ID: 1001092025

View in Genome Browser
Species Human (GRCh38)
Location 5:168748586-168748608
Sequence TAGGCGACACCCGCCAACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001092025_1001092029 16 Left 1001092025 5:168748586-168748608 CCGTGGTTGGCGGGTGTCGCCTA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1001092029 5:168748625-168748647 ACATAAGATGAAGACCATCAAGG 0: 1
1: 0
2: 0
3: 40
4: 1395
1001092025_1001092030 19 Left 1001092025 5:168748586-168748608 CCGTGGTTGGCGGGTGTCGCCTA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1001092030 5:168748628-168748650 TAAGATGAAGACCATCAAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001092025 Original CRISPR TAGGCGACACCCGCCAACCA CGG (reversed) Intronic
917997925 1:180460471-180460493 TGGGCGAGACCTCCCAACCAGGG + Intronic
1063469299 10:6271765-6271787 TAGGCTCCACCCTCCACCCACGG - Intergenic
1065458935 10:25934988-25935010 GAGGCGACACCCGCCAGACTCGG - Intronic
1077173527 11:1178769-1178791 TGGGAGACAGCTGCCAACCAAGG + Intronic
1084000782 11:66294416-66294438 CAGGCGACACCAGGCCACCACGG - Exonic
1096588586 12:52642449-52642471 TGGGCCACACCCTCCCACCAGGG - Intergenic
1107119306 13:36779380-36779402 AAGGCGAGACCTACCAACCAGGG + Intergenic
1113759826 13:112839552-112839574 GAGGGGACAGCCACCAACCACGG + Intronic
1137293359 16:47067333-47067355 GAGGTGACACCAGGCAACCATGG + Intergenic
1160596086 18:79975443-79975465 TAGGCTGCTCCCGCCACCCAAGG + Intronic
926986188 2:18626931-18626953 TAGGGGACACACTCAAACCATGG - Intergenic
927326331 2:21809874-21809896 TAGGCTACAAACACCAACCAAGG - Intergenic
1180570891 22:16717931-16717953 TAGACGACAGCCTCCACCCAGGG + Intergenic
1184678314 22:46055218-46055240 CAGGCCACACCCGCCTTCCATGG - Intronic
954522664 3:51243050-51243072 TAGGAGAGGCCAGCCAACCAAGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
968616461 4:1579698-1579720 CACGCGACACCCGCGAGCCACGG + Intergenic
1001092025 5:168748586-168748608 TAGGCGACACCCGCCAACCACGG - Intronic
1004249343 6:14010640-14010662 TAGAAGACACACACCAACCAGGG - Intergenic
1005982851 6:30850728-30850750 TAGGCGCCAACCGCCATGCATGG - Intergenic
1025236736 7:57239693-57239715 CAGGTGACTCCAGCCAACCAGGG - Intergenic
1042489592 8:69381881-69381903 TAGGTGACACCTCCAAACCAGGG + Intergenic
1062207951 9:135347493-135347515 TGGGCCAGACCCGCCCACCAAGG + Intergenic
1193274513 X:79570286-79570308 TAGGGGGCACCTCCCAACCAGGG - Intergenic