ID: 1001097313

View in Genome Browser
Species Human (GRCh38)
Location 5:168785923-168785945
Sequence CAAGGGACTGTTTGATGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001097313_1001097319 7 Left 1001097313 5:168785923-168785945 CCAGCCCATCAAACAGTCCCTTG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1001097319 5:168785953-168785975 CGGTGATCTTGTTCCCATACAGG 0: 1
1: 0
2: 2
3: 5
4: 32
1001097313_1001097322 25 Left 1001097313 5:168785923-168785945 CCAGCCCATCAAACAGTCCCTTG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1001097322 5:168785971-168785993 ACAGGACCCTGAAAGAGAGAAGG 0: 1
1: 0
2: 3
3: 40
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001097313 Original CRISPR CAAGGGACTGTTTGATGGGC TGG (reversed) Exonic
900374996 1:2349967-2349989 CAGGGGATTGTTTGAGGCGCTGG + Intronic
901497766 1:9631747-9631769 CAAGGGCCTCTGTGCTGGGCAGG - Intergenic
902572041 1:17353083-17353105 CAAGGAAAGCTTTGATGGGCGGG + Intronic
903656952 1:24955317-24955339 GAAGGGAGAGTTTGACGGGCTGG + Intronic
905947435 1:41915948-41915970 TCAGGGACTCCTTGATGGGCAGG + Intronic
913463389 1:119113646-119113668 CCAGGCACTGTTTTATGTGCTGG + Intronic
914049916 1:144123012-144123034 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
914098333 1:144563024-144563046 TAAGGGACTGGTTGATTTGCGGG + Intergenic
914129266 1:144842439-144842461 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
914300646 1:146374590-146374612 TAAGGGACTGGTTGATTTGCGGG - Intergenic
919453660 1:197799569-197799591 AAAGGGCCTGGTTGATAGGCTGG - Intergenic
921895553 1:220396204-220396226 CAAGGCACTATTTGAGGGACTGG - Intergenic
1062955275 10:1536034-1536056 CTGGGGCCTGCTTGATGGGCCGG - Intronic
1063196157 10:3745721-3745743 TAAGGGACTGTTTTTTGGGAGGG - Intergenic
1069681712 10:70290252-70290274 CAAGAGACAGGCTGATGGGCAGG - Intergenic
1069812853 10:71175218-71175240 CAAGGGACGGCTAGATGGCCAGG + Intergenic
1072223364 10:93346485-93346507 CTAGGGACTGTGTTAGGGGCTGG - Intronic
1074253379 10:111776514-111776536 CAAGGGACTGTTTTATTGTGTGG - Intergenic
1075037719 10:119082994-119083016 ATAGGAACTGTTTTATGGGCAGG + Intergenic
1076219643 10:128722902-128722924 AAGGGGACTGGTTGATGGGAAGG + Intergenic
1078182190 11:9021161-9021183 CAAGGCTCTGTTTGATGTCCTGG - Exonic
1079328746 11:19516728-19516750 CAAGGGACTTCCTGCTGGGCTGG + Intronic
1083720590 11:64601752-64601774 AAAAGGACAGTTTGATTGGCAGG + Exonic
1084537910 11:69768693-69768715 TAAGGCACTGTGGGATGGGCAGG - Intergenic
1084712135 11:70850466-70850488 TTAGGGACTGTCTGATGGGCAGG - Intronic
1085855653 11:80172620-80172642 CAAGGTACTGTTTAAGGTGCAGG - Intergenic
1089734440 11:120540002-120540024 GAAGGGAGTGTTTCCTGGGCTGG + Intronic
1090844369 11:130518611-130518633 CAAGGGATAGCTTGGTGGGCAGG - Intergenic
1096965536 12:55624333-55624355 CAAGGGATTGTCTGGTGTGCTGG - Intergenic
1098956763 12:76696288-76696310 TAAAGGACTGTTTTATGGCCAGG - Intergenic
1099300703 12:80891292-80891314 CCAGGGAAGGTTTGATGTGCAGG - Intronic
1100602340 12:96122665-96122687 AAAGACACTGTTTGATTGGCCGG - Intergenic
1103597516 12:122032590-122032612 CAAGGGACCGTTTGATTTGGAGG + Intronic
1103615069 12:122146529-122146551 CAAGGGACTCTTTGCTTGTCAGG + Exonic
1104856242 12:131903751-131903773 CAAGGGACCATTTGAAGTGCAGG + Intronic
1109954965 13:69553667-69553689 CAAGGGCCTGTTTGTGGGGTGGG + Intergenic
1113793511 13:113043195-113043217 CAAGGGGCTGTGTGTTGGGCGGG - Intronic
1114642531 14:24233024-24233046 CCAGGTACTGTTTGTTGGGGAGG - Exonic
1119174024 14:72555997-72556019 CATGGGCCTGTTTGATGGAATGG - Intronic
1123419781 15:20122258-20122280 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
1123446079 15:20331275-20331297 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
1123529003 15:21128794-21128816 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
1125532775 15:40424386-40424408 CAAGAGAAAGTTTGAAGGGCTGG - Intronic
1125758978 15:42084424-42084446 CTAGGGGCTGTTTGATGGACGGG - Intronic
1129459373 15:75692780-75692802 CAAGCGACTGTAAGATGGCCAGG + Intronic
1129724590 15:77895106-77895128 CAAGCGACTGTAAGATGGCCAGG - Intergenic
1129935874 15:79449906-79449928 GAGGGGAGTGTTTGATGGTCTGG - Intronic
1130160441 15:81393862-81393884 GAAGGGACTGATGCATGGGCTGG - Intergenic
1130704169 15:86216877-86216899 CAAGGAACAGTGAGATGGGCAGG - Intronic
1132111012 15:99102488-99102510 GAAGGGAATGATTGATGGGATGG - Intronic
1134837618 16:17375387-17375409 CAGGGGTCTGTTGGATGGGCCGG - Intronic
1134837908 16:17377314-17377336 AACAGGTCTGTTTGATGGGCAGG - Intronic
1135489455 16:22896266-22896288 CAAGGGATTTTTTGAAGAGCAGG + Intronic
1135589569 16:23695370-23695392 CAGGGGACAGTTTGAGGGACGGG - Exonic
1136720687 16:32317399-32317421 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
1136839068 16:33523681-33523703 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
1137862654 16:51862056-51862078 CGAGGTACTATTTTATGGGCAGG - Intergenic
1138824416 16:60301852-60301874 CAAGTGACTGTTTGATGAATTGG - Intergenic
1141133004 16:81447669-81447691 TAAGGAAGTGTTTGATGGACTGG + Intronic
1203005745 16_KI270728v1_random:200371-200393 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
1203137295 16_KI270728v1_random:1736491-1736513 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
1203149231 16_KI270728v1_random:1823968-1823990 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
1145102375 17:20087845-20087867 CCAGGGGCTGTTTGGTGGGGTGG + Intronic
1147563350 17:41522113-41522135 CAAGGGAGGCTTTCATGGGCAGG + Exonic
1149503726 17:57175373-57175395 CAAGGGCCTTTTTGATGTTCTGG + Intergenic
1151523870 17:74650424-74650446 CCAGGGGCTGTTTGATTGCCCGG - Intergenic
1153675465 18:7452650-7452672 CAAGGGACTTGGTGATGTGCTGG - Intergenic
1153992853 18:10415320-10415342 GAAGGGGCTGTCTGATGGGCTGG - Intergenic
1155036230 18:22027005-22027027 CAAGGGTCTGTTTCCTGGGCAGG + Intergenic
1156095846 18:33531001-33531023 CAAGGAAGTGTTTGGTGGGCTGG - Intergenic
1157392417 18:47313931-47313953 CCAGGGGCTGGATGATGGGCAGG - Intergenic
1157680521 18:49602055-49602077 TAAGGGATTCTCTGATGGGCGGG - Intergenic
1157944250 18:51960762-51960784 CAAGGGAGTGTCTGGTGGGAAGG - Intergenic
1160718915 19:589216-589238 CAGGGCACTGTTTGAGGGGTGGG + Intergenic
1163393594 19:17045799-17045821 CTGGGGACTGTTTCAAGGGCTGG - Intergenic
1164633120 19:29774506-29774528 CAAGTGACTGTCTCAGGGGCAGG + Intergenic
1202689305 1_KI270712v1_random:75575-75597 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
925675304 2:6356067-6356089 CAAGGGGCTGATTGAGGGCCTGG + Intergenic
926233386 2:11021644-11021666 CAAGGGACACTGTGATGGGTCGG + Intergenic
927571772 2:24166545-24166567 CCAGGCAGTGTTTGAGGGGCTGG + Intronic
931214476 2:60228358-60228380 CCAGGTACTGTTTGAGGGGCTGG - Intergenic
933957130 2:87380516-87380538 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
934241249 2:90272408-90272430 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
934271927 2:91544278-91544300 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
934723764 2:96601858-96601880 CAAGGGACTGTGTTATGTGGGGG - Intronic
935373049 2:102367326-102367348 CCAGGGAATGTTAGATAGGCAGG + Intronic
935914288 2:107932522-107932544 GTAGGGACTGTTGAATGGGCAGG + Intergenic
936147910 2:109993886-109993908 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
936196781 2:110377561-110377583 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
936948380 2:117952016-117952038 CAAGCTGCTGTTTGAGGGGCAGG + Intronic
939277513 2:140018350-140018372 CAAGGGTTTGTTTGTTGTGCTGG - Intergenic
941448575 2:165631302-165631324 CAAGGGGCAGCTTGATGTGCAGG + Intronic
944771742 2:202921609-202921631 CAAGTGACTGTTCTATGTGCTGG - Intronic
945724178 2:213455351-213455373 CAAGGGGATGTTTGGTGGGGAGG - Intronic
947168256 2:227284461-227284483 CAACCGGCTGTGTGATGGGCAGG - Intronic
1169189013 20:3645475-3645497 CCAGCCACTGTTTGCTGGGCTGG - Intronic
1171162183 20:22937530-22937552 TTAAGGACTGTTTGATGGACTGG - Intergenic
1172102779 20:32495553-32495575 CAAGGGACTGTCTTCTGGGGAGG - Intronic
1175702393 20:61149322-61149344 CAAGGGAATGCAGGATGGGCAGG + Intergenic
1176373130 21:6074410-6074432 AAAAGCACTGCTTGATGGGCAGG + Intergenic
1177231563 21:18327565-18327587 CAAGGGACAGTGTGGTGGGGAGG - Intronic
1177358736 21:20041591-20041613 CCAGTGACTGTTTGTTGGGGAGG + Intergenic
1179750347 21:43463833-43463855 AAAAGCACTGCTTGATGGGCAGG - Intergenic
1180552116 22:16549039-16549061 CAAGGGTCTGTTTGGGTGGCAGG - Intergenic
1181351912 22:22265020-22265042 CAAGGGTCTGTTTGGGTGGCAGG + Intergenic
1182658467 22:31908132-31908154 CCAGGGACTGTGTGATGGCCAGG - Intergenic
1182937023 22:34233785-34233807 CTGGGGACTGCTTGAGGGGCAGG + Intergenic
1184492889 22:44820428-44820450 CAACGTCCTGTGTGATGGGCGGG - Intronic
1184986998 22:48142510-48142532 CTAGGCACTGTTTCAGGGGCTGG + Intergenic
950136372 3:10584054-10584076 CAAGGGACAGTCTGAAGGGATGG + Intronic
950272840 3:11632841-11632863 CCAGGAACTGTTTTATGTGCTGG - Intronic
950670213 3:14521467-14521489 CTAGGCATTGTTTGATGTGCTGG - Intronic
950988863 3:17409363-17409385 CAAGGGACTGTTTAGTGGTATGG - Intronic
951320533 3:21238894-21238916 GAAGGGACTGTTTAAGAGGCTGG + Intergenic
952498337 3:33935735-33935757 CAAGGGAGTGACTGAGGGGCGGG + Intergenic
953812886 3:46129712-46129734 CTAGGGAGTGCTTGATGGGGTGG + Intergenic
955175999 3:56613246-56613268 CAAGGGGCTGTTTGATGGTTAGG + Intronic
956624037 3:71249244-71249266 CAAGGCCCTGTTTGCTGGGTTGG - Intronic
957494234 3:80969754-80969776 CAAGGGACTCTTTCATGGCTAGG + Intergenic
963010072 3:140760479-140760501 GAAGGGACTGTGTTGTGGGCAGG + Intergenic
969384260 4:6832689-6832711 CCAGGAACTGTTTTAAGGGCTGG - Intronic
969448713 4:7260432-7260454 CAATGGATTGACTGATGGGCTGG + Intronic
972839568 4:42914616-42914638 TAGGGGACTGTTGGAAGGGCAGG + Intronic
974120154 4:57628111-57628133 CAAGGTACTGTTTCAGGGGTGGG - Intergenic
975671409 4:76784489-76784511 CAAGTGTCTGTGTAATGGGCAGG - Intergenic
981935003 4:150229555-150229577 GAAAGGACTGCTTTATGGGCTGG + Intronic
983293058 4:165831084-165831106 TAAGGGACTGCATGATGTGCTGG - Intergenic
985305853 4:188538664-188538686 CTTGGGACTGTGTGATGGGAGGG - Intergenic
985835950 5:2272051-2272073 CCAGGGACTGTGTGAAGGGCTGG + Intergenic
987458996 5:18184099-18184121 CCAGGGACTGTTGGGGGGGCGGG - Intergenic
989435783 5:41411391-41411413 CAAGGGAGTGTTTGAGGGTTGGG + Intronic
992209864 5:74468297-74468319 GAAGGGAGTGGTTGATAGGCAGG - Intergenic
993577351 5:89619187-89619209 CTAGGGACTGTTGGGTGGTCGGG - Intergenic
996899959 5:128533301-128533323 CAAATGAAGGTTTGATGGGCTGG + Intronic
997850797 5:137331155-137331177 CAAGGGACTGTTTGTTCCTCTGG + Intronic
999239374 5:150118660-150118682 CAAGGCTCTGCGTGATGGGCTGG - Intronic
1000272729 5:159702145-159702167 GAAGGGAGTGTTTGCAGGGCAGG - Intergenic
1000356412 5:160400111-160400133 CAAAGGGCTGTGGGATGGGCTGG + Intergenic
1000553072 5:162690919-162690941 CTGGGGACTGTTGGGTGGGCGGG - Intergenic
1001097313 5:168785923-168785945 CAAGGGACTGTTTGATGGGCTGG - Exonic
1003806468 6:9730620-9730642 CAAGGGACAGTTGGATTGGAAGG - Intronic
1013576818 6:111491682-111491704 CAAGAGACTGGATGAAGGGCTGG - Intergenic
1019508764 7:1406655-1406677 CAAGGGGCTGCCTGAGGGGCTGG + Intergenic
1023286375 7:38625101-38625123 CAGGGGACTGTTTGAAAGCCCGG + Intronic
1023921483 7:44633545-44633567 CAAGGGAGTCTTGGATGGGGAGG - Intronic
1024407106 7:48994360-48994382 CAAATAGCTGTTTGATGGGCTGG - Intergenic
1025965844 7:66270239-66270261 CAAGGGAGTGTGTGAAGGTCAGG + Intronic
1027048369 7:75006305-75006327 CAAATGAATGTTTGAAGGGCTGG + Intronic
1029384641 7:100235343-100235365 CAAATGAATGTTTGAAGGGCTGG - Intronic
1030443173 7:109614623-109614645 CTAGGTACTCTTTGAAGGGCTGG + Intergenic
1030715013 7:112799456-112799478 GAAGGGTCTGTTTGGTTGGCTGG + Intergenic
1031823361 7:126532127-126532149 GAAGGGAGTGTTTGCTGGGTTGG - Intronic
1031832554 7:126645481-126645503 TTATGGACTGTTTGGTGGGCAGG - Intronic
1036495570 8:9267244-9267266 AAGGGGACTGTTTGATGGTAAGG + Intergenic
1038217774 8:25578456-25578478 CAAGGGACAGATTCTTGGGCTGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041784600 8:61617350-61617372 GAAGGGAGTGTTTGAAGGACAGG + Intronic
1043989869 8:86739414-86739436 CCAGGCACTGTTCCATGGGCTGG - Intronic
1048332536 8:133480471-133480493 CCAGGGGCTGTGTGAAGGGCTGG - Intronic
1048529745 8:135236453-135236475 CAAGGGGGTTATTGATGGGCTGG + Intergenic
1050706754 9:8408642-8408664 CAAGAGGCTTTTTGATTGGCTGG - Intronic
1054982271 9:71220845-71220867 CAGGAGGCTGTTGGATGGGCAGG - Intronic
1058281764 9:103125346-103125368 CAAGAGAGTGTTTGTTGGGAAGG - Intergenic
1062308374 9:135922097-135922119 CAGGGGAGGGTCTGATGGGCCGG - Intergenic
1188171962 X:26938582-26938604 CTAGGGCCTGTTTGGAGGGCTGG + Intergenic
1193869308 X:86777391-86777413 CTAGGGATTTTTTGATGTGCAGG - Intronic
1194239511 X:91427129-91427151 TTAGGGACTTTTTGATGGGATGG - Intergenic
1196123518 X:112075724-112075746 CAAGGGCCTGTTTGATGAGGGGG - Intronic
1196457936 X:115903119-115903141 CAAGGGAGTGTTGCATGGGAGGG + Intergenic
1199017362 X:142833954-142833976 CAAGGGACTGTGATATGGGCTGG - Intergenic
1200051603 X:153434845-153434867 CAAGGGAGTGTCTGGTGGGAAGG - Intergenic