATAGGGAAGG + Intergenic
1127315207 15:57788473-57788495 CACTGGGCAGAGCTTGGGGATGG + Intergenic
1127729332 15:61784087-61784109 CTTTGGGGACTCAGTGGGGAAGG + Intergenic
1128009900 15:64283001-64283023 CTTTGGGCAGAAGGGTGGGAGGG + Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128599713 15:68985661-68985683 CTTCGTCCAAAGAGTGGGGAGGG - Intronic
1128797647 15:70477311-70477333 CTATGGGGAGGGAATGGGGAGGG - Intergenic
1128818291 15:70630023-70630045 CTATGTGCAGAGAGCCGGGATGG - Intergenic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129386967 15:75201764-75201786 CTGTGGGCAGCGGGTGCGGAGGG - Intronic
1129515072 15:76152317-76152339 CTGAGGGCAGAGTGTGGGCAGGG + Intronic
1130295374 15:82644026-82644048 TTTTGTGCAGAGGGTTGGGAGGG + Intronic
1131255756 15:90860908-90860930 CCTGGGGCAGAGAGTGGAAAGGG - Intergenic
1132120245 15:99169579-99169601 CAGTGAGCAGGGAGTGGGGAGGG + Intronic
1132246697 15:100302080-100302102 CTTAGGCCTGAGGGTGGGGAAGG - Intronic
1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG + Intergenic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1132957317 16:2601808-2601830 CTGTGGGCAGGGAGTTGGGGGGG - Exonic
1133776231 16:8897398-8897420 CATTGTGCTGAGAGTTGGGAAGG - Intronic
1134465038 16:14468173-14468195 ATTTGGGAAGAGAGAGAGGAGGG + Intronic
1135171417 16:20187275-20187297 CTTAGGGCTGAGAGGGTGGAGGG - Intergenic
1136079554 16:27842735-27842757 AATTGAGCAGAGAGTGGAGATGG + Intronic
1137821493 16:51449670-51449692 ATTTGGGCAGACTGTGGGGGAGG - Intergenic
1138122006 16:54407965-54407987 CTATGGGAAGAGAATGTGGATGG - Intergenic
1138297895 16:55902326-55902348 TTGTGGGGGGAGAGTGGGGATGG - Intronic
1138488845 16:57364352-57364374 CTTTTGGCAGGGAGAGGGGAGGG - Exonic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1138987152 16:62343608-62343630 GTTTGGGCATAGAGCAGGGAAGG - Intergenic
1139085743 16:63583518-63583540 GGTAGGGCAGAGAGTGAGGATGG + Intergenic
1139491559 16:67288701-67288723 CTTTGGGTAGAGCTTGGGGTGGG + Intronic
1140019981 16:71229725-71229747 CTATGGGCTGGAAGTGGGGAAGG + Intronic
1140232473 16:73129024-73129046 CCTTTGGAAGAGTGTGGGGAAGG - Intronic
1140447801 16:75045390-75045412 CCTTAGGCATAGAGAGGGGATGG + Intronic
1140899635 16:79355793-79355815 CTATGGGCGGCGTGTGGGGAGGG + Intergenic
1140901519 16:79372234-79372256 CCTTGAGCAGAGGGTGAGGATGG + Intergenic
1141272092 16:82550177-82550199 CTCTGTGTAGAGAGTGGGTATGG + Intergenic
1141455280 16:84137224-84137246 TTCTGGGCAGAGAGGAGGGAAGG + Intronic
1141518838 16:84564150-84564172 TTTGGGGCAGGGAGTGGGGTGGG + Intergenic
1142223511 16:88866467-88866489 CTGGGGCCAGAGGGTGGGGAAGG - Exonic
1142281373 16:89149724-89149746 TTCTGGGCACAGAATGGGGAGGG + Intronic
1142572212 17:882412-882434 GTTGGGGCAGAGACGGGGGAGGG - Intronic
1142923930 17:3216088-3216110 CTGTGAGCAGAGTGTGGGGGAGG - Exonic
1142968582 17:3596273-3596295 CTTTGGGCAGAGAGAGGAGCAGG - Intronic
1143057845 17:4175792-4175814 CTGGGAGGAGAGAGTGGGGAAGG + Intronic
1143419160 17:6775836-6775858 CTTTGGGCAGGGAGAGTGGCTGG + Intergenic
1143612636 17:8028420-8028442 ATGTGGGCTGAGAATGGGGAAGG + Intergenic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1143644978 17:8224103-8224125 CCCTGGACAGACAGTGGGGAAGG + Intergenic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1143883295 17:10046948-10046970 TTATGGGCAGAGAGTGGTGAAGG - Intronic
1143943522 17:10568502-10568524 CTTAGGGAAGAGAGTGGGACTGG + Intergenic
1144180191 17:12744464-12744486 CTGTGGGCAGAGGTTGGGAAGGG + Intronic
1144383824 17:14730277-14730299 CTTTTGGGAGAGAGGGTGGAGGG - Intergenic
1144405499 17:14949107-14949129 CATTGGGCAAAGTGTGGAGAAGG - Intergenic
1144754262 17:17669775-17669797 GCTGGGGCAGGGAGTGGGGAAGG - Intergenic
1145921697 17:28614570-28614592 CTTAGCACAGAGACTGGGGAGGG + Exonic
1145993253 17:29091753-29091775 CCTTGGGCAGGGAATGGGGCAGG - Intronic
1146622639 17:34411432-34411454 GGTTGGGAAGAGAATGGGGATGG + Intergenic
1146723170 17:35137473-35137495 CATTGGGCAGGGAAAGGGGATGG + Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1146891296 17:36508083-36508105 CCTTGGGTGGAGGGTGGGGAAGG - Intronic
1147018665 17:37512931-37512953 ATTTGAGAAGAGAGTGGAGAGGG - Exonic
1147122056 17:38341390-38341412 GCTTGGGCAGAGAGAGGAGATGG - Intronic
1147139232 17:38452237-38452259 CTGGGGGCAGAGGGAGGGGAAGG - Intronic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147616998 17:41835744-41835766 CTTGGGGCAGAGAGCTAGGAGGG + Intronic
1147619922 17:41859125-41859147 CTTTGGGCAGCCAGAGGGGATGG + Intronic
1147703722 17:42411931-42411953 CAGTGGGCAGTGACTGGGGATGG + Intronic
1147966710 17:44198194-44198216 CTTTGGGCAGCGAGGTGGGGAGG - Intronic
1148152906 17:45406789-45406811 TTCTGGGCTGAGAGTGGGGTGGG - Intronic
1148427265 17:47610148-47610170 GGTGGGGCTGAGAGTGGGGAGGG - Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148804997 17:50259591-50259613 CTTGGGGCAGGGAGTGGGCTTGG - Intergenic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1148865033 17:50623972-50623994 CATTGGGCAGAGAGTGCGTTCGG - Exonic
1149627453 17:58089829-58089851 CTTGGGGCGGAGGGTGGGGTGGG + Exonic
1149774861 17:59349324-59349346 CTGTGGGCTGAGAAAGGGGAGGG - Intronic
1150250577 17:63702157-63702179 CTTTGGGCAGTGAGAGGCTAAGG - Intergenic
1150327577 17:64269154-64269176 CTCTGTGCAGAGTGTTGGGAAGG - Intergenic
1150630620 17:66877782-66877804 CTGGGAGCAGAGTGTGGGGAAGG - Intronic
1150980352 17:70134299-70134321 TTTTGGGGGGAGGGTGGGGAGGG + Exonic
1151217943 17:72590884-72590906 GTGGGGGCAGAGGGTGGGGAAGG + Intergenic
1151418912 17:73984830-73984852 GTTGGAGCAGAGGGTGGGGAGGG - Intergenic
1151878780 17:76882128-76882150 CTGTGGGCAGAGTGTGGGTATGG - Intronic
1152168856 17:78729889-78729911 CTGTGGAAAGAGAGTGGGGGAGG + Intronic
1152248513 17:79199152-79199174 CTGTGGTCATAGGGTGGGGATGG + Intronic
1153572492 18:6487233-6487255 CCTTGGGGAAAGAGTGGGGCGGG - Intergenic
1154313801 18:13287598-13287620 CTGAGGGCAGACAGTGGAGAAGG - Intronic
1155291380 18:24345764-24345786 CTTTAGACAGTGAGTGAGGAAGG - Intronic
1156199900 18:34818812-34818834 TTTTCTGCAGAGGGTGGGGAGGG + Intronic
1156359887 18:36375640-36375662 CTTTGGGATGAGAGTGTGGTGGG + Intronic
1156398938 18:36723560-36723582 CTTTTGGCAGGGAGCGAGGAGGG + Intronic
1156867152 18:41901625-41901647 CTTTGGCGAGAGAGTGTGGAGGG + Intergenic
1156987920 18:43371052-43371074 CCTTGGGAATAGAGTGGGAAGGG + Intergenic
1157208592 18:45721492-45721514 ATTTGGGCAGAGTATGAGGAGGG + Intergenic
1157297944 18:46459506-46459528 CCTGGGGCAGAGAATTGGGAGGG - Exonic
1157676785 18:49574550-49574572 GTTGGGGGAGAGAGTGGGTAAGG - Intronic
1157819276 18:50753565-50753587 CCTATGGCAGGGAGTGGGGAAGG + Intergenic
1158198154 18:54910836-54910858 CTTTGCTCCGAGATTGGGGAGGG + Intronic
1159493944 18:69176144-69176166 AGTTGGGCAGAAAGTGGAGAAGG - Intergenic
1159564528 18:70033367-70033389 CTGTGGTCTGAGAGTGTGGATGG - Intronic
1159975829 18:74711224-74711246 CTTTGGGGAGTGTGAGGGGAGGG - Intronic
1160189574 18:76704366-76704388 GGTTGGGCAGCGAGTGGGCATGG - Intergenic
1160715499 19:574685-574707 CCTTGGGCAGAGGCTGGGGAGGG + Intronic
1160961064 19:1721035-1721057 CTTTGGGGAGAGGGTGAGGGAGG - Intergenic
1161502251 19:4622811-4622833 CCTTGGGCAGAGGGGAGGGAAGG + Intergenic
1161777834 19:6273380-6273402 GTGTGGGAAGAAAGTGGGGATGG + Intronic
1162241983 19:9362672-9362694 CTTTGGTCAGGAAGAGGGGAGGG + Intronic
1162585183 19:11553969-11553991 CTTTTTCCAGAGGGTGGGGAGGG - Intronic
1163746607 19:19052470-19052492 CCAGGGGCTGAGAGTGGGGAAGG + Intronic
1164868152 19:31622148-31622170 CATTGGAAAGAGAGAGGGGATGG + Intergenic
1165069365 19:33246945-33246967 CTCTGGGCAGAGGCAGGGGATGG + Intergenic
1165358072 19:35316374-35316396 CATGGGCCTGAGAGTGGGGAGGG - Intergenic
1165723185 19:38093940-38093962 CACTGGGGACAGAGTGGGGATGG + Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166101809 19:40575932-40575954 CCTAGGGCAGAGAGGGGGGCAGG - Exonic
1166141032 19:40805327-40805349 CTTTGGGCAGAGGGTGGGACAGG + Intronic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1166690600 19:44819768-44819790 CTTGGGGTTGAGGGTGGGGATGG - Intronic
1166817749 19:45557069-45557091 CAGTGGCCAGAGAGTGGTGAGGG + Intronic
1167124830 19:47542289-47542311 GTTCTGGCAAAGAGTGGGGATGG + Intronic
1167298819 19:48667501-48667523 ATTTGGCCAAAGAATGGGGATGG + Intronic
1168002847 19:53463266-53463288 TTCTGGACAGAGAGCGGGGACGG + Intergenic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168156021 19:54473253-54473275 CTCTGGGCGGAGTGTGGGGGCGG + Exonic
1168288135 19:55344585-55344607 ATTTGGGCAGGGAGTGTGGCAGG + Intronic
926396894 2:12452838-12452860 CCTGGGGCAGGTAGTGGGGAGGG - Intergenic
926627814 2:15107844-15107866 CTTGGGGCCAGGAGTGGGGATGG - Intergenic
926717115 2:15933448-15933470 TTTGGGGCAGAGAATGGGTAGGG + Intergenic
926751873 2:16204499-16204521 TTTTGAGAAGACAGTGGGGATGG + Intergenic
927337585 2:21942898-21942920 CTTTGGGAAGTGGGTGGGCAAGG + Intergenic
927642198 2:24852444-24852466 CTTAGGCCACAGGGTGGGGAGGG - Intronic
929480208 2:42299465-42299487 CTTAGGTCAGATAGTGGTGATGG - Intronic
930234487 2:48875668-48875690 CTTTAGGTAGAGATGGGGGAAGG + Intergenic
931514880 2:63044602-63044624 GTTTGGGGTGAGAGTGGGGGTGG + Intronic
931634932 2:64332547-64332569 TGTAGGGCAAAGAGTGGGGAAGG + Intergenic
931683388 2:64771205-64771227 CTAAGGTCACAGAGTGGGGAAGG - Intergenic
931758985 2:65399813-65399835 CTTGGGGGAAAGGGTGGGGATGG + Intronic
931795397 2:65703404-65703426 CCTTGGGTAGAGAGTGGGACTGG + Intergenic
931868408 2:66434853-66434875 CTTTGGGGAGAGAGTCTGCAGGG + Intronic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932224940 2:70032074-70032096 ATCTGGTCTGAGAGTGGGGAAGG + Intergenic
933209091 2:79545298-79545320 CTATGGACAGGGAGTGGGGAAGG - Intronic
933778986 2:85788482-85788504 CTTTGGGCTGGGACTGGTGATGG - Intergenic
934557249 2:95294017-95294039 CTTGGGGCAGGCAGTGGGCATGG - Intergenic
934691658 2:96365398-96365420 CTTCGGGCAGGGGGTGGGGTGGG - Intronic
935126701 2:100230774-100230796 CCTTGGGGAGAGAGTGTGAATGG - Intergenic
935290816 2:101609626-101609648 CTTGGGGCAGGGATTGGGTAAGG - Intergenic
936651605 2:114433567-114433589 CTATGGGCATAGAGTGGGGAGGG + Intergenic
936826406 2:116587114-116587136 TTTTTGGAAGAGAGTGGGGAGGG + Intergenic
937340798 2:121089191-121089213 GGTGGGGCAGAGACTGGGGAAGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938387482 2:130877220-130877242 CATGGGGCAGAAAGTGGAGAGGG + Intronic
938785919 2:134629630-134629652 GTTTGGGCAGAGATTGGAGAGGG - Intronic
939241652 2:139568654-139568676 GTTTGGGGGGAAAGTGGGGATGG + Intergenic
941885503 2:170523442-170523464 TTTTGGGCAGAGGGTGGGGTGGG + Intronic
941936016 2:170981839-170981861 CATTGGGCACAGACTAGGGAGGG + Intergenic
942285945 2:174416178-174416200 TTTGGGGCAGATAGTGGGGCTGG - Intronic
944423947 2:199559971-199559993 CTTGGGGCAGAGGTTAGGGAGGG - Intergenic
945041227 2:205745397-205745419 CTTTGGCTAGAGAGGGGGGAAGG - Intronic
945376706 2:209085122-209085144 AACTGGGCAGGGAGTGGGGAAGG - Intergenic
945435193 2:209809975-209809997 CTTCGGGGAAGGAGTGGGGAGGG - Intronic
947475921 2:230447650-230447672 CATAGGGCAAAGCGTGGGGAAGG + Intronic
947737036 2:232460420-232460442 TTTTGGGCAGAGGGTGGGGGTGG + Intergenic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
948252675 2:236543181-236543203 CTTTGGACAGAGAGAGGTGAAGG + Intergenic
1169211718 20:3769400-3769422 CTATGAGAAGAGAGCGGGGAGGG - Intergenic
1169321150 20:4634338-4634360 CTTTGGCCAGATAATGGGAATGG + Intergenic
1169839565 20:9920099-9920121 CATTCAGCAAAGAGTGGGGATGG + Intergenic
1171257086 20:23697638-23697660 ATTTGGGAAAAGAGTGGAGAAGG + Intergenic
1171264448 20:23759493-23759515 ATTTGGGAAAAGAGTGGAGAAGG + Intergenic
1172068014 20:32235186-32235208 CTCTGGCCAGGCAGTGGGGATGG - Exonic
1172164424 20:32890277-32890299 GTTGGGGCAGAGAGAGGGGCAGG - Intronic
1172469963 20:35185727-35185749 CTTGGGGCAAAGAGTGGGAGGGG + Intergenic
1172550634 20:35796740-35796762 CTTTGGTCAGAGAAAGAGGAAGG + Intronic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1172786014 20:37469428-37469450 CTGTGAGCAGAGAGTTTGGATGG - Intergenic
1173336295 20:42114858-42114880 ATTTGGGCAGAGAATGAGGGAGG - Intronic
1173449754 20:43152527-43152549 ATTGGGGCACACAGTGGGGATGG - Intronic
1173647066 20:44639959-44639981 CTGTGGCCAGAGAGGTGGGAGGG + Intronic
1173852491 20:46227770-46227792 GTTGGGGCTCAGAGTGGGGATGG - Intronic
1174400272 20:50272221-50272243 GTCTGGGCAGGGAATGGGGAGGG + Intergenic
1174600798 20:51723243-51723265 CTTGGGGAAAAGAGTGGGGAGGG + Intronic
1174992740 20:55530091-55530113 CTGGGGGCAGGGAGTGGGCAAGG + Intergenic
1175823186 20:61923082-61923104 CTTTGAGCCTAGTGTGGGGAAGG - Intronic
1176367757 21:6044122-6044144 CTGTGGGCGGAGACGGGGGAGGG - Intergenic
1177016173 21:15790228-15790250 TTTTGGGCAGAGAGTAGTGCTGG + Intronic
1178835135 21:36090889-36090911 ATTTGAGGAGAAAGTGGGGATGG + Intergenic
1178908471 21:36655139-36655161 GCTTGGGCAGGGAGAGGGGATGG - Intergenic
1179054191 21:37916243-37916265 GTTTGGGCAGGGACGGGGGAGGG + Exonic
1179169533 21:38962324-38962346 AGTAGGGCAGAGAGAGGGGATGG - Intergenic
1179755762 21:43494420-43494442 CTGTGGGCGGAGACGGGGGAGGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181116119 22:20633379-20633401 AGTTGGGCAGAGAGGGAGGAGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1182045214 22:27268841-27268863 GTTTGAGCTGAGTGTGGGGAAGG - Intergenic
1183281554 22:36935275-36935297 CTCAGGGCAGGGAGTGGGGTTGG - Intronic
1183315147 22:37132939-37132961 GCTTGGGCAGGGAGTGGGAAAGG + Intronic
1183383709 22:37503212-37503234 ATCTGGGCAGAGAGAGGGCAGGG + Exonic
1183620693 22:38970561-38970583 CTTTGTCCAGAGAGAGGGAATGG - Intronic
1183700715 22:39449459-39449481 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1183800294 22:40157732-40157754 CTTTGACCAGAGTGTGGGGGTGG - Intronic
1184115094 22:42417614-42417636 GTTGGGGCAGAGAGTGAGGAGGG + Intronic
1184159648 22:42690485-42690507 CTTAGGGCAGAGAGGTGGGTAGG - Intergenic
1184516269 22:44964764-44964786 CTTGGGCCCGAGACTGGGGATGG - Intronic
1184836371 22:47024475-47024497 CTTTGGGCTGAGGGTGGGAGAGG + Intronic
1184995006 22:48199183-48199205 CCTAGGGAAGAGAGTGGGGGAGG + Intergenic
1185367081 22:50441679-50441701 CCCTGGGGAGAGAGTGGAGAGGG + Intronic
1185391674 22:50564847-50564869 CTTTAGCCAGAGGGTGTGGAGGG + Intergenic
1185402300 22:50625452-50625474 CTGTGGGCAGAGCCTGGGGAGGG + Exonic
949590331 3:5487560-5487582 CAATGTGCAGAGAGTAGGGAAGG + Intergenic
949916713 3:8970411-8970433 CTTTTGGTAGAGACTGGGGTGGG - Intergenic
950205495 3:11077008-11077030 TTTGGGGCATAGAGTGGGAAGGG + Intergenic
950972290 3:17201435-17201457 CTTGGGGCAGAAAGCTGGGAGGG + Intronic
951119084 3:18902911-18902933 ATTTGGGGTGAGAGTGGGAAAGG + Intergenic
951404540 3:22279256-22279278 CTCTGGGCAAAGAGTGGGAGGGG - Intronic
952412710 3:33064007-33064029 CTATGGGCAGCTTGTGGGGATGG - Intronic
953291574 3:41669372-41669394 CTTTGGGGTGGGAGTGGGGAGGG - Intronic
953388449 3:42520593-42520615 CTTAGGGAAGAGAGTGGGACTGG + Intronic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953404329 3:42653147-42653169 ATTCTGGCAGAGAGTGGGGGTGG + Intergenic
953413078 3:42701144-42701166 GTTTTGGCAGAGGGTGGGGCCGG - Intronic
953669554 3:44951295-44951317 CTCTGTGCAGAGAATGTGGAAGG - Intronic
953843186 3:46406421-46406443 CTGTGGGAAGAGAGTGGGACGGG - Intergenic
954293989 3:49664101-49664123 CTTTGGGCAGAGAAGCAGGAAGG + Intronic
954384407 3:50236770-50236792 GTTTGGGCAAAGTGTAGGGAAGG - Intronic
954710167 3:52501615-52501637 CTGGGGGCAGAGGGTGGGCAGGG - Intronic
955527708 3:59838214-59838236 GTTTGGGTAGAGAGTGGGACTGG - Intronic
956881868 3:73519179-73519201 CCTTGGGCAGAAAGTAGGGTGGG + Intronic
957185029 3:76930322-76930344 CTGTGCACAAAGAGTGGGGAAGG - Intronic
958066850 3:88554800-88554822 CTTGGGGGAAAGAGTGGGAAGGG + Intergenic
959933217 3:112004339-112004361 CTGTGGACAGAAAGTGGGAAAGG + Intronic
960516603 3:118608665-118608687 CTCTGGGCTGATACTGGGGATGG - Intergenic
960524931 3:118698883-118698905 CTTGGGGCGAAGAGTGGGAAGGG + Intergenic
961135182 3:124503420-124503442 ATTTGGGCTTAGAGTGGAGATGG - Intronic
961256861 3:125562097-125562119 CTTTGGGGAGAAAGTGGGATTGG - Intronic
961467261 3:127089408-127089430 CTGTGGACAGAGGGTGGGGCAGG - Intergenic
962405160 3:135094303-135094325 CAGTGGGCAGAGACTGGGAAGGG - Intronic
962716128 3:138127664-138127686 TTATGGGCATAGGGTGGGGATGG - Intronic
963837425 3:150071149-150071171 ATTTGGGCAGGGAGTTGTGATGG + Intergenic
964339262 3:155690977-155690999 CCTTAGGCTGAGTGTGGGGAGGG - Intronic
965612781 3:170562474-170562496 CTTTGGGGACTCAGTGGGGAGGG + Intronic
966247641 3:177826415-177826437 CTTTGGGAAGTGAGAAGGGAAGG + Intergenic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
968434958 4:579628-579650 GGGTGGGCAGAGAGAGGGGAGGG + Intergenic
968597646 4:1493566-1493588 CTCCTGGCAGATAGTGGGGAGGG - Intergenic
968725886 4:2247642-2247664 CTCTGTGCAGGCAGTGGGGAGGG + Exonic
968900673 4:3430248-3430270 CTGTGGGAAGATAGTGTGGACGG + Intronic
968932991 4:3593101-3593123 CATTGCGCAGAGAGTGGGGATGG + Intergenic
969509809 4:7611397-7611419 CTTGGGGCTGAGAGGGCGGAAGG - Intronic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
969719066 4:8883094-8883116 CCTCAGGCAGAGAGTGGAGAGGG + Intergenic
970899119 4:21138223-21138245 CTTAGGGCACAGAGTTGAGAAGG - Intronic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
971628362 4:28954808-28954830 CAGTGGACAGAGAGTGTGGAGGG - Intergenic
972364303 4:38359976-38359998 CAATAGGCACAGAGTGGGGATGG - Intergenic
973113227 4:46421616-46421638 CTTGGGGGAGAGGGTGGGAAGGG - Intronic
974905336 4:68048056-68048078 ATTGGTGCATAGAGTGGGGAAGG + Intergenic
975442077 4:74422300-74422322 GTTGGGGTAGAGAGTGTGGAGGG + Intergenic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
976195463 4:82527661-82527683 CACTGGGCAGAGAGTTAGGAAGG - Intronic
978577719 4:110202798-110202820 CTTCAGGCTGAGAGTGGGCAGGG + Intergenic
979435269 4:120680783-120680805 CTTTGGGGACACAGTGGGGAAGG + Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980729136 4:136804668-136804690 CTTTCAGCAGAGAGGGGAGATGG - Intergenic
981266378 4:142788625-142788647 CTTTGGGGACTCAGTGGGGAAGG - Intronic
982087227 4:151848194-151848216 CTTTGGGGAGAGGGAGGGAAAGG - Intergenic
983516460 4:168662306-168662328 CTATGGGCTAAGAGTGGAGAGGG - Intronic
984779063 4:183506783-183506805 GTTTGGGGAGGGGGTGGGGAGGG + Intronic
984998791 4:185464349-185464371 CTTCAGTCAGAGGGTGGGGAGGG + Intronic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
988511711 5:31869843-31869865 CTGAGGGCAGAGAGAGGGGTGGG + Intronic
989553825 5:42768003-42768025 CTTTGAGTAGATGGTGGGGATGG + Intronic
989690289 5:44135405-44135427 CTCTGGGGAAAGAGTGGGAAGGG - Intergenic
989714817 5:44450686-44450708 CTGTGGGGAGACATTGGGGAGGG - Intergenic
990486268 5:56261831-56261853 CTATGGGAAGAGAGGAGGGATGG + Intergenic
991434509 5:66583566-66583588 ATTTGGACAGTGGGTGGGGAGGG + Intergenic
991509765 5:67363825-67363847 CTTGGGGGAAAGAGTGAGGAAGG + Intergenic
992020413 5:72618386-72618408 CCTTGAGCTGAGAGTGGGCAGGG - Intergenic
992198494 5:74362662-74362684 CCTGGGGCTGAGAGTGGGGGAGG - Intergenic
992625837 5:78635133-78635155 TTTTGAGAACAGAGTGGGGATGG - Intronic
993731492 5:91428319-91428341 CTATGTGCAGGGAGTGGGCATGG - Intergenic
993867225 5:93209893-93209915 CTTTGGGGAGTGTGTGGCGATGG - Intergenic
995215069 5:109585758-109585780 CCTTGGGCAGTGACTAGGGAGGG + Intergenic
995708892 5:115014711-115014733 CTTTTGGCAGAGAGTATAGATGG + Intergenic
995841240 5:116445194-116445216 AGTGGGGCAGAGGGTGGGGAAGG + Exonic
995942812 5:117605428-117605450 ATTTGGGCTGAGAGTGATGATGG + Intergenic
996432577 5:123398082-123398104 CTTAGGGGAAAAAGTGGGGAGGG + Intronic
996575129 5:124970814-124970836 CCTTGGGAACAGACTGGGGAGGG + Intergenic
997036739 5:130202194-130202216 CTTTGGGGAGACTGTTGGGAAGG - Intergenic
997467109 5:134095643-134095665 CATTGGGCAGTGGGAGGGGATGG - Intergenic
997496027 5:134326995-134327017 CACCAGGCAGAGAGTGGGGAAGG - Intronic
997977609 5:138449515-138449537 CTTTGGGTAGGGACTGGGGCAGG + Intergenic
998173767 5:139887595-139887617 CTTTGGGCTGGAACTGGGGAAGG + Intronic
999855862 5:155593109-155593131 GTTTAGGCAGAGACTGGGGTTGG - Intergenic
1000122317 5:158209009-158209031 CTGAGGGCAGAGAGTGGAGAGGG + Intergenic
1000470065 5:161630012-161630034 ACATGGGCAGAGGGTGGGGAAGG - Intronic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001402782 5:171455860-171455882 ATCTGGGTGGAGAGTGGGGAAGG + Intronic
1001453790 5:171845780-171845802 ATTTGGGCAGAGGCTGTGGAGGG + Intergenic
1001804131 5:174568864-174568886 CGGTGGGCAGTGAGTGGAGAAGG + Intergenic
1001932454 5:175683073-175683095 TTTTGGCCAGGGGGTGGGGAAGG - Exonic
1003646102 6:7913916-7913938 CTTTGAGCAGGGAGCAGGGAGGG - Intronic
1004244723 6:13963327-13963349 CTTTGGGCAGAGATTGGCTTTGG + Intronic
1004823242 6:19392819-19392841 CTTTGGGCAGGGAGCAGGTAAGG - Intergenic
1005241961 6:23840375-23840397 CTTTGGGCTGAGAGTCCAGAAGG + Intergenic
1005634197 6:27737920-27737942 TTTTGGGCTGAGAATGGGAAAGG + Intergenic
1005899982 6:30209071-30209093 CTTTGGGGAGAGAAGGGGAAGGG + Intronic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1006088918 6:31616321-31616343 CTGGGGGCAGAGGATGGGGATGG - Intronic
1006277802 6:33020039-33020061 GTTTGGGCAGAGAGTCAGGCTGG + Intergenic
1006308654 6:33241297-33241319 CCATGGGCAGGGAGTGGGGATGG - Intergenic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006740721 6:36306556-36306578 GTTAGGGCAGTGTGTGGGGAAGG + Intronic
1007033097 6:38646917-38646939 CTTTGGGAATTGAGTGGGAAGGG + Intergenic
1007290878 6:40785821-40785843 CTGGGAGCAGTGAGTGGGGATGG - Intergenic
1009269277 6:61598087-61598109 CTTGTGGCAGGGAGTGGGGTGGG - Intergenic
1009823158 6:68830807-68830829 CATGGGTCAGGGAGTGGGGAGGG + Intronic
1010053776 6:71539723-71539745 CTTTGGGGACTCAGTGGGGAAGG + Intergenic
1010928210 6:81769188-81769210 CTTTGGGCAGAGCTGAGGGAGGG - Intergenic
1012585590 6:100918329-100918351 CTTTGGGCAGAGAGAATGGGAGG + Intergenic
1012933962 6:105346234-105346256 CTTTGGGCGTAGAGTGGAAAAGG - Intronic
1013474920 6:110498179-110498201 ATTTTGAAAGAGAGTGGGGAGGG - Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1015352727 6:132241681-132241703 GTTTGGGCAGGGAATGGAGATGG - Intergenic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1015444316 6:133285837-133285859 CTTTGTGCAGAGAAATGGGAAGG + Intronic
1015710032 6:136129492-136129514 CTTCGGGTGGGGAGTGGGGAGGG - Intronic
1015834377 6:137404135-137404157 CTTTGGGTGGAGAGTGAGTAGGG + Intergenic
1016439776 6:144071012-144071034 CTTTGGGAAGAGAATGTGAAGGG - Intergenic
1016835534 6:148472969-148472991 CTCTGGTCAGCGTGTGGGGAAGG - Intronic
1017156194 6:151324547-151324569 CTTGGGGCAGGGAGGAGGGAGGG - Intronic
1017742517 6:157419462-157419484 CTTCGGGCAGAGGATGGGGAGGG - Intronic
1017900570 6:158715648-158715670 CTCTGGGCAGGGGGTGGGGGTGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018641030 6:165904218-165904240 CTTTGAGAAGAGAGAGGGGACGG + Intronic
1018681633 6:166270268-166270290 AGGTGGGCAGAGAGTGGCGATGG + Intergenic
1019057797 6:169235743-169235765 GTATGGGCAGTGAGTGTGGATGG - Intronic
1019605303 7:1907168-1907190 CAGTGGGGAGATAGTGGGGATGG - Intronic
1019705637 7:2495969-2495991 CTGTGGGGAGGGAGTGGGGCGGG + Intergenic
1020315927 7:6905317-6905339 CTTTGGGCACAGACTAGGAAGGG - Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1021710222 7:23408956-23408978 CCACGGACAGAGAGTGGGGATGG + Intronic
1022335977 7:29422494-29422516 CTTTGCTCAGAGAGTGGCCAGGG - Intronic
1022953387 7:35360023-35360045 CTTGGGGGAAAGAGTGGGAAGGG - Intergenic
1023665040 7:42514144-42514166 CTTTAAGCAGGGAGTGGGTAAGG + Intergenic
1023786484 7:43713480-43713502 ACTTGGGCAGGGAGAGGGGAAGG - Intronic
1024020332 7:45362555-45362577 CTATGGGGTGGGAGTGGGGATGG + Intergenic
1024356320 7:48416823-48416845 TGTAGGGAAGAGAGTGGGGAAGG - Intronic
1024374024 7:48617994-48618016 CCTGGGGCAGAGAGTGAGGTAGG - Intronic
1024833586 7:53490324-53490346 CTTTGGGAAGAGTGAGGGCAGGG + Intergenic
1026254244 7:68697026-68697048 CAATAGGCAGAGAGTAGGGATGG + Intergenic
1026906883 7:74067983-74068005 CAGTGAGCAGAGAGTGGGGCAGG - Intronic
1027190263 7:75992393-75992415 CCATGGGCAGAGTGTGGGGTGGG - Intronic
1028154568 7:87415207-87415229 TACTGGGCAGGGAGTGGGGAGGG - Intronic
1028784049 7:94772281-94772303 CTTTGGGGAAAGGGTGGGAAGGG + Intergenic
1029107101 7:98186712-98186734 TTCTGGGCAGAAAGTGGGTAAGG - Intronic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029415110 7:100437502-100437524 CTTTTGGTAGAGATTGGGAATGG - Intergenic
1029521115 7:101063151-101063173 CTTTTGGTAGAGATTGGGGCAGG - Intergenic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1030658765 7:112196634-112196656 CTGGTGACAGAGAGTGGGGAAGG + Intronic
1033419975 7:141196905-141196927 CCTTGGGCTGTGAGTGGGGATGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034188580 7:149196893-149196915 CTTGAGTCAGAGAGTGGGGCTGG + Intronic
1034387338 7:150751091-150751113 CTTTGGGCAGAGAGAAGTGATGG - Intergenic
1034528471 7:151681042-151681064 CTCTCGGCAGGGGGTGGGGAGGG - Intronic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1035041495 7:155931503-155931525 CTTGGGTCAGAAAATGGGGAAGG - Intergenic
1035323665 7:158051024-158051046 TTTTGGGCAGAGACTGGCAAAGG - Intronic
1035593580 8:836613-836635 CTGTGGGCAGGGGGTGGGGTTGG + Intergenic
1035712481 8:1729313-1729335 TGCTGTGCAGAGAGTGGGGAAGG - Intergenic
1036282127 8:7409249-7409271 CTTTGGGGAGTGATTGGGAAGGG + Intergenic
1036339342 8:7902322-7902344 CTTTGGGGAGTGATTGGGAAGGG - Intergenic
1037228813 8:16629128-16629150 GTTGGGGGAGAAAGTGGGGATGG + Intergenic
1037468369 8:19183340-19183362 CTTGGGGCTGTGAGTGGAGAAGG + Intergenic
1037525122 8:19717150-19717172 CTTTTGGCAGAGAGGAGGAATGG + Intronic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038196554 8:25373399-25373421 CTTTGGGAACTCAGTGGGGAAGG - Intronic
1038368527 8:26962787-26962809 CTGAGGGGAGAGAGTGGGAAGGG - Intergenic
1038419199 8:27421461-27421483 CTCTGGGGAAAGAGTGGGAAGGG - Intronic
1038950399 8:32408148-32408170 CTTGGGGTAGGCAGTGGGGAAGG + Intronic
1039232850 8:35467718-35467740 CTTTGGGCAGATGTTGGGGTAGG + Intronic
1040551908 8:48444255-48444277 CTTTGGGCAGGGAGGGGCTATGG + Intergenic
1040611316 8:48984973-48984995 CTTGGGAAGGAGAGTGGGGAAGG + Intergenic
1041219266 8:55632877-55632899 CTTTGGTTGGAGAGTGGGGAGGG - Intergenic
1041698832 8:60765548-60765570 CTTGGAGAAGAGAGTGGGAAAGG + Intronic
1042307499 8:67346695-67346717 TTTTGGGCAGACAGTGGGGCTGG - Intergenic
1042448468 8:68917248-68917270 ATTTGGGTAGAGGGTGGGAATGG - Intergenic
1043988413 8:86721406-86721428 CTATGGGGAAAGAGTGGGAAGGG + Intronic
1044515523 8:93134159-93134181 ATTTGGTCAGAGTGTGGCGAGGG - Exonic
1045424964 8:102056664-102056686 CTTTGGTCAGACAGTGAGGGAGG - Intronic
1046890444 8:119416222-119416244 CTTTTCCCAGAGGGTGGGGAGGG - Intergenic
1047298059 8:123588678-123588700 TTTTTGGCAGGGTGTGGGGATGG - Intergenic
1047365078 8:124204042-124204064 CTTTGGGAAGTGGGTTGGGAAGG - Intergenic
1047367789 8:124228179-124228201 CCTGGGGCATAGAGTTGGGAGGG + Intergenic
1047520261 8:125590598-125590620 CTTTAGCCTTAGAGTGGGGATGG - Intergenic
1048213825 8:132478963-132478985 CGTGGGGGAGAGAGGGGGGAGGG + Intronic
1049367843 8:142249298-142249320 CTGTGGGCAGAGGGTGGGCTGGG + Intronic
1049494676 8:142924178-142924200 CTATGGGCAGGGAGAGGGGCCGG - Intergenic
1049541329 8:143210504-143210526 CTGTGGGCAGGGAGCGGGGGTGG + Intergenic
1049675882 8:143888821-143888843 CTGTGGCCTGAGGGTGGGGAGGG + Intergenic
1050330943 9:4545576-4545598 CTTTGAGTAGAAAGTGGGTAAGG - Intronic
1051683917 9:19637290-19637312 CAGTGGGCAGAGACTGGGCAGGG + Intronic
1052348613 9:27435476-27435498 CTCTGGCCACAGACTGGGGAGGG - Intronic
1053533707 9:38905619-38905641 CTATGGGGAGAGGGTGGAGAAGG + Intergenic
1054205933 9:62130048-62130070 CTATGGGGAGAGGGTGGAGAAGG + Intergenic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1054632427 9:67458322-67458344 CTATGGGGAGAGGGTGGAGAAGG - Intergenic
1054805284 9:69391578-69391600 CTTTGGGAAAAGAGAGGGGTGGG - Intronic
1055498016 9:76875155-76875177 CTCTGGGCAGACAATGGGGAAGG - Intronic
1056599699 9:88036975-88036997 CTCTGGGCAGGGGCTGGGGAAGG + Intergenic
1056762362 9:89424679-89424701 CATTGGGCAGAGGTGGGGGAGGG - Intronic
1057040621 9:91845088-91845110 CCTTGGGCGTAGGGTGGGGAGGG - Intronic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1059323429 9:113486993-113487015 CTTGGAGCTGAGAGTGAGGAGGG + Intronic
1059898622 9:118896403-118896425 CTCTGGGCAGAGGGAGGAGATGG + Intergenic
1060061498 9:120464335-120464357 ATTGGGGCAGAGTGTGGTGAGGG - Intronic
1061168601 9:128939028-128939050 ACTCAGGCAGAGAGTGGGGATGG - Intronic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1061861596 9:133471228-133471250 TTTTTGGCAGGGGGTGGGGACGG + Exonic
1062395810 9:136352353-136352375 GTCTGGGCACAGGGTGGGGAGGG - Intronic
1203737499 Un_GL000216v2:150634-150656 CTGTAGGCAGAGAGTGGAAAAGG + Intergenic
1203740473 Un_GL000216v2:172976-172998 CTTTGGGCAGAGGGTAGACAAGG + Intergenic
1185502922 X:612586-612608 CTTGGGGAAAAGAGTGGGAAGGG - Intergenic
1185847977 X:3457567-3457589 ATTTGACCAGAGAATGGGGAAGG - Intergenic
1186312463 X:8335659-8335681 CTTTGGGGAGAGAGTCTGTAGGG - Intergenic
1187217335 X:17289761-17289783 CCTTGGACTGAGAGTGGGAATGG - Intergenic
1188541499 X:31255703-31255725 CTTTGGGCTGAGGGTGGGGCAGG - Intronic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189230179 X:39445981-39446003 CTCTGAGGAGAGAGTGGGGAAGG + Intergenic
1189251067 X:39601122-39601144 ATTTGGGCAGTGAGGAGGGAGGG - Intergenic
1190324638 X:49199336-49199358 GTTCGGGTAGAGAATGGGGATGG + Intronic
1190391857 X:49939986-49940008 CTTTGGGCAGAGAGCTGTCATGG - Intronic
1190932070 X:54957332-54957354 CTTTGGGAAGACAGTGCTGAGGG - Intronic
1191735896 X:64387551-64387573 CTTTGAGTAGAAAGAGGGGAGGG - Intronic
1192240669 X:69325151-69325173 CTTAGGGCTGGGAGTGGGGTGGG - Intergenic
1192261355 X:69507321-69507343 ATTGGGGCAGAGGGTTGGGAAGG + Intronic
1192340571 X:70260095-70260117 CTGTAGGCAGGCAGTGGGGAAGG - Intergenic
1192410153 X:70926901-70926923 ATTTGGCCAGAGAGTGGAGTGGG + Exonic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193792467 X:85832278-85832300 CTTGGACCAGAGAGTTGGGATGG + Intergenic
1195201056 X:102550311-102550333 CTTTGGGAGTAGAGTGGGAACGG - Intergenic
1195250760 X:103044349-103044371 GTTTGGGAAGGAAGTGGGGATGG - Intergenic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195386561 X:104318991-104319013 CTTTTGGGAGACAGTGGGGAGGG + Intergenic
1195468523 X:105208470-105208492 GTGTGGTGAGAGAGTGGGGATGG - Intronic
1195751729 X:108166110-108166132 CTTTGGCCAAAAAGGGGGGAGGG - Intronic
1195900523 X:109792891-109792913 CTTGGGGGAGAAAGTGGGGAAGG - Intergenic
1196251550 X:113465958-113465980 GTTTGGGAAGAGAAAGGGGAGGG + Intergenic
1196608025 X:117677674-117677696 CTTTGGTCAGAGAGTATGGTTGG - Intergenic
1197671940 X:129286511-129286533 TTTTTTGCAGAGAGTAGGGATGG + Intergenic
1197812857 X:130463537-130463559 CTGGGGGCTGAGGGTGGGGATGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198430198 X:136557903-136557925 ACTTGGGCAGAGAGTAGGGGAGG + Intergenic
1199216329 X:145263640-145263662 CTTTGGCCAGTAAGTGGGCATGG - Intergenic
1199584634 X:149401346-149401368 CTTGGGGGAAAGAGTGGGAATGG + Intergenic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1200720158 Y:6596825-6596847 CTTTGGCCAGAGATCGGGGCAGG - Intergenic
1200815870 Y:7531801-7531823 ATTTGCCCAGAGAATGGGGAAGG + Intergenic
1202366407 Y:24168673-24168695 CTTGGGGCAGCAAGAGGGGAGGG - Intergenic
1202504375 Y:25501450-25501472 CTTGGGGCAGCAAGAGGGGAGGG + Intergenic