ID: 1001096540

View in Genome Browser
Species Human (GRCh38)
Location 5:168779814-168779836
Sequence GGACCCCAAATGAAAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001096540_1001096550 7 Left 1001096540 5:168779814-168779836 CCAGCTTCTTTCATTTGGGGTCC 0: 1
1: 1
2: 1
3: 7
4: 172
Right 1001096550 5:168779844-168779866 ATGGGGAGATGGCCCACAGGGGG 0: 1
1: 1
2: 2
3: 25
4: 242
1001096540_1001096547 4 Left 1001096540 5:168779814-168779836 CCAGCTTCTTTCATTTGGGGTCC 0: 1
1: 1
2: 1
3: 7
4: 172
Right 1001096547 5:168779841-168779863 AACATGGGGAGATGGCCCACAGG No data
1001096540_1001096551 16 Left 1001096540 5:168779814-168779836 CCAGCTTCTTTCATTTGGGGTCC 0: 1
1: 1
2: 1
3: 7
4: 172
Right 1001096551 5:168779853-168779875 TGGCCCACAGGGGGAAAACCAGG No data
1001096540_1001096548 5 Left 1001096540 5:168779814-168779836 CCAGCTTCTTTCATTTGGGGTCC 0: 1
1: 1
2: 1
3: 7
4: 172
Right 1001096548 5:168779842-168779864 ACATGGGGAGATGGCCCACAGGG 0: 1
1: 0
2: 6
3: 16
4: 182
1001096540_1001096549 6 Left 1001096540 5:168779814-168779836 CCAGCTTCTTTCATTTGGGGTCC 0: 1
1: 1
2: 1
3: 7
4: 172
Right 1001096549 5:168779843-168779865 CATGGGGAGATGGCCCACAGGGG 0: 1
1: 0
2: 3
3: 20
4: 219
1001096540_1001096545 -4 Left 1001096540 5:168779814-168779836 CCAGCTTCTTTCATTTGGGGTCC 0: 1
1: 1
2: 1
3: 7
4: 172
Right 1001096545 5:168779833-168779855 GTCCAGGTAACATGGGGAGATGG 0: 1
1: 0
2: 0
3: 13
4: 201
1001096540_1001096544 -10 Left 1001096540 5:168779814-168779836 CCAGCTTCTTTCATTTGGGGTCC 0: 1
1: 1
2: 1
3: 7
4: 172
Right 1001096544 5:168779827-168779849 TTTGGGGTCCAGGTAACATGGGG 0: 1
1: 0
2: 1
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001096540 Original CRISPR GGACCCCAAATGAAAGAAGC TGG (reversed) Intronic