ID: 1001100647

View in Genome Browser
Species Human (GRCh38)
Location 5:168811008-168811030
Sequence TAGGAGAAGAACAATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 329}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001100647_1001100651 -9 Left 1001100647 5:168811008-168811030 CCAGCCACATTGTTCTTCTCCTA 0: 1
1: 0
2: 1
3: 22
4: 329
Right 1001100651 5:168811022-168811044 CTTCTCCTAAATGGTAAAATGGG 0: 1
1: 0
2: 0
3: 15
4: 271
1001100647_1001100655 18 Left 1001100647 5:168811008-168811030 CCAGCCACATTGTTCTTCTCCTA 0: 1
1: 0
2: 1
3: 22
4: 329
Right 1001100655 5:168811049-168811071 ATTATCAAGGTGAAAGCGAAAGG 0: 1
1: 0
2: 3
3: 9
4: 180
1001100647_1001100650 -10 Left 1001100647 5:168811008-168811030 CCAGCCACATTGTTCTTCTCCTA 0: 1
1: 0
2: 1
3: 22
4: 329
Right 1001100650 5:168811021-168811043 TCTTCTCCTAAATGGTAAAATGG 0: 1
1: 0
2: 3
3: 39
4: 335
1001100647_1001100652 -8 Left 1001100647 5:168811008-168811030 CCAGCCACATTGTTCTTCTCCTA 0: 1
1: 0
2: 1
3: 22
4: 329
Right 1001100652 5:168811023-168811045 TTCTCCTAAATGGTAAAATGGGG 0: 1
1: 0
2: 2
3: 36
4: 417
1001100647_1001100654 5 Left 1001100647 5:168811008-168811030 CCAGCCACATTGTTCTTCTCCTA 0: 1
1: 0
2: 1
3: 22
4: 329
Right 1001100654 5:168811036-168811058 TAAAATGGGGATGATTATCAAGG 0: 1
1: 1
2: 8
3: 56
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001100647 Original CRISPR TAGGAGAAGAACAATGTGGC TGG (reversed) Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
902753499 1:18533928-18533950 TGGGAAAGGAACAATGTGGGAGG - Intergenic
904025631 1:27501730-27501752 TAGAAGTAGAAAAATATGGCTGG + Intergenic
905963880 1:42072103-42072125 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
906261556 1:44395542-44395564 TGAGAGAAGACCAATATGGCTGG + Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
910084749 1:83386532-83386554 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
910136228 1:83973507-83973529 AAGGAGAAGAACAAAGTTGGAGG - Intronic
910793269 1:91072989-91073011 AAGAAGAAGAAGAATGTGACTGG + Intergenic
911102389 1:94104870-94104892 TGGGAAAAGAACAATGGAGCTGG - Intronic
913052233 1:115127746-115127768 TAGGAGGAGGCCATTGTGGCTGG + Intergenic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915928142 1:160040198-160040220 CAGGAGCAGAACTCTGTGGCTGG - Exonic
916333734 1:163646524-163646546 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
918065554 1:181098791-181098813 TAAAAGAAAAAAAATGTGGCTGG - Intergenic
918517140 1:185375731-185375753 AAGCAGGAGACCAATGTGGCAGG - Intergenic
918628729 1:186689602-186689624 AAGGAGAAGAACAAAGTTGCAGG + Intergenic
918743704 1:188170765-188170787 AAGAACAAGAAAAATGTGGCAGG - Intergenic
919408929 1:197219796-197219818 TAAAAGAAGATCATTGTGGCTGG - Intergenic
919556441 1:199060496-199060518 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
920789741 1:209078596-209078618 TATTAAAAGAACAATGTGACCGG + Intergenic
921768449 1:219003102-219003124 TAGAAGAAGAAAAAAGTGACAGG - Intergenic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924523366 1:244824611-244824633 TATAAGAAGAACACTGAGGCCGG - Intergenic
1064335229 10:14434441-14434463 TGGGAGAAGAACATTGTAGAGGG - Intronic
1065277714 10:24102593-24102615 AAGGAGAAGAACAAAGTCGAAGG + Intronic
1066043156 10:31572332-31572354 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1068817106 10:61329429-61329451 AAGGAGAAGAACAAAGTTGACGG - Intergenic
1071998426 10:91169824-91169846 AAGGAGAAGAACAAAGTTGGAGG + Intronic
1073479180 10:103775443-103775465 AAGGACAAGATCAGTGTGGCTGG + Intronic
1073546523 10:104353945-104353967 TAGGAGAGGGACAATGGGGAGGG - Intronic
1073998329 10:109341424-109341446 TAGGAGGAGAAGAATGGGGCGGG + Intergenic
1074851014 10:117439733-117439755 TATGCCAAGAACAATGGGGCTGG - Intergenic
1075848353 10:125565445-125565467 TTGGAGAAGGATAACGTGGCAGG + Intergenic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077836460 11:5931281-5931303 TAGGAGAAGAGCTAGGTGGGTGG - Intronic
1078748663 11:14139373-14139395 TAGGAGAAGGACAAAGTGCTGGG - Intronic
1079215559 11:18507795-18507817 TAGGAAAAAAAAAATGTTGCAGG + Intronic
1080597660 11:33788939-33788961 TAAGAAATGTACAATGTGGCTGG + Intergenic
1080708132 11:34718769-34718791 TAAAAGAAGGCCAATGTGGCTGG + Intergenic
1081385894 11:42472597-42472619 TAGAATAAGAAAAATCTGGCTGG - Intergenic
1081560538 11:44211007-44211029 TAAAAGAAGAACAAAGTTGCAGG + Intronic
1081731202 11:45372842-45372864 TAGGACAAGAAAACTGTGGGTGG + Intergenic
1084121800 11:67073509-67073531 TAGGGGAAGAGCAATCAGGCTGG + Intergenic
1084201600 11:67562565-67562587 TAGGAGCAGACAAATGGGGCCGG + Intergenic
1084919061 11:72454441-72454463 CAGGGGAAGAATCATGTGGCTGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1087275875 11:96160059-96160081 TAGGGGAAAAGCACTGTGGCAGG - Intronic
1087301596 11:96442704-96442726 TAAGAGAAAAACAGTATGGCCGG + Intronic
1087375389 11:97333396-97333418 TAGGAGGAGAAATCTGTGGCTGG - Intergenic
1087901754 11:103649240-103649262 TTGGAGATGTGCAATGTGGCTGG - Intergenic
1088925240 11:114295215-114295237 TAGGAGATAAACAATGTTGCCGG - Intronic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1090908671 11:131099008-131099030 TAGTGGAAGAGCAACGTGGCTGG + Intergenic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1092797143 12:12123317-12123339 TAGAAGAAGAAACTTGTGGCAGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1092872709 12:12820457-12820479 GCTGAGAAGTACAATGTGGCTGG - Intronic
1094192602 12:27712237-27712259 GGGAAGAAGGACAATGTGGCAGG + Intronic
1094309498 12:29063173-29063195 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
1094828228 12:34288128-34288150 AAGGAAAAAAACAATGTGGCCGG + Intergenic
1098136835 12:67412108-67412130 CAGGAGAAGAGGAGTGTGGCTGG + Intergenic
1098745936 12:74236646-74236668 TATGAGAAGCCCAAAGTGGCTGG - Intergenic
1098832988 12:75386209-75386231 GATGAGAAGAACAAGGTTGCAGG + Intronic
1099964686 12:89433194-89433216 TGGGAGAAGAGCAATGAGACAGG + Intronic
1101610016 12:106282806-106282828 TAGGAGGAGAAAATTGAGGCTGG - Intronic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1103865488 12:124048660-124048682 TAATATAAGGACAATGTGGCTGG - Intronic
1103894425 12:124263703-124263725 AAGGAGATGAAGAATATGGCAGG - Intronic
1104261727 12:127189815-127189837 TAGGGGAAGAACAAAATGGGTGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105267379 13:18834032-18834054 TAAGAGAACACCAATTTGGCAGG - Intergenic
1105503832 13:20993257-20993279 TAGGACAAGAAGAACCTGGCAGG + Intronic
1107160420 13:37219524-37219546 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
1107578135 13:41749791-41749813 TGGGAAATGAACAATGTGGTGGG + Intronic
1108019837 13:46116480-46116502 TAAGAAAGAAACAATGTGGCCGG + Intergenic
1109149152 13:58823140-58823162 GAGCAGAAGAACAAGGTGGAAGG + Intergenic
1110319626 13:74147042-74147064 AATGAGAAGAACAATGTGCTGGG - Intergenic
1112564228 13:100538682-100538704 TTGGAAAAGAACAATGTTGGAGG - Intronic
1115300646 14:31881544-31881566 GAGGAGAAGGACAAGGTGACGGG - Intergenic
1115758605 14:36555319-36555341 AAGGAGAAAAACTATGTGGGAGG + Intergenic
1117707939 14:58492462-58492484 TAGCAGTAGAACAAGGTGGTTGG - Intronic
1118203960 14:63704227-63704249 AAAAAGAAGAACAATGTGGAAGG + Intronic
1118242578 14:64074300-64074322 AGGGAGAAGATCAGTGTGGCTGG + Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1120761387 14:88288726-88288748 AATGAGAAGACCAGTGTGGCTGG - Intronic
1120946104 14:89998703-89998725 TAGGGGAAGAGCCATGTGGATGG + Intronic
1122194408 14:100074223-100074245 AACGAGAAAAACAAGGTGGCAGG - Intronic
1122552854 14:102559400-102559422 GAGGTGAAGAACAATTTGCCAGG - Intergenic
1122648573 14:103211445-103211467 TTGAAAAAGAACAATGTGGCCGG - Intergenic
1123154288 14:106209539-106209561 GAGGAGAGGAACAGTGTGGAAGG + Intergenic
1202831397 14_GL000009v2_random:37442-37464 TAAGAGAATACCAATTTGGCAGG + Intergenic
1126679334 15:51188399-51188421 TGGGAGAAGAACATTCTGGATGG - Intergenic
1127299084 15:57634932-57634954 TAGGAGGACAATAATGTGGGAGG - Intronic
1130756720 15:86772029-86772051 AAGTGGAAGAACAGTGTGGCTGG + Intronic
1131353123 15:91719466-91719488 TAGGAGAAAGACCATGTGGAGGG - Intergenic
1132922333 16:2403941-2403963 TAGGATAAGAATAATGGGCCAGG - Intergenic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1134423035 16:14112188-14112210 TAGGAAAGGAAAAAGGTGGCAGG + Intronic
1134765775 16:16756425-16756447 TATGAAAGGTACAATGTGGCAGG + Intergenic
1134785541 16:16939329-16939351 TAGAATAAAAACTATGTGGCTGG + Intergenic
1134980278 16:18602794-18602816 TATGAAAGGTACAATGTGGCAGG - Intergenic
1135469906 16:22721155-22721177 GAAGAGAAAAAAAATGTGGCCGG - Intergenic
1135485321 16:22859960-22859982 TTGAGGAAGAGCAATGTGGCTGG - Intronic
1137279623 16:46964629-46964651 TAGCAAAAGAACAATGTCTCCGG + Exonic
1137759221 16:50927164-50927186 TAGGAGATGAGCAAGGTGGCTGG - Intergenic
1137901280 16:52271900-52271922 TTGGAGAGGATCAATGTGGCAGG - Intergenic
1138055346 16:53827215-53827237 TAGAAGAAGAGAAATGTGGGTGG - Intronic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138484419 16:57328622-57328644 AAGGAGTAGAACAAGGTTGCAGG - Intergenic
1138591865 16:58004387-58004409 AAGGAGAAGAACAAAGTTGGAGG - Intronic
1140067414 16:71623556-71623578 TAGGGGAAGAGCCATGTGTCTGG + Intergenic
1140169926 16:72594017-72594039 TGGGAGAAGAACAGAGTGGAGGG - Intergenic
1140605048 16:76526272-76526294 AAGGAAAAAAACAATGTGGCTGG + Intronic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1143637947 17:8177064-8177086 TAAGAGCAGAGCAAGGTGGCTGG + Intergenic
1146112705 17:30104973-30104995 TCAGATAAGAACACTGTGGCAGG + Intronic
1146154845 17:30514259-30514281 TAGGACCAGAACAATGTTGGAGG - Intronic
1146168362 17:30611562-30611584 TTAAAGAAGAAAAATGTGGCCGG + Intergenic
1147434608 17:40401842-40401864 TAGGCCAAGGACAGTGTGGCTGG + Intronic
1148987113 17:51632645-51632667 TAGGGGGTAAACAATGTGGCTGG + Intronic
1150383158 17:64736599-64736621 TAGAAGAATAACATTGTGGAGGG + Intergenic
1150641190 17:66950915-66950937 AAGGAGAAGGACAGTGTCGCTGG + Intergenic
1150773080 17:68058174-68058196 TAGAAGAATAACATTGTGGAGGG - Intergenic
1151659225 17:75509875-75509897 GAGGAGCAGGACAATGTGACAGG + Intronic
1154265861 18:12878368-12878390 AAGAAAAAGAAAAATGTGGCTGG + Intronic
1154421031 18:14227403-14227425 TAAGAGAATACCAATTTGGCAGG + Intergenic
1155756709 18:29507366-29507388 CTGGAGAGAAACAATGTGGCCGG - Intergenic
1157333623 18:46721277-46721299 TAGGAAGTGGACAATGTGGCAGG + Intronic
1157334178 18:46725397-46725419 TAGGAGGATGACAGTGTGGCTGG - Intronic
1157748437 18:50157567-50157589 GGGGAGAAGAGAAATGTGGCTGG - Intronic
1157805121 18:50652056-50652078 TGAGAGAAGAACAATCGGGCTGG - Intronic
1158349158 18:56547295-56547317 TAGGAGACAAACAAAGTGGGTGG - Intergenic
1158446381 18:57525990-57526012 TATAAGAAGACCAGTGTGGCTGG + Intergenic
1158794423 18:60826008-60826030 AAGGAGAATAACAAGGTGGAAGG + Intergenic
1158975277 18:62705383-62705405 TAGGAGAAAAAAAATCTGGGAGG + Intergenic
1159260682 18:66008037-66008059 AAGGAGAAGAACAAAGTTGAGGG - Intergenic
1159487184 18:69077299-69077321 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1159873321 18:73783207-73783229 TAGGAGAAGAAAAAGGTAGTAGG - Intergenic
1161020623 19:2009492-2009514 TAGAAGTAGAACAATCTGGGTGG - Intronic
1163083136 19:14957930-14957952 AGAGAGAAGACCAATGTGGCTGG + Intronic
1163785198 19:19271378-19271400 TGGAGGAAGAACAATGTGGATGG - Intronic
1165791294 19:38494269-38494291 TTGGACCAGAACAATGTGGAAGG - Intronic
1167374825 19:49105006-49105028 TAAGAGGAGTACAATGAGGCAGG - Intronic
925694800 2:6565158-6565180 TTGGAGAAGGAAAATTTGGCAGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926834477 2:17002708-17002730 TAAGAGAAGAAGAAAGTGGTAGG + Intergenic
930327073 2:49933427-49933449 CAGGTGAAGAGGAATGTGGCTGG - Intronic
930331553 2:49991794-49991816 AAGGAGAAGAACAAAGTTGAAGG + Intronic
932017907 2:68051630-68051652 TGGGGGAAGAACAATGTGGCTGG - Intronic
932597390 2:73102515-73102537 TAGGACAGGAACAATGGGGAAGG + Intronic
932604990 2:73159266-73159288 GAGGAAAAGAACTGTGTGGCTGG + Intergenic
932980276 2:76655481-76655503 TATGAGAAGAACAAAGTTGGAGG - Intergenic
934497113 2:94813727-94813749 TAAGAGAATACCAATTTGGCAGG - Intergenic
934612281 2:95749676-95749698 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
934841871 2:97629771-97629793 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
936238121 2:110763238-110763260 AAGGAGAAGAACAAAGTTGGAGG + Intronic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
937456193 2:122043815-122043837 TAAGAGAAGAAAAGTGTGGCTGG - Intergenic
937822686 2:126328597-126328619 TAAGAAAACAACAATGTAGCAGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
941609428 2:167642693-167642715 TATGAGAAGAAAAATAAGGCAGG - Intergenic
942683568 2:178507232-178507254 TGGGGGAAGAAAAATGTGGGAGG - Exonic
942764003 2:179432432-179432454 TAGGAGAGGTACAAGGAGGCTGG - Intergenic
943301623 2:186209874-186209896 TAGGAGAAGAAAAAAGTTGGAGG - Intergenic
943772179 2:191730435-191730457 TAGGAGGGGACCAGTGTGGCTGG + Intergenic
946438662 2:219676666-219676688 CAGGAGATAAACAATATGGCAGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947387187 2:229602926-229602948 TTGAATAAGAACAATGTGGGAGG + Intronic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
1168764057 20:369837-369859 TCGGAGAAGGTCAATGTGGCTGG - Intronic
1171888412 20:30680513-30680535 TAAGAGAATACCAATTTGGCAGG - Intergenic
1172548999 20:35784346-35784368 GAGGGGAAAAAAAATGTGGCCGG - Intronic
1173983880 20:47246060-47246082 TAGGAGAAGACCATTCTGGGCGG - Exonic
1174495931 20:50942756-50942778 TAGGCAAAGAAAAGTGTGGCAGG - Intronic
1174820796 20:53725069-53725091 GAGGAGATGAAAAATATGGCCGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175898040 20:62348204-62348226 TTGCAGAGAAACAATGTGGCAGG + Intronic
1176610584 21:8882273-8882295 TAAGAGAATACCAATTTGGCAGG + Intergenic
1176852443 21:13932560-13932582 TAAGAGAATACCAATTTGGCAGG - Intergenic
1177016220 21:15791055-15791077 TAGAAGAAGAACTAAGTGGTCGG + Intronic
1177185793 21:17794768-17794790 TTAGAAAAGAAAAATGTGGCTGG + Intronic
1178275736 21:31235126-31235148 TGGGAGCAGGACAATGTGCCAGG + Intronic
1180905836 22:19410655-19410677 CAGGAGAAGAGCAAGGTGGCAGG + Intronic
1183613989 22:38930963-38930985 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
1184627813 22:45751225-45751247 TAAAAGAAGAACAAAGAGGCTGG - Intronic
949146922 3:712245-712267 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
949782790 3:7709008-7709030 TAGGAGATAAACAATGTATCGGG - Intronic
950505174 3:13390123-13390145 TAGGAAACGAACACTGTTGCCGG - Intronic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952304743 3:32135819-32135841 TGGGAGAGGAATAATGTAGCAGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952890031 3:38033720-38033742 GAGGACAAGGCCAATGTGGCTGG + Intergenic
953839016 3:46373651-46373673 CAGGAGAAGGACAATGTTGTAGG - Exonic
954044864 3:47920859-47920881 AAGAAGTAGAAAAATGTGGCTGG + Intronic
954060533 3:48062624-48062646 AAGAAAATGAACAATGTGGCTGG + Intronic
954893380 3:53953583-53953605 TAGGAAAACAGCAAAGTGGCCGG - Intergenic
956226269 3:66962400-66962422 TGGGAAAAGAAAAAAGTGGCAGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
958001745 3:87759453-87759475 AAAGAGAAGAACAAAGTGGGAGG + Intergenic
959819234 3:110712863-110712885 TTGGAAAAGAAAAATGTTGCTGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960043206 3:113171065-113171087 AAAGTGAAGAACAATGTGGTGGG + Intergenic
960391514 3:117082962-117082984 TAGGAGCAGAGAAATGGGGCAGG - Intronic
960622189 3:119647762-119647784 TAAAAGAAAAAGAATGTGGCAGG - Intronic
961485776 3:127214909-127214931 TAAGAGAAAAACAATTTGGGTGG + Intergenic
961657395 3:128450785-128450807 CTGGAGAAGACCACTGTGGCTGG - Intergenic
961914783 3:130362570-130362592 AAGGAGAAGAACAAAGTTGGAGG - Intronic
961985603 3:131129873-131129895 AAGGAGAACAACAATGTTGGAGG - Intronic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
964267695 3:154918562-154918584 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
965226677 3:166000143-166000165 TTGGGGAAGAAGTATGTGGCTGG - Intergenic
965414012 3:168369625-168369647 TAAGAGAAGAGCAGTGAGGCTGG - Intergenic
965466966 3:169041569-169041591 TAGATGAATAACAATGTGGTTGG + Intergenic
965604422 3:170484691-170484713 CATGAGAAGAACAAGGTTGCTGG - Intronic
965719868 3:171649969-171649991 TAAGAGAATAAAAATGTGGCAGG + Intronic
966334343 3:178851580-178851602 TAGGAGAATAAAAATGTTTCCGG - Intergenic
966642257 3:182204123-182204145 TAGGAGAATAACTCTGTAGCAGG - Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
967105548 3:186252253-186252275 TGGGAGATGGACAGTGTGGCAGG + Intronic
967355272 3:188562603-188562625 AAGGAGAAGATCCATCTGGCAGG - Intronic
967811425 3:193764349-193764371 GAGGAGAAAAACAATGTGAAGGG - Intergenic
968215499 3:196886252-196886274 TAGGAGAAGAACAGGATGACTGG - Exonic
968351445 3:198057075-198057097 TAAGAGAATACCAATTTGGCAGG - Intergenic
1202737267 3_GL000221v1_random:17057-17079 TAAGAGAATACCAATTTGGCAGG + Intergenic
968635759 4:1678009-1678031 CAGGAGAAGAACAAAGTTGGAGG + Intronic
968958520 4:3730936-3730958 TGGGAAAAGAACAATGTCACAGG - Intergenic
971961863 4:33499054-33499076 CAAGAGAATACCAATGTGGCTGG + Intergenic
972039680 4:34577234-34577256 CAGGAGAAGAATAATGGGCCGGG - Intergenic
972113246 4:35592763-35592785 GAGGAGAAGCACATTGTGACTGG + Intergenic
972342102 4:38161055-38161077 GAAGAGAAGATCAATGGGGCTGG - Intergenic
974272713 4:59673062-59673084 TAGGAGAAAAACAATATTGTTGG + Intergenic
974591901 4:63962016-63962038 CAGAACAAGAACAATATGGCAGG - Intergenic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978781281 4:112557661-112557683 TAGGGCAAGAACACTGAGGCTGG + Intronic
979071277 4:116209994-116210016 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
979113073 4:116783212-116783234 GCAGAGAAGAACAATGAGGCAGG + Intergenic
979647099 4:123082605-123082627 AAGGAAAAGAACAAAGTTGCAGG - Intronic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
982043571 4:151419284-151419306 CAGGAGAAGACCAATGTCCCAGG - Intronic
982213552 4:153060493-153060515 TAGTAGAAAAATAATGAGGCCGG + Intergenic
983054113 4:163081978-163082000 TAAGATAAGTACCATGTGGCCGG + Intergenic
983237318 4:165194173-165194195 AACAAGAAGACCAATGTGGCTGG - Intronic
984048738 4:174836996-174837018 TAGAAGAATAAAAATATGGCTGG + Intronic
984138176 4:175967973-175967995 AAGGAGAAGAACAAAGTTGGAGG + Intronic
985196286 4:187433263-187433285 AAGGAGAAGAACAAGAGGGCTGG - Intergenic
985356395 4:189124066-189124088 TATGTGAAAAACAAAGTGGCCGG - Intergenic
987800518 5:22690588-22690610 AAGGAACAGAACAGTGTGGCAGG + Intronic
989071164 5:37513221-37513243 AAGGTAAAGAACAATGTGGTGGG + Intronic
989712367 5:44414979-44415001 TTGGAAAAGACCAGTGTGGCTGG + Intergenic
991008092 5:61851348-61851370 GAGGAGAAGAACAAAGTTGAAGG + Intergenic
991629444 5:68640773-68640795 AAGGAGAAGAACAAAGTCGGAGG - Intergenic
992121799 5:73601343-73601365 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
992418626 5:76578606-76578628 TAGAAAAAGAATGATGTGGCCGG - Intronic
992911909 5:81403226-81403248 TATGAAAACAAGAATGTGGCAGG - Intergenic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
994757350 5:103810841-103810863 TAAAATAAGACCAATGTGGCTGG - Intergenic
996549279 5:124712713-124712735 TACCAGAAGAACAAAGCGGCTGG + Intronic
996620306 5:125493337-125493359 TAGGATGAGCACAAAGTGGCTGG + Intergenic
996726244 5:126675374-126675396 TAAAAGCTGAACAATGTGGCTGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997428461 5:133820621-133820643 TACAGGAAGAACAATGTGACAGG + Intergenic
1000753129 5:165121940-165121962 TAAGAGAAGAACAATGAATCTGG - Intergenic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1002012030 5:176291003-176291025 TAGGAGAAGGTCAGTGTGACTGG + Intronic
1002215734 5:177631296-177631318 TAGGAGAAGGTCAGTGTGACTGG - Intergenic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005116975 6:22349652-22349674 TAGAAGCAGAAAAATGTGTCTGG - Intergenic
1006230473 6:32581840-32581862 TAGGAGAAAAACAACGTAGAGGG + Intronic
1006606027 6:35258720-35258742 TAGGAGAGGAACTGGGTGGCTGG - Intergenic
1006940337 6:37747911-37747933 CAGTAGGAGAACAAGGTGGCAGG - Intergenic
1008013847 6:46495751-46495773 AAGGAGAAGAACAATGTCAGAGG - Intergenic
1008444195 6:51569654-51569676 TTGTAGCAGAATAATGTGGCAGG - Intergenic
1008625306 6:53309776-53309798 TAGGGAGAGGACAATGTGGCAGG + Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1014990868 6:128074760-128074782 TAACAGAAGGACAATGTGGTTGG + Intronic
1015015810 6:128411298-128411320 TAGAAAAAGTACAATATGGCTGG - Intronic
1015789041 6:136947876-136947898 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1016263681 6:142206648-142206670 AAGGAGAAGAACAAAGTTGGAGG + Intronic
1016373173 6:143394843-143394865 TGGGAAAAGAACACTGGGGCAGG + Intergenic
1018202103 6:161404590-161404612 TAAGAGAACAAAAATGTGTCAGG + Intronic
1018630408 6:165817161-165817183 TGGGAGAAGAAAGATGTGACAGG - Intronic
1020577823 7:9956620-9956642 TAGGAGAGGAAAAAGGTGGATGG + Intergenic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1022069173 7:26894311-26894333 TAAGACAAGAATATTGTGGCTGG - Intronic
1023026342 7:36053865-36053887 GAGGAGAAGAAGAATGTAGGAGG - Intergenic
1025266026 7:57457638-57457660 TAAAAGAAAAAAAATGTGGCTGG - Intronic
1027301570 7:76842645-76842667 AAGGAGAAGAACAAAGTTGGAGG + Intergenic
1027391724 7:77710544-77710566 TAAGAGAAGAACAAAGTGAAGGG - Intronic
1028011736 7:85653629-85653651 AAGGAGAAGAAAAATTTGGTAGG - Intergenic
1028808003 7:95051417-95051439 AAGGAGAAGAACAAAGTTGGAGG - Intronic
1029259569 7:99292635-99292657 TAAGAGGAGGACAATGTGTCTGG + Intergenic
1029520253 7:101056309-101056331 AAGGAGAAGAAGAAAGTCGCAGG - Intronic
1029581519 7:101439597-101439619 TGTGAGAAGACCAGTGTGGCTGG + Intronic
1033205241 7:139414662-139414684 AAGGAAAAGACCAGTGTGGCTGG - Intronic
1033690872 7:143735672-143735694 TAAGACAAAAACTATGTGGCTGG - Intergenic
1034034933 7:147809150-147809172 TAGATGAGGTACAATGTGGCTGG + Intronic
1034037098 7:147836360-147836382 AAAGAGAAGACCAGTGTGGCTGG - Intronic
1036306376 8:7605650-7605672 TAGAAGAAGAGCAGTCTGGCTGG - Intergenic
1036357222 8:8053635-8053657 TAGAAGAAGAGCAGTCTGGCTGG - Intergenic
1037360821 8:18071698-18071720 TAGGAGAAAAAAAAAATGGCAGG - Intronic
1038681196 8:29670116-29670138 TAGAAGAACAGAAATGTGGCAGG + Intergenic
1038800091 8:30741744-30741766 TTAGAAAAGAACATTGTGGCCGG - Intronic
1041334513 8:56765518-56765540 AAGGAGAAGAACAAAGTTGGAGG - Intergenic
1041555819 8:59154297-59154319 AAGGAGAAGAACAAAGTGAGAGG - Intergenic
1042114824 8:65419309-65419331 TATGAGAAAAAGAATATGGCCGG - Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1043666626 8:82822755-82822777 AAGCAGAAGAAAAATATGGCAGG - Intergenic
1045204194 8:100020178-100020200 AAGGAGAAGAAAATTGCGGCCGG - Intronic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1046521847 8:115335154-115335176 AGGGAGAAAACCAATGTGGCGGG - Intergenic
1046546053 8:115651486-115651508 TAGGGGAAGAACACTTTGGCTGG - Intronic
1046655950 8:116894268-116894290 TAGTTGAAGAATAATTTGGCTGG - Intergenic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1047548929 8:125848604-125848626 CAGAAGAAGACCAGTGTGGCTGG - Intergenic
1050435662 9:5607228-5607250 TTGGAGAAGAACAAGGTAGGAGG + Intergenic
1050784247 9:9379475-9379497 AAGGAGAAGAACAAAGTTGGAGG - Intronic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1053242379 9:36506620-36506642 TAAGAGAAGAAGAAAGGGGCTGG - Intergenic
1053298042 9:36929053-36929075 AAGGGGAAGATCATTGTGGCAGG - Intronic
1053501164 9:38594093-38594115 TAAGAGAATACCAATTTGGCAGG - Intergenic
1053660038 9:40266747-40266769 TAAGAGAATACCAATTTGGCAGG + Intronic
1053910412 9:42896094-42896116 TAAGAGAATACCAATTTGGCAGG + Intergenic
1054361031 9:64119437-64119459 TAAGAGAATAACAATTTGGCAGG + Intergenic
1054524560 9:66109470-66109492 TAAGAGAATACCAATTTGGCAGG - Exonic
1054679788 9:67902749-67902771 TAAGAGAATACCAATTTGGCAGG + Intergenic
1055503362 9:76923921-76923943 TTGGATATGAACAATGTGGCAGG + Intergenic
1056023999 9:82473142-82473164 TTGAAGAAGAACAAACTGGCAGG + Intergenic
1057104227 9:92396290-92396312 TTGAAGAAGAACAAAGTTGCAGG - Intronic
1057680560 9:97178600-97178622 TAAGAGAATACCAATTTGGCAGG - Intergenic
1058772676 9:108251882-108251904 AAGGAGAAGAACAAAGTTGTAGG - Intergenic
1058901235 9:109443944-109443966 GAGGTGAAGAGCAAGGTGGCTGG - Intronic
1059686342 9:116640590-116640612 TAGAAGAAGATCACTATGGCTGG + Intronic
1059996880 9:119919382-119919404 TGGGAGAAGAACATTCTGGGTGG - Intergenic
1203693562 Un_GL000214v1:69906-69928 TAAGAGAATACCAATTTGGCAGG - Intergenic
1203705991 Un_KI270742v1:47507-47529 TAAGAGAATACCAATTTGGCAGG + Intergenic
1203558013 Un_KI270744v1:18273-18295 TAAGAGAATACCAATTTGGCAGG - Intergenic
1203642711 Un_KI270751v1:34157-34179 TAAGAGAATACCAATTTGGCAGG + Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1187956835 X:24527367-24527389 TAGGTGAAAAACAAAGTGTCAGG + Intronic
1190414502 X:50167531-50167553 TAGGAGAAGATAAATCTGGAGGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1198084854 X:133272551-133272573 TAGTAGAAGAACATTGTGCTTGG + Intergenic
1198603900 X:138315137-138315159 TAAGAAAAGAACAAAGTGGTGGG + Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1201231234 Y:11866811-11866833 CAGGAGAAGACCAATGTCCCAGG - Intergenic