ID: 1001106337

View in Genome Browser
Species Human (GRCh38)
Location 5:168857850-168857872
Sequence CCTGATAGGCACACCGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001106337_1001106342 3 Left 1001106337 5:168857850-168857872 CCCTCAACGGTGTGCCTATCAGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1001106342 5:168857876-168857898 AGATTCACGTAGGAGTTCTTAGG 0: 1
1: 0
2: 1
3: 2
4: 85
1001106337_1001106343 6 Left 1001106337 5:168857850-168857872 CCCTCAACGGTGTGCCTATCAGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1001106343 5:168857879-168857901 TTCACGTAGGAGTTCTTAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 57
1001106337_1001106345 17 Left 1001106337 5:168857850-168857872 CCCTCAACGGTGTGCCTATCAGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1001106345 5:168857890-168857912 GTTCTTAGGCGGGACAAGACTGG No data
1001106337_1001106344 7 Left 1001106337 5:168857850-168857872 CCCTCAACGGTGTGCCTATCAGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1001106344 5:168857880-168857902 TCACGTAGGAGTTCTTAGGCGGG No data
1001106337_1001106341 -7 Left 1001106337 5:168857850-168857872 CCCTCAACGGTGTGCCTATCAGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1001106341 5:168857866-168857888 TATCAGGTAGAGATTCACGTAGG 0: 1
1: 0
2: 1
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001106337 Original CRISPR CCTGATAGGCACACCGTTGA GGG (reversed) Intronic
900803415 1:4751701-4751723 CCTGGTGGCCACACCGATGATGG + Intronic
907224192 1:52929083-52929105 CCAGATAGGCACATCATTAATGG - Intronic
908363251 1:63390638-63390660 CCAGATAGGCACACCACTGTAGG - Intronic
913146007 1:115990666-115990688 CCAGAGAGGCCCACCATTGATGG + Intronic
915972331 1:160363389-160363411 CCTGAGAGGTAGATCGTTGAGGG - Intergenic
919817642 1:201451452-201451474 CCTGCTGGGCACACCCTTGGTGG + Intergenic
1068795846 10:61079150-61079172 CATGATAGCCACACTTTTGATGG - Intergenic
1073608303 10:104918090-104918112 ACTGTTAGGCACACTGTTGGTGG - Intronic
1077982938 11:7319750-7319772 CCTGAGAGTCACATCGTTAAAGG - Intronic
1080360305 11:31506036-31506058 CCTGATCCGCACACTGTTCAAGG + Intronic
1082805654 11:57448243-57448265 CCCGCTAGGCACTCCGTTAATGG - Intergenic
1083529775 11:63409166-63409188 TGTGATATGCACACTGTTGAAGG + Intronic
1084379699 11:68803875-68803897 CCTACCAGGCACACCGCTGAAGG + Intronic
1088378493 11:109167945-109167967 CCTGAGAGGCACACTTTGGAAGG + Intergenic
1094649777 12:32364309-32364331 TCTGCTAGGCTCACCCTTGAAGG - Intronic
1096747780 12:53739552-53739574 CCTGATGGGCACACCCCTGCAGG - Intergenic
1113405304 13:110033325-110033347 ACTGATAGGCACACCATAAAAGG + Intergenic
1131774867 15:95783953-95783975 CCTGATAGGCACTCAGTAAATGG - Intergenic
1142297091 16:89231413-89231435 CCTGATATGCCCACTGTTGGTGG + Exonic
1149434725 17:56623588-56623610 CCTGAGTGGCATACCATTGAAGG - Intergenic
925590825 2:5507763-5507785 CCTGAAGGGAACACTGTTGAAGG - Intergenic
942783279 2:179671603-179671625 CATCATAGGCACACAGTAGAAGG + Intronic
1178982492 21:37276652-37276674 CCTGATGGAGACACTGTTGAAGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184443561 22:44534100-44534122 CCAGATAGGCACATCAATGATGG + Intergenic
956012229 3:64844171-64844193 ACTGATGGGCACACCATGGAAGG - Intergenic
959694422 3:109234278-109234300 CCTGAGAGCCACACCGGTCAGGG + Intergenic
985702856 5:1384018-1384040 CCTGATGGGCTCAGCGCTGATGG - Intergenic
993349525 5:86831238-86831260 CCTCAAAGTCACACCCTTGAGGG + Intergenic
996031688 5:118712114-118712136 CTGGATAGGCTCACTGTTGAAGG + Intergenic
996059972 5:119022420-119022442 CCAGATAGGGAGAACGTTGAAGG + Intergenic
1001106337 5:168857850-168857872 CCTGATAGGCACACCGTTGAGGG - Intronic
1008814548 6:55549565-55549587 CCTGATAGCCACAAAGTTGAAGG + Intronic
1014504938 6:122243186-122243208 CCTGAAAGGCACACTGAAGAAGG + Intergenic
1016200746 6:141404175-141404197 CCTGATAGGCAATCCAATGAAGG - Intergenic
1017443463 6:154486098-154486120 CCACAAAGGCACACCCTTGAAGG - Intronic
1032635070 7:133697785-133697807 CTTGATAGGACCACTGTTGAAGG + Intronic
1041150875 8:54932850-54932872 CCTGATAGGCAAATGGTTAATGG + Intergenic
1042228692 8:66535843-66535865 CTTGATAGGTACAGCATTGAGGG - Intergenic