ID: 1001104759

View in Genome Browser
Species Human (GRCh38)
Location 5:168843707-168843729
Sequence TTAGAGAAGCCCAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001104759_1001104763 6 Left 1001104759 5:168843707-168843729 CCTTCCTCTCTGGGCTTCTCTAA 0: 1
1: 0
2: 6
3: 44
4: 442
Right 1001104763 5:168843736-168843758 GACAGCTAGAAGTGTAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001104759 Original CRISPR TTAGAGAAGCCCAGAGAGGA AGG (reversed) Intronic
900289527 1:1918003-1918025 ATGGCCAAGCCCAGAGAGGAAGG - Exonic
901443839 1:9294953-9294975 CTAGAGAGGCCCAGAGAGGGCGG + Intronic
901841448 1:11956556-11956578 TCAGAGAAGCCCCAAGAGAAAGG - Intronic
902106268 1:14038621-14038643 TCAGTGGAGCCCAGGGAGGAAGG - Intergenic
902558371 1:17260504-17260526 TCACAGCAGCCCAGAGAGGTGGG + Intronic
903741707 1:25562299-25562321 TCAGGGAAGCCCAAAGGGGAAGG + Intronic
904583981 1:31568981-31569003 TTAGCGAAGCCCAGACAGGGTGG + Intergenic
904868904 1:33604075-33604097 TCAGAGAAGCCAAGGGAAGAAGG + Intronic
905279527 1:36840190-36840212 TTATAAAAGCCCAGTGAGGTAGG - Intronic
905772920 1:40649888-40649910 GTTGAGAACCCCAGAGAGGCTGG + Intronic
905867863 1:41386056-41386078 GCAGGCAAGCCCAGAGAGGAGGG - Intergenic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
906155918 1:43613825-43613847 TTTCAGGAGCACAGAGAGGAGGG + Intronic
906255883 1:44349790-44349812 AAAGTGAAGCCCAGAGAGGAAGG + Intronic
907118809 1:51991002-51991024 TCACAAAAGCCCAGAGAGGGAGG + Intergenic
907305036 1:53508595-53508617 CTAGAGAAGCCCAGGGAGAGGGG - Intronic
908089286 1:60669545-60669567 TTCTAGAAGCCTAGAAAGGATGG + Intergenic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
908926660 1:69263973-69263995 TTACAGAAGCAAAGAGATGATGG + Intergenic
908947925 1:69522678-69522700 TTTGAGAGGCCCAGAGGGGGTGG - Intergenic
910199434 1:84683480-84683502 TTCTAGAAGCACAGAGAGAAGGG - Intronic
910884028 1:91947473-91947495 TTGTAGAAGCCCAGAGACAAAGG + Intergenic
912570951 1:110620518-110620540 TGGCAGAAGGCCAGAGAGGAGGG + Intronic
912911965 1:113770407-113770429 ATCGAGAAGTCCAGAGAGGTTGG - Intronic
913073179 1:115319166-115319188 TGAGAGATGACCAGAGAGAAGGG + Intronic
913251162 1:116912750-116912772 CCAGAGAAGACCAGAGGGGAGGG - Intronic
913968819 1:143398417-143398439 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
914063198 1:144224016-144224038 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
914115952 1:144742338-144742360 TGAGATGAGGCCAGAGAGGAGGG + Intergenic
915603886 1:156938916-156938938 ATAGATGAGCCCAGGGAGGAAGG - Intronic
916926441 1:169525932-169525954 TTGGAGAAAACCAGAGAGCAGGG - Exonic
918009320 1:180571952-180571974 TTAAAGAAGACAAGAGAGAAGGG - Intergenic
918311998 1:183291549-183291571 TTAGAGCAGCCCAGGGAAGGTGG + Intronic
918936434 1:190928270-190928292 TTAGAAAAGCAGAGAGATGATGG - Intergenic
919788859 1:201277221-201277243 TTACAGAGGCCCAGAAAGGAGGG - Intergenic
919902290 1:202052972-202052994 TTTGAGAAGCCAAGGCAGGAGGG + Intergenic
920845522 1:209590204-209590226 TTACAGAAGTCAAGAGAGGAGGG + Intronic
920974057 1:210769078-210769100 TCACAGAAGCCCACATAGGAGGG + Intronic
921167883 1:212520012-212520034 TTACAGAAGCTCAGAAAGGATGG + Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921344368 1:214166852-214166874 TTACAGATGCCCAGAGATTAAGG + Intergenic
921951432 1:220934357-220934379 TGAGAGGAGCCCAGTGGGGAGGG - Intergenic
922084026 1:222328242-222328264 TTACAGAAGCCAAAGGAGGAGGG - Intergenic
922089786 1:222384931-222384953 TGAGGCAAGCCCAGTGAGGAAGG - Intergenic
922455270 1:225769190-225769212 GAAGATAAGCCCAGAGAGGGGGG - Intergenic
922937534 1:229433462-229433484 TCAGGGAGGCGCAGAGAGGATGG - Intronic
922950467 1:229554813-229554835 TTCCTGAAGCCCAGTGAGGATGG - Intronic
923288956 1:232525984-232526006 TTTGAGGAGCCAAGAGAGGAAGG + Intronic
923490837 1:234482687-234482709 TTAGTGGGGCACAGAGAGGAGGG - Intergenic
924048403 1:240055668-240055690 GTAGGGAACCCCAGAGAAGATGG + Intronic
1064347325 10:14544103-14544125 TTAGAGAGGCCCACACGGGAAGG + Intronic
1064720202 10:18221071-18221093 TTAGAGAGGCTCAGAGAAGAGGG + Intronic
1065699635 10:28412180-28412202 TTGGAGGAGTCCAGAGAGGATGG - Intergenic
1068692642 10:59932699-59932721 GTAGAGAAGAGAAGAGAGGAAGG + Intergenic
1068786909 10:60986866-60986888 TTAGAGAGGCACAGAAAGGGAGG - Intronic
1070356493 10:75645438-75645460 GTAGAAGAGGCCAGAGAGGAGGG + Intronic
1070528097 10:77312290-77312312 TGAGAGAAGGGAAGAGAGGAAGG + Intronic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071807775 10:89142968-89142990 AAAGAGAAACCCAGGGAGGAAGG - Intergenic
1071862707 10:89690672-89690694 AGAGAGAATCCCAGACAGGATGG - Intergenic
1071885205 10:89942313-89942335 TTAGAAGAGACCACAGAGGAAGG - Intergenic
1071994655 10:91135820-91135842 CTAGAAAAGTACAGAGAGGATGG - Intergenic
1072450389 10:95534882-95534904 TTGGGGAAGCACAGAGTGGAGGG - Intronic
1073117762 10:101101610-101101632 TAAGACAAGACCAGAGAAGAAGG + Intronic
1073204603 10:101762287-101762309 TGAGAGCAGCCCAGGGAGGGAGG - Intergenic
1073387643 10:103140159-103140181 TTTGAGAGGCCGAGATAGGAGGG - Intronic
1073866498 10:107810371-107810393 TAAGAGAAGATGAGAGAGGAAGG - Intergenic
1074307101 10:112289026-112289048 AGATAGAAGCCCAGAGAGGTTGG - Intronic
1074845512 10:117393962-117393984 TGAGAGAAGGCCAGTGAGGCTGG - Intergenic
1075122072 10:119671641-119671663 TCAGAGCAGCCCAGTGAGGGAGG + Intronic
1076172130 10:128328129-128328151 ATAGAGAAGCTCAGAGAAAAGGG + Intergenic
1076321474 10:129585273-129585295 TTACAGAAGGCCACAGAGGGAGG + Intronic
1076405172 10:130206952-130206974 CTGCAGAAGACCAGAGAGGAAGG - Intergenic
1076545839 10:131245316-131245338 TCAGAGAACCCCAAAGAGGTAGG - Intronic
1076619287 10:131776745-131776767 TGAGAGAGGCCAAGACAGGATGG + Intergenic
1076995128 11:294035-294057 GGACAGCAGCCCAGAGAGGACGG + Intronic
1078017046 11:7623989-7624011 TGAGTGGAGCCCAGAGTGGAGGG + Intronic
1078480077 11:11667892-11667914 CTAGAGAAGCTTGGAGAGGAGGG + Intergenic
1078655646 11:13236387-13236409 TTAGGGAAGCCTAGGGAGGGTGG - Intergenic
1079149590 11:17885564-17885586 TTTGAGAGGCCGAGGGAGGAGGG - Intronic
1079619407 11:22534961-22534983 TTAGGAGAGCCCAGAGAGAAAGG - Intergenic
1079802611 11:24889103-24889125 TTACAGAAGCCAAAAGGGGATGG + Intronic
1080245227 11:30172559-30172581 TTAGAGATACCCAAAGAGTAAGG + Intergenic
1082833638 11:57637656-57637678 GTGGGGGAGCCCAGAGAGGAAGG - Intergenic
1083140245 11:60715462-60715484 TTATGGAAGCCCAGAAAGGGAGG - Exonic
1084231163 11:67754306-67754328 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
1084235398 11:67785037-67785059 TTGGGGAAGCCTGGAGAGGAGGG + Intergenic
1084497749 11:69514862-69514884 TTCCAGGAGCCCAGTGAGGAAGG + Intergenic
1085051114 11:73380756-73380778 GGAGAGAGGACCAGAGAGGAAGG + Intronic
1085350115 11:75792822-75792844 TTACTGAGGCACAGAGAGGAGGG + Intronic
1085374255 11:76044166-76044188 TTAGAGGAGTCCTTAGAGGAGGG - Intronic
1086290308 11:85301231-85301253 TTAGAGAAGGACAAAGAGAATGG + Intronic
1087301554 11:96442143-96442165 GTGGAGAATCCCAGAGAGGAGGG + Intronic
1087998062 11:104836703-104836725 ATAGAGGAGCCCATAGAAGAGGG - Intergenic
1088850373 11:113699030-113699052 TTAGAGAAGAACAAAGAGAAAGG + Intronic
1089293295 11:117451264-117451286 AGAGACAGGCCCAGAGAGGAGGG - Intronic
1089397009 11:118142852-118142874 TGACAGAAGCCCAGACAGAAAGG + Intronic
1089708162 11:120295695-120295717 TTAGAGATGCCAAGTGTGGATGG + Intronic
1090427565 11:126619339-126619361 GGAGATGAGCCCAGAGAGGAAGG + Intronic
1090927036 11:131258544-131258566 TAGGAGCAGCCCAGGGAGGAGGG + Intergenic
1092302373 12:7264048-7264070 CTAGACAAACTCAGAGAGGAAGG - Intergenic
1094031969 12:26022364-26022386 AAAGACAAGCCCAGAGAGGGAGG + Intronic
1095205120 12:39430808-39430830 TTAGATAAGGTCATAGAGGAAGG + Intronic
1095347151 12:41164633-41164655 TAAGTGAAGCCCAGAGTTGAAGG + Intergenic
1095853040 12:46831409-46831431 TAAGAGAAGCCTAGGGAGGAGGG - Intronic
1095970450 12:47898117-47898139 TGGTGGAAGCCCAGAGAGGAAGG + Intronic
1097181327 12:57173694-57173716 TTAGAGAAGCCCACAGGGTCTGG + Intronic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097349499 12:58532970-58532992 TTAGTGAATCACAGGGAGGAAGG - Intergenic
1097743011 12:63267609-63267631 TTTGGGAAGCCCAGAGAAGCTGG + Intergenic
1098107796 12:67088888-67088910 TTAGAGCTGCCCAGGGAGAAAGG - Intergenic
1098981697 12:76963146-76963168 TTACAGAACCCCAGATGGGAGGG + Intergenic
1099328002 12:81244262-81244284 CTAGAGAAAGCCAGAGTGGAGGG - Intronic
1099444845 12:82740600-82740622 TTAGAGAATCCCAGCAGGGAAGG - Intronic
1100793618 12:98157241-98157263 TTAGAAAAGGCCACAGAGGCCGG + Intergenic
1101392428 12:104314134-104314156 TGAGATGAGACCAGAGAGGAAGG + Intronic
1101640514 12:106583237-106583259 CTAGAGATGCCCAGGGAGGAAGG - Intronic
1101880496 12:108622750-108622772 TTAGAGGGACCCAGAGAAGATGG + Intronic
1102274951 12:111574663-111574685 TTTGGGAAGCCAAGGGAGGAGGG - Intronic
1102772038 12:115486447-115486469 CTAGAGAAGAGCAGAGAGGAGGG + Intergenic
1102838571 12:116092305-116092327 TTAGAGATGCCCAGATAAGAAGG - Intronic
1106013772 13:25848989-25849011 CTTGAGAGGCCCAGAGAGTAAGG + Intronic
1106286706 13:28324335-28324357 CTAGAAAAGCCCAGGAAGGATGG - Intronic
1106585390 13:31052635-31052657 TTAGAGAACCCCTGAATGGAGGG + Intergenic
1106803058 13:33276278-33276300 TTACAGAAGTCCAGACAGTAAGG + Intronic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1108503362 13:51087734-51087756 TAAGAGATCCCCACAGAGGATGG + Intergenic
1109244877 13:59941479-59941501 TTAGAGACCCCCAGAGCAGAGGG + Intronic
1111364306 13:87221680-87221702 TGAAAGAAGCCTAGAAAGGAAGG + Intergenic
1112150207 13:96751327-96751349 CTAGAGAGACCCAGAGAAGAGGG + Intronic
1113160561 13:107376110-107376132 TTGGAGAGGCCCAGATGGGAAGG + Intronic
1113276136 13:108732663-108732685 TTAGGGAAGCCCTGGGAAGAAGG + Intronic
1113961928 13:114131053-114131075 TTTGAGTAGTCCAGAGAGGAGGG - Intronic
1115906827 14:38210348-38210370 TGAGAGAAAGCCATAGAGGATGG - Exonic
1116154273 14:41184339-41184361 TTAGAGAAATCCAAAGATGAGGG + Intergenic
1117090819 14:52248226-52248248 TCAGAGCACCACAGAGAGGAAGG + Intergenic
1117116405 14:52517663-52517685 TTCGAGTAGGCAAGAGAGGATGG - Intronic
1118231036 14:63950116-63950138 TGGAAGAAGCACAGAGAGGAAGG - Intronic
1118325018 14:64774711-64774733 TCAGGGGAGTCCAGAGAGGAAGG - Intronic
1119113425 14:71996495-71996517 TTATGGGATCCCAGAGAGGAAGG + Intronic
1119432557 14:74578042-74578064 ACACAGAAGCCCAGAGGGGAGGG + Intronic
1119514715 14:75239164-75239186 TTAGAGAATTCCAGTGAAGAGGG + Exonic
1119533690 14:75382121-75382143 TTAGGGAAGCCCAAAGACAATGG + Intergenic
1120769236 14:88360568-88360590 TTAGAGAAGTGCAGAGTGAAGGG - Intergenic
1121282572 14:92709921-92709943 TGAGAGAAGGCCAGAGAGAGAGG + Intronic
1121554094 14:94823262-94823284 TTAAAGAAGCTCAGAGAGGTTGG + Intergenic
1122107122 14:99466664-99466686 TGAGGGAAGCACAGTGAGGAAGG + Intronic
1122487397 14:102090198-102090220 TTAGAGAAGAACAGAGGGAATGG - Intronic
1124203381 15:27697484-27697506 GAACAGAAGCCCAGTGAGGACGG + Intergenic
1125034411 15:35107211-35107233 CTGGAGAAGCCCAGAGAATATGG + Intergenic
1125357009 15:38826837-38826859 TTAGGGAAGACAAGAGAGCATGG + Intergenic
1125759176 15:42085319-42085341 TTAGGGAAACACAGAGAGGAAGG - Intronic
1126696565 15:51330768-51330790 TCATGGAAGCTCAGAGAGGAAGG + Intronic
1127702992 15:61519258-61519280 GAAAATAAGCCCAGAGAGGAGGG - Intergenic
1128028953 15:64462156-64462178 TTGGAGGAGGCCAGAGAGAAAGG + Intronic
1128405005 15:67327759-67327781 TTAAAGGAGCCCAGCCAGGATGG - Intronic
1128511169 15:68314695-68314717 TTAGAGCAGGGCAGAGAGCAAGG + Intronic
1129901461 15:79154295-79154317 GTCCAGAAGCCCAGAGAGGAGGG + Intergenic
1130070178 15:80640444-80640466 GGAGAGAAGCCCAGAGTGAATGG - Intergenic
1130088026 15:80795050-80795072 TGAGAGAAGCCCAGATTGGCTGG + Intronic
1130624108 15:85495785-85495807 TGAGAGAAAACAAGAGAGGAAGG - Intronic
1130645371 15:85721044-85721066 TTAGATGAAACCAGAGAGGAGGG - Intronic
1131181039 15:90240263-90240285 TTTGGGAAGCCGAGAGGGGAGGG + Intronic
1131301330 15:91202150-91202172 TTAGGGAAGACCAGAGGCGACGG - Intronic
1131719045 15:95147212-95147234 CTGGAGAAGCCCAAAGAGTAGGG + Intergenic
1132324193 15:100953313-100953335 TTAAAGAAGCCGAGAGTGAATGG - Intronic
1133282236 16:4673361-4673383 AAAGAGAAGTCCAGAGGGGAGGG - Intronic
1133439042 16:5805245-5805267 TTAGAGAGGGTCAGACAGGATGG + Intergenic
1133923677 16:10177703-10177725 TTTGAGAAGTCCAGGGAGTATGG - Intronic
1134840064 16:17394624-17394646 TTAGAGAAAACAACAGAGGAGGG + Intronic
1135065320 16:19304839-19304861 TGAAAGAAGATCAGAGAGGAAGG + Intronic
1135500637 16:22992889-22992911 TTAGAGAATGCCAAAGGGGAAGG - Intergenic
1136079509 16:27842528-27842550 CTAGAGAAGGGCACAGAGGAAGG - Intronic
1136109044 16:28053123-28053145 GGAGAGAGGCCCAGAGAGAAGGG + Intronic
1137932061 16:52598214-52598236 GGAGAGAAGCCCAAAGAGGGGGG + Intergenic
1137946244 16:52735572-52735594 ATAGAGAAGCCAAGAGGGGATGG - Intergenic
1138146895 16:54620686-54620708 TCAGAGAAAGCCAGACAGGAGGG + Intergenic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138332167 16:56223964-56223986 TTAGAGAAGGTCAGAGATGAAGG + Intronic
1141426819 16:83949625-83949647 GAACAGAAGCCCAGAGAGGGAGG + Intronic
1203141197 16_KI270728v1_random:1767920-1767942 TGTGAGAAGCTCAGAGAGGCTGG - Intergenic
1143378157 17:6479417-6479439 TCTGAGCTGCCCAGAGAGGAGGG - Intronic
1143628651 17:8124776-8124798 TTACAGAAGCCCAGTGAAGTAGG + Intergenic
1143688285 17:8537561-8537583 TTAGAGGAGCTCAGAGTGGCAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144451604 17:15384587-15384609 GTACAGAAGCCCAGAGGGAATGG + Intergenic
1144513261 17:15895792-15895814 TTAGGGAAGCAAAGAGAGGGAGG + Intergenic
1144796683 17:17896204-17896226 TTAGAGAATCCTAGAGAGAAGGG - Intronic
1145887483 17:28392671-28392693 AGAAAAAAGCCCAGAGAGGAAGG - Intronic
1146387077 17:32386696-32386718 CAAGATAATCCCAGAGAGGAAGG + Intergenic
1146424023 17:32718716-32718738 TTACAGAAGCCAAGAGAAGATGG - Intronic
1146543174 17:33715446-33715468 TGAGACAAGCACAAAGAGGATGG + Intronic
1147949730 17:44100339-44100361 CTAGAGAAGCCCTGGGGGGAGGG + Intronic
1148357550 17:46985743-46985765 CAATGGAAGCCCAGAGAGGATGG - Intronic
1149207745 17:54267941-54267963 TAAGAGAAGCCCAGACTTGATGG - Intergenic
1149459210 17:56813338-56813360 ATAGAGAAGCCAAGAGAGTGGGG - Intronic
1150599568 17:66639026-66639048 TTGGAGAAACCCTGAGAGAAAGG + Intronic
1151076793 17:71282619-71282641 GAAGAGAAGACAAGAGAGGAGGG + Intergenic
1152251968 17:79217029-79217051 TGAGAGAGGCCCAGAGTGGGGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152805505 17:82353977-82353999 TGGAAGAAGGCCAGAGAGGAAGG - Intergenic
1153172198 18:2328897-2328919 TTACTGAAAGCCAGAGAGGAGGG - Intergenic
1153200397 18:2641768-2641790 CTAGAGAAGCACTCAGAGGAGGG - Intergenic
1153864754 18:9254801-9254823 TCAGAAAAGACCAGAGAGGAGGG + Exonic
1154127173 18:11701985-11702007 TTAGAGAATCACTGAAAGGAAGG + Intronic
1155514416 18:26610040-26610062 TTAGAGAAGCCAAGAGAATAAGG + Intronic
1155950239 18:31903476-31903498 TTAGGGAAGAACAGGGAGGAGGG - Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156859277 18:41817291-41817313 TTAGAGAATTCCAGCAAGGAGGG + Intergenic
1157132643 18:45021743-45021765 TTAGAGAAAGCTGGAGAGGAGGG - Intronic
1159938152 18:74384951-74384973 TTAGAGAAGCACAGTGTGGAAGG - Intergenic
1161566592 19:5006064-5006086 TTAGTGAAGGACAGAGAAGAAGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1164449622 19:28349780-28349802 TTAGAGAAGCTCAGAGAAACAGG + Intergenic
1164663348 19:30000054-30000076 TTAGAGAAGCAGAGACAGGGAGG - Intronic
1164678589 19:30119341-30119363 TTCCCGAAGCCCAGAGAGCAGGG + Intergenic
1165968692 19:39606598-39606620 TTAGAGAAAGCCAGAAAGTATGG - Intronic
1166010164 19:39935616-39935638 GTAAAGATGCCCAGAGAGGCTGG - Intergenic
1166274933 19:41746782-41746804 TTAGAAAACACCAGAGAGGCAGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167729000 19:51239472-51239494 TTAGAGCAGGGCAGTGAGGAGGG - Intronic
1168385968 19:55963426-55963448 TTAGAGAAGCACAGAGTGTTGGG - Intronic
1202702608 1_KI270712v1_random:175887-175909 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925212335 2:2060685-2060707 GAAGAGAAGGGCAGAGAGGAGGG - Intronic
925929719 2:8697278-8697300 TTAGAGCAGGCCACAGAGGAAGG + Intergenic
925961083 2:9017227-9017249 TTTGGGAGGCCCAGACAGGAGGG - Intergenic
926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG + Intergenic
926213923 2:10891914-10891936 GAAAAGAAGCTCAGAGAGGACGG + Intergenic
926475833 2:13321055-13321077 TTCGTGAAGAACAGAGAGGATGG - Intergenic
926960823 2:18356696-18356718 TAAGAGAAGAAAAGAGAGGAGGG + Intronic
927187651 2:20493335-20493357 TTTGAGAGGCCAAGACAGGAGGG - Intergenic
927997376 2:27495305-27495327 TGGGAGGAGCCCCGAGAGGACGG - Intergenic
928231688 2:29504266-29504288 TGAGAGAAGGTCAGAGAGGTGGG + Intronic
928412800 2:31067356-31067378 CTAGAGAAGCCCTGAGAGTCTGG + Intronic
929362235 2:41106010-41106032 TTACAGAAGCCAAGAGAGTGTGG + Intergenic
929817248 2:45243079-45243101 TTACAGAAGAGTAGAGAGGATGG - Intergenic
930594569 2:53371113-53371135 TTTGAGAAGACTAGAAAGGAAGG - Intergenic
931835881 2:66097937-66097959 GAAGAGAAGCCCACAGAGGAGGG + Intergenic
932423399 2:71614235-71614257 CTTGCAAAGCCCAGAGAGGAGGG - Intronic
933767218 2:85718503-85718525 GAAGAGAAGCCCACAGAGGTAGG - Intergenic
933799670 2:85950653-85950675 TCAGAGAAGCCAGGAGAGGAAGG - Intergenic
933985429 2:87587845-87587867 TTAGAAAAGTCCAGTGAAGAAGG + Intergenic
934169135 2:89324937-89324959 TTAGAGCAGCACACATAGGAAGG + Intergenic
934173518 2:89559340-89559362 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
934198158 2:89857647-89857669 TTAGAGCAGCACACATAGGAAGG - Intergenic
934283832 2:91633693-91633715 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
934790579 2:97056324-97056346 TTAGAGCAGCACACATAGGAGGG - Intergenic
934815885 2:97326207-97326229 TTAGAGCAGCACACATAGGAGGG + Intergenic
934821810 2:97382276-97382298 TTAGAGCAGCACACATAGGAGGG - Intergenic
935829012 2:106979780-106979802 CTATAGAAGCAAAGAGAGGAGGG + Intergenic
936308412 2:111362964-111362986 TTAGAAAAGTCCAGTGAAGAAGG - Intergenic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937255602 2:120553176-120553198 ACAGAAAAGCCTAGAGAGGATGG - Intergenic
937262417 2:120595086-120595108 TGACAGAAGCCCAGAGGGGCGGG - Intergenic
937355596 2:121196315-121196337 TTGGAGCAGCCAAGAGAGGCAGG + Intergenic
937962070 2:127467704-127467726 TTATAGTAGCCCAGATGGGATGG - Intronic
938385043 2:130859504-130859526 TTAGAGAGGCCAAGGCAGGAGGG + Intronic
938385424 2:130862980-130863002 TTAGAGAGGCCAAGGCAGGAGGG + Intronic
939531062 2:143362364-143362386 CCAAAGAAGCCCAGAGAAGAAGG - Intronic
939667135 2:144965713-144965735 TTAGAGAAGCTGTGAGAAGAGGG + Intergenic
940164660 2:150756890-150756912 TCAGAGAAGCCCAGATAGGAGGG + Intergenic
940515542 2:154680005-154680027 TAAGAGAAGCCCAAACAGTATGG + Intergenic
940657884 2:156510372-156510394 TTAGAGTAGATCAGAGATGAGGG + Intronic
940886534 2:158994511-158994533 TTGGGGAAGCCAAGGGAGGAAGG - Intronic
941343719 2:164340342-164340364 GGAGAGAAGGACAGAGAGGAAGG - Intergenic
941654569 2:168129279-168129301 TTAAAGAAGGTCAGAAAGGAGGG - Intronic
942281917 2:174373992-174374014 GTAGAAGAGCCCTGAGAGGAGGG - Intronic
942309766 2:174645015-174645037 ATAGAGAAGCCTAGAGTAGAGGG + Intronic
943486569 2:188492523-188492545 TTAGAAAAGCCCAGTGAGATTGG + Intronic
943781468 2:191828956-191828978 GAAGAGAAGCCCTGAGTGGAAGG - Intergenic
944928676 2:204493302-204493324 TTAGAGATGCCAAGATAGTATGG + Intergenic
944967856 2:204956093-204956115 TTAAATAAGCCCAAAGAGCATGG - Intronic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
945933222 2:215877396-215877418 TTAGAGAAGCCCACATTGCAAGG + Intergenic
946540469 2:220678962-220678984 TTAAAGAAGCTCAGAGTAGAGGG - Intergenic
946683557 2:222243721-222243743 TTATAGAACCCAAGAGAAGATGG - Intronic
947668031 2:231919262-231919284 TTAGAGGCTCCCTGAGAGGAAGG + Intergenic
948000136 2:234560829-234560851 GGATAGAAGCACAGAGAGGAGGG + Intergenic
948529010 2:238591491-238591513 GTAGAGCAGCCCAGACACGATGG + Intergenic
948694094 2:239724522-239724544 TCAGAGAAGCCAAGATAGGCGGG - Intergenic
1169187774 20:3633183-3633205 GCAGAGAGGCCCAGAGATGAAGG + Intronic
1170770829 20:19331055-19331077 TTAGAGGAGACCAGGGAGGTGGG + Intronic
1170870120 20:20198044-20198066 TTGGAGAAGTCCAGAGGGAATGG + Intronic
1171136247 20:22697065-22697087 TTAGAGAACATGAGAGAGGAGGG - Intergenic
1172259561 20:33550863-33550885 TTTGGGAAGCCGAGAGGGGACGG - Intronic
1172264687 20:33600791-33600813 TTAGGGAAGTTCAGAGATGAAGG - Intronic
1172806028 20:37612482-37612504 ACAGAGAACCCCAGAGAGAAGGG + Intergenic
1173017617 20:39239786-39239808 TGAGAGAAACTCAGAGAGGAAGG + Intergenic
1173137415 20:40451484-40451506 TTGGAGCATACCAGAGAGGAGGG - Intergenic
1173436047 20:43033250-43033272 GGAGAGAGACCCAGAGAGGAAGG - Intronic
1173656429 20:44703198-44703220 TTCCAGAAGCCCAGGGTGGAGGG - Intergenic
1173668541 20:44780890-44780912 TTTGAGAACCCTAGAGAGGGAGG + Intronic
1173772787 20:45677926-45677948 CTAGAGAAGACAAGAGAGAAAGG - Intergenic
1173924273 20:46769134-46769156 AGAGGAAAGCCCAGAGAGGAGGG - Intergenic
1174736954 20:52973469-52973491 CCAGAGAAGGCGAGAGAGGACGG - Intronic
1175116860 20:56688985-56689007 TCAGAGAAGGCCAGAGAGGATGG + Intergenic
1175370211 20:58483253-58483275 CTAGAGAAGCACAGAGCGGCTGG + Intronic
1176426824 21:6553308-6553330 TTAAAGATGTCCAGTGAGGAAGG + Intergenic
1177815292 21:25969893-25969915 TTAGAGAAGAGAAGAGGGGAGGG + Intronic
1178428546 21:32499097-32499119 GTAGAGGAGCTCAGAGGGGAAGG - Intronic
1179702315 21:43161630-43161652 TTAAAGATGTCCAGTGAGGAAGG + Intronic
1179810773 21:43867628-43867650 TTTGACAAGGCCAGAGAGGGGGG - Intronic
1179819860 21:43930513-43930535 TGAGAGAGGCCCAGAGAACAGGG - Intronic
1181534495 22:23534492-23534514 TCAGAGCACCCCAGAGGGGAAGG + Intergenic
1181878782 22:25960730-25960752 CTATAGAAGCCCAGACTGGAGGG - Intronic
1182153336 22:28047017-28047039 TCAGAGACGGCCAGAGAGAAGGG + Intronic
1182536642 22:31008669-31008691 TTAGAGATACACAGAGAGGAAGG + Intergenic
1182709471 22:32311592-32311614 CTATGGAAACCCAGAGAGGAGGG - Intergenic
1184085010 22:42256097-42256119 TTGGAGAAGCCGGTAGAGGAGGG - Intronic
1184268429 22:43363431-43363453 TTAGAGAAGCCCAAAGCTGGCGG + Intergenic
949470310 3:4388991-4389013 TTAGAAAACTCCACAGAGGAAGG + Intronic
950408516 3:12819464-12819486 GTAGAGAAGCCCAGTAAAGAGGG - Intronic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
953663223 3:44906044-44906066 ATAGATAAGGCCAGAGAGGGAGG + Intronic
953987599 3:47457342-47457364 TTAGAGAAGCTCAGAGAAGAGGG - Intronic
954807605 3:53229541-53229563 ATTCAGAAGCCCAGAAAGGATGG - Intronic
955230978 3:57098482-57098504 GTAGAGAAGGGCAGAGAGAATGG - Exonic
956405799 3:68927654-68927676 TTTGAGAGGCCGAGACAGGAGGG + Intronic
956551763 3:70468862-70468884 TTAGAAAAGCACATAGAGAAAGG + Intergenic
957025507 3:75177328-75177350 TTTGAGAAGCCAAGGCAGGAGGG - Intergenic
957047710 3:75389190-75389212 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
957102843 3:75849980-75850002 TTTGATGAGCTCAGAGAGGAAGG - Intergenic
957705174 3:83770652-83770674 TCAGAGCAGGACAGAGAGGATGG + Intergenic
959677047 3:109048156-109048178 TTAAGGAAGAACAGAGAGGAGGG + Intronic
960144146 3:114181379-114181401 ATAGTGAAGTCCAGAGAGAAAGG - Intronic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
961070278 3:123917705-123917727 TTAGAGAAGCCTGGAGAGGCAGG + Intronic
961303115 3:125934760-125934782 TTGGGGAAGCCGGGAGAGGAGGG - Intronic
961505791 3:127369866-127369888 TAAGAGATGCCCAGTGAGGGTGG - Intergenic
961879785 3:130053317-130053339 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
962390660 3:134969442-134969464 TTAGAGGAGCCCTGGGAGGCAGG + Intronic
962390942 3:134972151-134972173 TTAGAGGAGCCCTGGGAGGCAGG - Intronic
962943020 3:140142720-140142742 GGAGAGAAACCCAGAGAAGAAGG + Intronic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966384230 3:179378344-179378366 TTAAATAAGCACATAGAGGATGG + Exonic
967265043 3:187683066-187683088 TTAGGGAAGCCATGACAGGAAGG - Intergenic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
968530538 4:1089061-1089083 CTAGAGAAGCCATGAGAAGAGGG + Intronic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
968991993 4:3920425-3920447 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
968994149 4:3935213-3935235 TTGGAGAAGCCGGGAGAGGAGGG + Intergenic
969410634 4:7025717-7025739 AAAGGGAGGCCCAGAGAGGAGGG + Intronic
969823349 4:9737253-9737275 GAAGAGGAGCTCAGAGAGGAAGG - Intergenic
969827379 4:9768153-9768175 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
969999069 4:11345533-11345555 TTAGAGAAGCCTAAATAGGTAGG + Intergenic
970386116 4:15558474-15558496 TCAAAGAAGCCTAGAGAGGATGG - Intronic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
970561336 4:17284776-17284798 TGAAGGAAGCCCAGAGATGAAGG + Intergenic
973743682 4:53942954-53942976 TTAGAGAAGGTCACAGAGGCTGG + Intronic
973901490 4:55477863-55477885 TAAGGGAAGCCAAGGGAGGAGGG + Intronic
976026029 4:80688700-80688722 TTTGAGAAGCTGAGAGAAGAAGG + Intronic
977333365 4:95664862-95664884 TTTGACAAGCTGAGAGAGGAAGG + Intergenic
977492338 4:97731471-97731493 GTTGGGAAGCCTAGAGAGGAAGG + Intronic
979910118 4:126354620-126354642 TTACAGAAGCCCAGAGGTGTGGG - Intergenic
980887944 4:138784025-138784047 TAAGAGCAGCCAAGAGAGCAAGG - Intergenic
981872950 4:149508248-149508270 CTAGAGAAGCTGAGAGAAGAGGG + Intergenic
981891295 4:149741245-149741267 TTAAAGAAGACCAGAGAATAAGG - Intergenic
983472855 4:168177734-168177756 TTACAGGGGACCAGAGAGGAAGG + Exonic
983822856 4:172217947-172217969 TTAGAGAAGCCCAAATACAAAGG - Intronic
984720151 4:182963986-182964008 TTAAAGAAGCTGAGAGAAGAAGG - Intergenic
985968612 5:3356981-3357003 TCAGAGGAGCCCTGATAGGAAGG + Intergenic
986473079 5:8094919-8094941 ACAGAGTTGCCCAGAGAGGAAGG + Intergenic
987285961 5:16456825-16456847 TTAGAGATGACCAGACAGGAGGG + Intronic
988951040 5:36260577-36260599 TAATAGAAACCCACAGAGGAAGG - Intronic
989201304 5:38766842-38766864 TCACAGAAGCCAAGAGAAGAAGG + Intergenic
989349152 5:40465097-40465119 TTTGAGAAGCTCAGAGTGAAGGG + Intergenic
989603377 5:43220849-43220871 TTGAAGAAGCCGAGAGAAGAAGG + Intronic
990452676 5:55950637-55950659 TTAGAAAACCCAAGGGAGGAGGG + Intronic
992760483 5:79947133-79947155 TTAGGAAAGCCCAGCGAGGCAGG - Intergenic
992955902 5:81907768-81907790 TCAGAGAAGCCAAGACAGGGAGG - Intergenic
997189915 5:131922143-131922165 GTAGAAAAGTCTAGAGAGGAAGG - Intronic
997468859 5:134105458-134105480 TCACAGCAGCCCAGAGAGGTAGG - Intergenic
998647894 5:144084194-144084216 TCACAGAAGCCAAGTGAGGATGG - Intergenic
999028934 5:148268411-148268433 TTAGAGAAGACTAGAAAGGCTGG + Exonic
999308077 5:150533517-150533539 TGAGAGAGCCCCAAAGAGGAAGG - Intronic
1001104759 5:168843707-168843729 TTAGAGAAGCCCAGAGAGGAAGG - Intronic
1001405986 5:171477980-171478002 TTAGAGAGGCCCTAAGGGGAGGG + Intergenic
1001853623 5:174991453-174991475 TGAAAGAAGACCAGAGAGGCTGG - Intergenic
1001953140 5:175830072-175830094 TTTCAGAACCCCAGAGAGCACGG - Intronic
1002320808 5:178374583-178374605 TTACAGCAGCCCAGTGAGGTAGG - Intronic
1002441696 5:179267600-179267622 GGAGAGCAGCCCACAGAGGAGGG + Intronic
1002579374 5:180198393-180198415 TAAGAGTCTCCCAGAGAGGAAGG + Intronic
1004011033 6:11687520-11687542 CTAGCTAAGCCCACAGAGGAGGG + Intergenic
1004359134 6:14955364-14955386 TTAGAGAAGTGGAGAGAGCAGGG + Intergenic
1005089579 6:22042769-22042791 TTAGGGAAGCCCAGAGGAGGGGG + Intergenic
1005609549 6:27510482-27510504 TTAGGGAAGCTCTGAGAGTATGG + Intergenic
1005879582 6:30045609-30045631 TTAGTGAAGCCCAGAGTGGGTGG - Intergenic
1005897693 6:30192024-30192046 TGTGAGCAGCCCAGAGAGGGTGG + Intronic
1005901376 6:30219669-30219691 TTTGAGAAAACAAGAGAGGATGG - Intergenic
1006936024 6:37718814-37718836 TTTGGGAAGCCGAGGGAGGAAGG + Intergenic
1007025793 6:38572064-38572086 TTAGAAAAGGCCAGAGATGGGGG - Intronic
1007229353 6:40337690-40337712 TTAGAGAAACGCAGAGATGGAGG + Intergenic
1007421861 6:41724479-41724501 CCAGAGAGGCCCAGGGAGGATGG + Intronic
1010769469 6:79812101-79812123 TTAGGTAAACCCAGGGAGGAGGG - Intergenic
1012152362 6:95770245-95770267 GTAGAGAAGTTCAGAGAGTAGGG - Intergenic
1012930520 6:105311354-105311376 TAAGAGAAGCCCAGTGAGTAAGG - Intronic
1013511147 6:110845279-110845301 TTTGAGAAGCCAAGACAGGTGGG - Intronic
1014140799 6:117939793-117939815 TTAAATTAGCCCAGAGAGGTAGG + Intronic
1014595886 6:123338281-123338303 TTAGAGAAACAGAGAGAGAATGG + Intronic
1014748195 6:125224633-125224655 CAAGAGTAGCCCAGAGAGGCAGG + Intronic
1014986002 6:128010468-128010490 ATAGAGAAGCCAAGAGGAGAAGG - Intronic
1016857402 6:148684667-148684689 TGCCAGAAGCCCAGACAGGATGG + Intergenic
1017078323 6:150640634-150640656 TTACACAAGGCCTGAGAGGAGGG - Intronic
1017137456 6:151160964-151160986 TGAGAGATGCCCAGGTAGGAGGG + Intergenic
1017148389 6:151255553-151255575 TTTGAGAAGCCGAGGCAGGAGGG + Intronic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1018288010 6:162261706-162261728 GTAGATAAGCCCAGAAAGTAAGG - Intronic
1018593537 6:165453826-165453848 CTAGAGAAGCCCTGGGAGCAAGG + Intronic
1019171656 6:170136420-170136442 TTAGAGAAGCAAAGGGTGGACGG - Intergenic
1019444270 7:1063065-1063087 ATGGAGGAGCCCAGAGAGAACGG - Intronic
1020314812 7:6897996-6898018 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
1021909941 7:25375478-25375500 ATAGAGAAACCCAGAGAGGCTGG - Intergenic
1022457114 7:30567105-30567127 CTAGAGCAGCCCAGGGATGAAGG - Intergenic
1022495675 7:30851689-30851711 AAACAGAAGCCCAGAGAGGGAGG + Intronic
1022762143 7:33366151-33366173 CCAGGGAACCCCAGAGAGGAAGG - Intronic
1024728984 7:52233823-52233845 TGAGAGAAGGCAATAGAGGAAGG + Intergenic
1025994737 7:66520714-66520736 ATAAATAAGCCCGGAGAGGAGGG - Intergenic
1026926579 7:74198259-74198281 TCAGAGAAGCCCAGTGAGCCTGG - Intergenic
1027185834 7:75970091-75970113 TTAGCGTAGCCCAGAGAGGTGGG + Intronic
1028451788 7:90993446-90993468 TTGGAGCAGGCAAGAGAGGATGG + Intronic
1028587605 7:92467526-92467548 TAAGAGAAGCCCTGACATGAGGG - Intergenic
1029304641 7:99609978-99610000 TTTGGGAAGCCGAGACAGGAGGG - Intergenic
1029385128 7:100238586-100238608 TTCGAGAAGCAAAGATAGGAAGG - Intronic
1029440203 7:100583139-100583161 CCAGAGAAGCCCAGATGGGAGGG - Intronic
1029884174 7:103849555-103849577 ATAGATAAGCCCAGAGATGTAGG - Intronic
1030997151 7:116372392-116372414 TTTGACAAGCTGAGAGAGGAAGG + Intronic
1031712934 7:125072246-125072268 CATGAGCAGCCCAGAGAGGAAGG - Intergenic
1032227874 7:130047987-130048009 TTAGAGAAGCCCACATAGCAAGG + Intronic
1032485249 7:132282032-132282054 TTAGAGAGGCACAGAGATGCTGG - Intronic
1032851541 7:135799467-135799489 TCAGAGAAGTCCAGCAAGGAGGG - Intergenic
1033150996 7:138915019-138915041 TTAGAGCAGTCCAGGGAGGAGGG - Intronic
1033383034 7:140842516-140842538 TTATTGGAGCCCAGAGATGAAGG - Intronic
1033547748 7:142417093-142417115 AAAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033550496 7:142442778-142442800 AGAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033650012 7:143333969-143333991 TTTGGGAAGCCGAGAGAGGTGGG + Intronic
1035555743 8:565860-565882 TCAGAGACCCCCAGAGAGGCAGG + Intergenic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1040893276 8:52339303-52339325 TCAGAGAAGCCCAGAGGGAGAGG - Intronic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042484859 8:69337997-69338019 ATAGTGAGGCCCACAGAGGACGG + Intergenic
1045103652 8:98869538-98869560 TTTGAGAAACACAGAAAGGAAGG + Intronic
1046229328 8:111332616-111332638 TTCGAGAAGGTCAGAGAGAATGG + Intergenic
1046819716 8:118621813-118621835 TTAGGGAAGCTCTGAGAGAATGG - Exonic
1047007204 8:120632652-120632674 CTAGAGGAGCACAGAGAGAAGGG + Intronic
1047295531 8:123567360-123567382 TTACAAAAACCCAGAGAGGTGGG + Intergenic
1047328661 8:123864965-123864987 TTTGAGGAGCTGAGAGAGGAAGG - Intronic
1047689203 8:127333728-127333750 TTACAGAAGACCAGAGAACATGG + Intergenic
1047922960 8:129654153-129654175 TTGGGAAAGGCCAGAGAGGAGGG - Intergenic
1047959794 8:130002853-130002875 TTTGGGAAGCCAAGCGAGGAGGG + Intronic
1048225994 8:132586125-132586147 TTAGAGAAGGAGAGAGAGAACGG + Intronic
1048402899 8:134088407-134088429 TTAGTGAACTTCAGAGAGGATGG - Intergenic
1049106043 8:140613771-140613793 TTAGGGAAGCCGAGGCAGGAGGG + Intronic
1049378365 8:142300250-142300272 TTAGGGAAACCCAGGAAGGAGGG + Intronic
1049675681 8:143887910-143887932 ATAGAAAAGCCCAGAGAGTTGGG + Intergenic
1050679453 9:8093271-8093293 TTAGAGAAGGTAGGAGAGGAAGG - Intergenic
1052340714 9:27361832-27361854 TTTGAGCTGCCCAGAAAGGAAGG - Intronic
1053120031 9:35539373-35539395 TTAGAAATGCCCAAAAAGGAAGG - Intronic
1053295255 9:36908254-36908276 AAAGAGAAGCCAAGAGTGGATGG + Intronic
1054998796 9:71425058-71425080 TTACAGAGGCCAAGAGTGGAAGG - Intronic
1056474193 9:86937260-86937282 TTACAGAAGACAAGAGAGGGGGG + Intergenic
1057645819 9:96874649-96874671 GCAGAAAAGCCCAGACAGGACGG - Intronic
1058462578 9:105196812-105196834 TTATAGAAGCTGAGAGAAGATGG + Intergenic
1058861730 9:109123054-109123076 TTGGAGTAGGACAGAGAGGAGGG - Intergenic
1059936801 9:119320038-119320060 TGAGAGAACCCCATAGAAGAGGG + Intronic
1060213376 9:121723929-121723951 TCAGAGAAGCCCTGGGAGGTGGG - Intronic
1061504052 9:131020683-131020705 TGAGAGAATGACAGAGAGGAGGG + Intronic
1186159910 X:6766339-6766361 TTAGAGTATCCCAGATAAGAAGG - Intergenic
1186814246 X:13220303-13220325 TTACAGATGCCCAGACAGTAGGG + Intergenic
1186863917 X:13700342-13700364 TTGGAGAAGGCCAGAGAAAAGGG + Intronic
1187027979 X:15455949-15455971 TTTGAGGAGCTCAGAGAAGATGG - Exonic
1187494913 X:19787081-19787103 TTAGAGATCCCAGGAGAGGAGGG - Intronic
1187560387 X:20397504-20397526 TTACTAAAACCCAGAGAGGAGGG - Intergenic
1188007254 X:25023769-25023791 TTAGAGAATCCCAGAAAGGCTGG + Intergenic
1188059396 X:25582411-25582433 TTTGAGAGGCCCAGTGATGAAGG + Intergenic
1189083858 X:38000123-38000145 TTGGGGAAGCCCAGACAGGTTGG + Intronic
1189360821 X:40349555-40349577 TGGCAGAAGCCCAGAGAGTATGG - Intergenic
1190873292 X:54442670-54442692 TAACTGAAGCCCAGAGAGGAAGG + Intronic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193046628 X:77061098-77061120 TTAGAGTAGCCCAGGGAAGGGGG + Intergenic
1195014895 X:100768815-100768837 ATACAAAAGCCCAGACAGGAAGG - Intergenic
1195229500 X:102831863-102831885 TTAGGGAAGCCCTGAGAGGAGGG + Intergenic
1195259970 X:103122373-103122395 TTAGGGAAGCCCTGAGAGGAAGG - Intergenic
1197311291 X:124908824-124908846 TCAGAGTAGCCCTGAGAGAAAGG + Intronic
1197574962 X:128200079-128200101 TTAGATGAGCTGAGAGAGGAAGG + Intergenic
1199161335 X:144615467-144615489 TTAGGGAAACCCAGAGAAGCAGG - Intergenic
1199574109 X:149296915-149296937 CCACAGAGGCCCAGAGAGGAAGG - Intergenic
1199831597 X:151554169-151554191 CTGGAAAAGGCCAGAGAGGAAGG + Intergenic
1199843857 X:151676618-151676640 TTGGAGAAGCCCAGAGAGAATGG + Exonic
1199908162 X:152256974-152256996 TAAGAGAATCCCAGAAGGGATGG + Intronic
1199924882 X:152451574-152451596 AGAGGGAAGCCCAGAGAGAAAGG + Intergenic
1202026565 Y:20529913-20529935 TAAGGGCAGCCCAGAGAGAAAGG + Intergenic