ID: 1001102451

View in Genome Browser
Species Human (GRCh38)
Location 5:168825336-168825358
Sequence ACTGGAATCCTGCTTTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001102451_1001102454 -6 Left 1001102451 5:168825336-168825358 CCAGTCCAAAGCAGGATTCCAGT 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1001102454 5:168825353-168825375 TCCAGTGGCCTCACCTCCCTTGG 0: 1
1: 0
2: 2
3: 35
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001102451 Original CRISPR ACTGGAATCCTGCTTTGGAC TGG (reversed) Intronic
903292797 1:22325496-22325518 ACTGGAATTCTGCTGTGCCCAGG + Intergenic
904836343 1:33339732-33339754 ACTGGAATACAGCTTAGTACAGG + Intronic
915929189 1:160048200-160048222 ACTGAAAGCCTGATCTGGACGGG + Intronic
916690678 1:167187124-167187146 TCTGGGATCCTGCTATGAACTGG - Intergenic
917494602 1:175528913-175528935 ACTGGCATTGTGCTTGGGACAGG - Intronic
917616973 1:176755800-176755822 ACTGAAAGCCTGCTGTTGACTGG + Intronic
921419777 1:214933100-214933122 AATGGATTCCTGCTTTGCTCTGG + Intergenic
923502147 1:234574203-234574225 TCTGGAATCCTGAATTGGAATGG - Intergenic
1065335303 10:24651226-24651248 AGAAGAATCCTGCTTTGGGCAGG - Intronic
1067178818 10:43969929-43969951 ACTGCAGTCCTGCTTGGCACTGG + Intergenic
1067735782 10:48849062-48849084 ACTGGAATCTGTCTTTGGTCAGG + Intronic
1068492674 10:57743396-57743418 ACTGGAAGCCTCCTTTGGTGGGG + Intergenic
1069514968 10:69070161-69070183 ACTGGAAGCCTGCCCTGGATTGG + Intergenic
1073583085 10:104685357-104685379 ACTGGAATCCTACAGTGGGCAGG + Intronic
1075647730 10:124107647-124107669 AGTGGAATCCAGCTTGGGACGGG - Intergenic
1076803219 10:132842375-132842397 ACCAGAATGCTGATTTGGACAGG - Intronic
1078057735 11:8020704-8020726 ACTGGAATCATGAGGTGGACAGG - Intronic
1078358753 11:10652224-10652246 AATGGAACCCAGCTTGGGACAGG - Intronic
1079187810 11:18253249-18253271 ATTAGAGTCCTGCTTTGGGCAGG - Intergenic
1081213034 11:40359193-40359215 ACTGGTATCCTGCTTTTGAGAGG - Intronic
1089077995 11:115754046-115754068 ACTGGGACACTGATTTGGACCGG - Intergenic
1089243286 11:117099102-117099124 ACTGGAATGCCTGTTTGGACTGG - Intergenic
1090373086 11:126270262-126270284 ACTGGAATCTTTCTTTGGTCTGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092745064 12:11665485-11665507 ACTGAAAGCCTGCTGAGGACAGG + Intronic
1097630484 12:62056009-62056031 ACTGAAATCCTGATTTTGAGTGG - Intronic
1097764270 12:63506110-63506132 ACTGGGATGCTGTTTTGGAAAGG - Intergenic
1100932011 12:99619825-99619847 ACTGGATTCTTGCTTGGCACTGG + Intronic
1101437951 12:104680068-104680090 ACTGGACTCCTGCTGTGTGCAGG + Intronic
1103557324 12:121774647-121774669 ACTGGAACCCTTCTGTGGAGAGG - Exonic
1105622933 13:22086772-22086794 TATGGAATTCTGCTTTGGAGTGG + Intergenic
1106759710 13:32856873-32856895 ACTGGAATCATGCCTAGCACAGG + Intergenic
1107072589 13:36286952-36286974 ACTGGTTTCCTGGTTTGAACAGG - Intronic
1107719224 13:43230357-43230379 GGAGGAATCCTGCTTTGGACAGG + Intronic
1107827606 13:44343142-44343164 ACTTGAATTCTCCTTTGAACTGG - Intergenic
1108801225 13:54097898-54097920 AATGGAAACCTGCTTTGGAGAGG + Intergenic
1112258441 13:97856259-97856281 CCTGCAATCCTTTTTTGGACTGG - Intergenic
1114587770 14:23830178-23830200 ACTGGGAACCTGCTATGGGCTGG + Intergenic
1115994438 14:39181173-39181195 ACTGGAGTACTGGTTGGGACTGG - Exonic
1118798876 14:69171074-69171096 ACTGGCATCCTTATTTGGTCTGG - Intergenic
1124873047 15:33562687-33562709 TCTGAAATCCTGGCTTGGACAGG + Intronic
1126904192 15:53346887-53346909 ACTTGTATCCTGCCTTGGAAAGG + Intergenic
1131542165 15:93283684-93283706 ACTGGCATGCTGCTTTGCTCAGG + Intergenic
1133669576 16:8005248-8005270 CCTGGCATCCTACTTTGGAATGG + Intergenic
1135263500 16:21001227-21001249 CCTGGAATCCCTATTTGGACAGG + Intronic
1140473299 16:75226643-75226665 AGTGGAAGCCAGCTTTGTACTGG - Intergenic
1145815353 17:27791469-27791491 ACAGGATTCTTGCTTAGGACAGG - Intronic
1146055323 17:29577981-29578003 GCTGGAATCCGGCTGTGGCCAGG + Intronic
1146660426 17:34661919-34661941 CCTGGAATTCTGCTTTGAACAGG + Intergenic
1147450664 17:40501974-40501996 ACTGGCATCCTGCTTTGTCAAGG - Intergenic
1147895021 17:43744980-43745002 AGTGGAATCCTGTTTTAGATGGG + Intergenic
1148833790 17:50454542-50454564 GCTGGAATGCTGCTTGTGACGGG - Intronic
1149095610 17:52837109-52837131 ACTCCACTCCTGCTTTGGTCTGG + Intergenic
1151421424 17:74000586-74000608 ACTGGAGTCCTGCCTTGGCCAGG + Intergenic
1151538290 17:74750661-74750683 ACTGGATTTCTGCCTGGGACTGG - Intronic
1152219036 17:79050824-79050846 CCTGCAATCCTGCTCTGTACGGG + Intergenic
1156947759 18:42856078-42856100 ACTGGAATCCTTCTTTCCAAAGG + Intronic
927022595 2:19032845-19032867 TATGAAATCCTGCTTTGGATAGG + Intergenic
928941016 2:36727396-36727418 TCTGGAAACCTGCTGTGGAAGGG + Intronic
940466916 2:154042515-154042537 TCTGGAAGGCTGCTTTAGACTGG - Intronic
941722688 2:168828528-168828550 ACAGGAATCTTGCTTTAAACAGG - Intronic
941959316 2:171238113-171238135 ACTGGGCTCCTGCTGTGCACAGG - Intergenic
946034912 2:216734076-216734098 ACTTGAATTCCACTTTGGACAGG - Intergenic
946195325 2:218029166-218029188 TCTGGAGTCCTGCATTGGAGTGG - Intergenic
948672222 2:239575890-239575912 ACTGGAAGCCTGCTCTGGGTTGG + Intergenic
949006606 2:241652954-241652976 ACTGGACCCCTGCTATGGGCTGG + Intronic
1169603088 20:7284634-7284656 CCTGAAATACTGCTTTGGATAGG - Intergenic
1173046141 20:39514307-39514329 ATTGGGATCCTGCTTTGGTGGGG + Intergenic
1175608233 20:60328840-60328862 ACTGCATTCCTGCTGAGGACTGG - Intergenic
1175632642 20:60555253-60555275 ACTCGCATCCTGCTTTACACAGG - Intergenic
1178205356 21:30457890-30457912 ACTGGAATCATGCTCTGTAGAGG - Intergenic
1184841067 22:47052679-47052701 ACAGGAGTCCTGCTCAGGACAGG - Intronic
951340747 3:21483990-21484012 ACTGGCATCGTAATTTGGACAGG + Intronic
952211321 3:31231719-31231741 AGTGGAATCCTGCATTGCATAGG + Intergenic
953356729 3:42262630-42262652 ATAGGAATCATGCTTTGGATTGG - Intronic
961048414 3:123725775-123725797 ACTGGGATCCTGCTCCCGACTGG - Intronic
961099501 3:124186587-124186609 ACTGGACACCTGCTTAGGACAGG - Intronic
961745376 3:129061007-129061029 ACTGGAAACCTGCTGTGGGTAGG + Intronic
967992408 3:195141249-195141271 ACTGGAATTTGGCTTTTGACTGG - Intronic
968199218 3:196738158-196738180 ACTGTGATCCTGCATAGGACTGG - Intergenic
970222097 4:13821794-13821816 CCTGAAAACCTGCTTAGGACAGG - Intergenic
971037768 4:22713894-22713916 TCTGGACTCCTGCCTTGCACTGG - Intergenic
973637438 4:52873249-52873271 ACTGGAGTCTTTCTTTGGAGGGG + Exonic
985712599 5:1438017-1438039 ACTGGCATCCTGCGCTTGACAGG + Intronic
988385735 5:30562470-30562492 GCTGGAATCCTGTGTTGGGCTGG - Intergenic
993863510 5:93165551-93165573 ACTGGAATCTAACTTTGGATTGG + Intergenic
997531616 5:134584883-134584905 ACTGTGGTCCTGCTTTGGGCTGG - Intergenic
998652297 5:144134502-144134524 ACTGGTAACCTGGTTTGAACTGG + Intergenic
999408479 5:151328079-151328101 GCTGGAATCTTGCTTTGGCCAGG - Intronic
999659118 5:153840434-153840456 TCAAGAATTCTGCTTTGGACTGG - Intergenic
1001102451 5:168825336-168825358 ACTGGAATCCTGCTTTGGACTGG - Intronic
1001606263 5:172962127-172962149 ACTGCAATGCTGCCTTGAACTGG - Intronic
1003367902 6:5494381-5494403 ACTGGAATCCGGGTCTGTACTGG + Intronic
1003663878 6:8090968-8090990 ACTGTAATGCTGCTGTGAACAGG + Intronic
1007673871 6:43579187-43579209 ATTAGAGTCCTGCTTTGGGCAGG - Intronic
1008634187 6:53392985-53393007 ATTAGAGTCCTGCTTTGGGCAGG + Intergenic
1009728009 6:67559574-67559596 ACTTGAATCCTGCATAGTACTGG + Intergenic
1020549408 7:9583055-9583077 AAAGGAATGCTGCTTTGGACAGG - Intergenic
1021523079 7:21555839-21555861 ACTGGAGTCCTTCTCTGCACAGG + Intronic
1023390020 7:39700754-39700776 AATGTAATTCTGTTTTGGACAGG - Intronic
1026033019 7:66811397-66811419 ACTGGAATACACCTTTGGAACGG + Exonic
1030345170 7:108424890-108424912 AGTGGAATCCTGCTTGAGAAAGG - Intronic
1030950550 7:115785729-115785751 ACTGGAATTCTGATTTGGGAAGG + Intergenic
1033797618 7:144866353-144866375 ACTGGACTCCAGCTCTAGACAGG - Intergenic
1034901364 7:154909879-154909901 ACTGGAATCCAGCTGTGCAGGGG - Intergenic
1037910508 8:22741144-22741166 GCTGGCCTCCTGCTTGGGACAGG - Intronic
1038408394 8:27339876-27339898 ACTGGAATCCTGCCCAGGAATGG - Intronic
1038572111 8:28671744-28671766 ACTGAAATGCTGCTTTCCACTGG + Intronic
1041834584 8:62197483-62197505 ACATCAATCCTGCCTTGGACAGG - Intergenic
1046191026 8:110794023-110794045 ATTAGAGTCCTGCCTTGGACAGG - Intergenic
1047543476 8:125793136-125793158 GCTGGAATGCTGCTGTGGAATGG + Intergenic
1049081838 8:140449320-140449342 ACTGGCCTCCTGGCTTGGACAGG - Intronic
1052811166 9:33061878-33061900 ACTGGGATACTGCTGTGGCCTGG - Intronic
1203495167 Un_GL000224v1:144417-144439 AGTACAATCCTGCTTTGGTCTGG + Intergenic
1203507793 Un_KI270741v1:86340-86362 AGTACAATCCTGCTTTGGTCTGG + Intergenic
1186817885 X:13255937-13255959 TCAAGAATCCTGCTTTGGACGGG - Intergenic
1187837410 X:23447482-23447504 ATGGGAAGCCTTCTTTGGACAGG - Intergenic
1193819694 X:86147480-86147502 AGTGGAATCTTGTTTAGGACTGG + Intergenic
1194336983 X:92660184-92660206 ACTAGAGTCCTGCCTTGGGCAGG - Intergenic
1195211369 X:102654375-102654397 GCTGGAATCCTGCTTGGTAATGG - Exonic
1197934876 X:131729692-131729714 ACTGGATTCCTGATGAGGACCGG - Intergenic
1199822649 X:151464541-151464563 ACTGAAATCCAGCTATGGGCTGG + Intergenic
1200645417 Y:5776919-5776941 ACTAGAGTCCTGCCTTGGGCAGG - Intergenic