ID: 1001106431

View in Genome Browser
Species Human (GRCh38)
Location 5:168858528-168858550
Sequence CTATGTAAGTGGCATTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001106431_1001106439 20 Left 1001106431 5:168858528-168858550 CCATCCAAATGCCACTTACATAG 0: 1
1: 0
2: 2
3: 11
4: 154
Right 1001106439 5:168858571-168858593 AACTCCCCTGCAGCAGCGTTGGG No data
1001106431_1001106438 19 Left 1001106431 5:168858528-168858550 CCATCCAAATGCCACTTACATAG 0: 1
1: 0
2: 2
3: 11
4: 154
Right 1001106438 5:168858570-168858592 AAACTCCCCTGCAGCAGCGTTGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001106431 Original CRISPR CTATGTAAGTGGCATTTGGA TGG (reversed) Intronic
902743020 1:18453362-18453384 CTTTGTAAGGGGCATTTGACTGG - Intergenic
903640239 1:24854625-24854647 ATATGTTGATGGCATTTGGAGGG + Intergenic
905456744 1:38093453-38093475 CTATGTACCTGGCATTGGGCTGG - Intergenic
907776764 1:57523389-57523411 CTATGCAAGTGGGGTTGGGATGG - Intronic
907811039 1:57870149-57870171 ATATCTAAGTGGCATATGCAAGG + Intronic
909723531 1:78806251-78806273 TTATTAAAGTTGCATTTGGAAGG + Intergenic
912076619 1:105883847-105883869 CGATGTTGGTGGCCTTTGGATGG + Intergenic
912222084 1:107689819-107689841 CTATAAAAGTGCCATTTGGCTGG + Intronic
912586656 1:110772599-110772621 CTTTATAAGGGGCATTGGGAAGG - Intergenic
916849277 1:168686560-168686582 GTGTGTAAGTGGAATTTGAAGGG + Intergenic
922171591 1:223160020-223160042 CAATGTAAGTGGCAGCTGTAGGG - Intergenic
1067927529 10:50525386-50525408 CTGTCTGGGTGGCATTTGGAAGG - Intronic
1069241212 10:66141594-66141616 ATATTTAAGTGAGATTTGGAGGG + Intronic
1071006476 10:80889591-80889613 CAATCTAAGTGGCTTTTGGGAGG - Intergenic
1074834231 10:117273877-117273899 TCATGAAAGGGGCATTTGGAGGG + Intronic
1076522947 10:131092247-131092269 CTGTGTGAGTGGCATTTTCATGG + Intergenic
1078580315 11:12534456-12534478 CTTTGATACTGGCATTTGGAAGG + Intergenic
1083192598 11:61063105-61063127 CTATGTAAGTTGCCTTGGCAGGG - Intergenic
1083591653 11:63898909-63898931 GTCTGTAAGTGGCCCTTGGAGGG + Intronic
1089353139 11:117832655-117832677 CCATGTCAGTGGCATCCGGAAGG - Intronic
1089539939 11:119183695-119183717 CAAAGCATGTGGCATTTGGATGG + Exonic
1093386679 12:18565208-18565230 TTATGTAAATGTCATCTGGAAGG + Intronic
1094172854 12:27512422-27512444 CCATTTATGTAGCATTTGGATGG - Intergenic
1098661823 12:73103963-73103985 CTGAGTAAGTGGCCTTTGGATGG - Intergenic
1099071861 12:78054612-78054634 ATATGGTAGTGGCATTTGTAGGG + Intronic
1099963166 12:89416356-89416378 CAATATAAGTGGAATTGGGAAGG + Intergenic
1100934671 12:99649144-99649166 GTATATAAGTGGCAATTGCAGGG - Intronic
1101369860 12:104116875-104116897 CTAAGTATGTGACATTTGGAAGG + Intergenic
1102193076 12:111003954-111003976 CTCTGTAAATGCCAGTTGGAGGG - Intergenic
1102848153 12:116210071-116210093 ATATGTAAGTTGCAGTGGGAAGG - Intronic
1103270942 12:119673253-119673275 CTATGTAGGTGTCATTAGCAAGG + Intronic
1106396267 13:29383849-29383871 CTATGTAAGTGGCCTGTGGATGG - Intronic
1106446669 13:29839427-29839449 CCATCTAAGTTGCATTTAGAGGG + Intronic
1107850420 13:44566910-44566932 CTATATAAGTGGGATGTGGGGGG + Intronic
1107908144 13:45081089-45081111 TTATGTAAGTAGCAGTTAGAGGG - Intergenic
1108507229 13:51123408-51123430 GTGTGTAATTTGCATTTGGAAGG - Intergenic
1112092113 13:96092047-96092069 CTCCCTAAGTGGCTTTTGGATGG + Intronic
1115020089 14:28668779-28668801 TAATGTAAGTGGCATTATGATGG - Intergenic
1115286060 14:31713592-31713614 CCTTTTAAGTGGCATGTGGATGG + Intronic
1118411389 14:65482411-65482433 TCATGTAAGAGGAATTTGGAGGG - Intronic
1119546475 14:75475465-75475487 CCATGTAAGTGCCATGAGGATGG + Intergenic
1121493441 14:94376271-94376293 TTATTTAACTGGCATTTGGTAGG - Intergenic
1121817624 14:96940635-96940657 CCATTTAAGTGAAATTTGGAGGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1130406047 15:83602870-83602892 CATTGTAAGTGGGCTTTGGAGGG + Intronic
1138803786 16:60068429-60068451 CTATGTAAATTGAATTTAGAAGG + Intergenic
1139010103 16:62621577-62621599 CTATGTAAATTCCATTTTGAAGG - Intergenic
1141192576 16:81835073-81835095 CCAAGTAAGTGGCACCTGGAAGG - Intronic
1142968236 17:3594213-3594235 CTATGGAAATGGCAATTAGAAGG - Intronic
1142994048 17:3750635-3750657 CAGAGGAAGTGGCATTTGGATGG + Intronic
1144224504 17:13131831-13131853 TACTGTAAGTGGCATTTGGGAGG - Intergenic
1144328503 17:14204387-14204409 CTCAGTAAGTGGCATCTGTATGG + Intronic
1148835326 17:50462941-50462963 CCATGTAAGTGGCATGAGAACGG + Intronic
1149021588 17:51972864-51972886 TTATATAGGTAGCATTTGGATGG - Intronic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1157731750 18:50010086-50010108 CTGTGTAATTGGCATTTGGCAGG + Intronic
1163604978 19:18269262-18269284 GTAGGTAAATGGCATATGGAAGG + Intronic
1166628705 19:44385952-44385974 CCATAGAAGTGGCATTTGAAGGG - Exonic
1168163191 19:54526649-54526671 CTCTGGAAGTGGCATTGGCAAGG - Intergenic
925964867 2:9055141-9055163 CTATGTACTTGGGAGTTGGAAGG + Intergenic
926484266 2:13435377-13435399 CTATCTATGTGGCCTGTGGATGG - Intergenic
930802060 2:55453195-55453217 CTAGGTATGTGGCCCTTGGAAGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935902733 2:107810025-107810047 CCCTGTGAGTGGCATTTGGAGGG + Intergenic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936001757 2:108838471-108838493 CTTTGTACATGGCTTTTGGAGGG + Intronic
936018617 2:108978059-108978081 CTATGTCAGTGCCATTTGTCGGG - Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936417982 2:112336968-112336990 CTGTAAAAGTGACATTTGGATGG - Exonic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936739981 2:115493308-115493330 GTATGTAAATGGAATTTTGAGGG + Intronic
936804463 2:116311577-116311599 AAATGTAATTGGCATTTTGATGG - Intergenic
938544911 2:132319233-132319255 CTACAGAAGTGGCATTTGAAGGG + Intergenic
939218612 2:139273249-139273271 CTATGTAAAAGGCATTTAGATGG - Intergenic
941540214 2:166772885-166772907 CTATATAAGAGGCATTTTTATGG - Intergenic
942522350 2:176817714-176817736 ATATACAGGTGGCATTTGGATGG + Intergenic
945426949 2:209717489-209717511 CTATGTAATTAGCATTTAAAGGG - Intronic
945506756 2:210651193-210651215 TTAGGCAAGTGGAATTTGGAGGG + Intronic
945827177 2:214736411-214736433 CTCTGTAAGTACCATTGGGAAGG - Intronic
1169797744 20:9482855-9482877 CTGTGTAAAAGGGATTTGGAGGG - Intergenic
1177759932 21:25391932-25391954 CTAAGTCAGTGGCAGTGGGAAGG - Intergenic
1178111049 21:29370504-29370526 CTAAGGAAGTAGCATGTGGAAGG + Intronic
1178844902 21:36166502-36166524 CTATATAAGTGACATATAGATGG + Intronic
949612656 3:5718785-5718807 GTATGTAAGAAGCATTTGCATGG + Intergenic
950359423 3:12440020-12440042 CTATGTATGTGGCCTTGGGTAGG + Intergenic
950379072 3:12595702-12595724 CCAAGAAAGTGGCATTTGCATGG - Intronic
951251892 3:20403640-20403662 CTATGACAGTGTAATTTGGAAGG - Intergenic
954510735 3:51122678-51122700 CTTGGTTAGTGGCATTTGCATGG + Intronic
955439858 3:58943558-58943580 CGATGTTAGTGACCTTTGGATGG - Intronic
958608135 3:96386937-96386959 TTTTGTAAGTGGCATGAGGAAGG + Intergenic
959110388 3:102115885-102115907 CCTTGTATGTGCCATTTGGAAGG - Intronic
964203585 3:154145804-154145826 CTGTGTAAATGGCAATTTGAGGG + Intronic
966999395 3:185317856-185317878 TTTTGTAAGTGGCATTAGAATGG - Intronic
969967072 4:11007990-11008012 CTGTGGAGGTGGCATTTGGATGG + Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971420403 4:26469019-26469041 CCATGTAAGGGGCATTAGTAAGG + Intergenic
971819574 4:31533711-31533733 ATGTGTAAGTGGCATTAGGCTGG + Intergenic
975109140 4:70604648-70604670 CTATGTGTGTGGCACATGGAAGG - Intronic
975440526 4:74405403-74405425 TTATTTAAGAGGCATTAGGAAGG + Intergenic
976655812 4:87488250-87488272 TGATGTTAGTGGCCTTTGGATGG + Intronic
978160192 4:105537624-105537646 CTGAGTAAGTGCAATTTGGATGG - Intergenic
978744935 4:112182167-112182189 CTTTGGATGTGGCATATGGATGG + Intronic
978974915 4:114857850-114857872 CTAAGAAAGAGGCATGTGGATGG + Intronic
981017434 4:139988568-139988590 ATCTGTAAATGGCAGTTGGATGG - Intronic
982244734 4:153340328-153340350 CTATGCAAGTGGCTTATGGAGGG - Intergenic
982678982 4:158407586-158407608 AAATGTATGTGACATTTGGAGGG - Intronic
982706499 4:158715927-158715949 CTATGTAAGTGGCATTAGGTGGG + Intronic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
990332260 5:54739784-54739806 TTAAGGAAGTGGCAATTGGAGGG - Intergenic
991004436 5:61813753-61813775 CTAAGTAACTGGCTTTAGGAAGG + Intergenic
992234736 5:74697815-74697837 TTTTGTAAGTGGCATTAGAAAGG + Intronic
999623491 5:153495838-153495860 CTTTGGAAGGGGCATTTGGTTGG + Intronic
1000786591 5:165552233-165552255 TAATTTAAGTGGAATTTGGATGG - Intergenic
1001106431 5:168858528-168858550 CTATGTAAGTGGCATTTGGATGG - Intronic
1001287905 5:170437116-170437138 TGACCTAAGTGGCATTTGGAAGG + Intronic
1003237057 6:4304261-4304283 TGATGCAAGTGGCATTTGCAAGG - Intergenic
1003783097 6:9451465-9451487 CGATGGAAGTGGCATTAGGCGGG - Intergenic
1008193412 6:48487981-48488003 CTCTGTAAGTTGAATTTGGTTGG - Intergenic
1009056929 6:58347241-58347263 TTAAGTAACTGGGATTTGGAGGG + Intergenic
1009606440 6:65874847-65874869 CTATGTATCTGGCATTTGGCAGG - Intergenic
1013891027 6:115027350-115027372 ATATGAAATAGGCATTTGGATGG + Intergenic
1014203508 6:118630004-118630026 CTTGATAAGTGGCTTTTGGAAGG + Intronic
1014885334 6:126773627-126773649 CTATGTGTGTGGTATTTGGAGGG - Intergenic
1015122189 6:129711809-129711831 CTATGGAAGTGGAAATGGGAAGG - Intergenic
1015700624 6:136032417-136032439 CTTTGTAAGTGCATTTTGGAGGG - Intronic
1015768532 6:136745054-136745076 CAGTGTAAGTGGTATTTGGCTGG + Intronic
1017014550 6:150089503-150089525 CTATGTTACTGGCATTTCCAGGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1020083863 7:5300242-5300264 AAATGTAAGTGGAATTTGGGGGG + Intronic
1021623885 7:22573784-22573806 CTAAGGAAATGGAATTTGGATGG + Intronic
1022067238 7:26871825-26871847 CTTTGCAAGTGGCTTTGGGAGGG - Intronic
1022254262 7:28640594-28640616 CTATGAAAGTTGCCTTTGTATGG + Intronic
1024010848 7:45265544-45265566 CTGTGCAAATGGCATTTTGAAGG + Intergenic
1025210412 7:57016947-57016969 AAATGTAAGTGGAATTTGGGGGG - Intergenic
1025661544 7:63559900-63559922 AAATGTAAGTGGAATTTGGGGGG + Intergenic
1025925220 7:65953596-65953618 CTATAAAACTGGCATTTGGCTGG + Intronic
1029979159 7:104862138-104862160 CAAAGAAGGTGGCATTTGGAGGG - Intronic
1032563403 7:132915364-132915386 TTCTGGAAGTGGCATGTGGAGGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033374829 7:140748726-140748748 CTATGTTAGTACCTTTTGGAAGG + Intronic
1039167753 8:34704248-34704270 CAAAGCAAGTGTCATTTGGAAGG + Intergenic
1039809590 8:41034524-41034546 CTCTGACAATGGCATTTGGAGGG - Intergenic
1039812430 8:41061463-41061485 CTATGTTAGTATCAGTTGGAAGG + Intergenic
1041388757 8:57330653-57330675 CCAAGGAGGTGGCATTTGGATGG - Intergenic
1042528476 8:69790993-69791015 CTATGTAAGTAACATTGGAAGGG - Intronic
1043468410 8:80537257-80537279 CCATATAAATGGCATTTTGATGG - Intergenic
1044483398 8:92719952-92719974 CAATGTAAGTGCAATTTGAATGG - Intergenic
1045728906 8:105210835-105210857 CTTTGTAAATGGCATATAGATGG + Intronic
1045852364 8:106717620-106717642 CTATGTAAGTGTCATAAGGCAGG + Intronic
1048058114 8:130888708-130888730 CTTTGTAAATTGCATTTGAATGG + Intronic
1050640799 9:7665427-7665449 CTATCTAAGTGAAATTGGGAAGG + Intergenic
1051967723 9:22848809-22848831 ATATGTTAGTGGCAGTTGAAGGG - Intergenic
1052524239 9:29592892-29592914 CTATCTAAAGGTCATTTGGAGGG + Intergenic
1053103589 9:35391655-35391677 CTCACTAAGTGGCATCTGGAGGG - Intronic
1054953549 9:70881910-70881932 CTAAGTATCTGGCATTTAGAGGG + Intronic
1056862586 9:90200427-90200449 CTATGTATGTAGCATTTACATGG - Intergenic
1057898790 9:98931496-98931518 AGATGTTAGTGGCATTTGGCAGG - Intergenic
1058029376 9:100178114-100178136 CTATGTTGGTGACCTTTGGATGG - Intronic
1060593553 9:124834544-124834566 CTTTGTAAGTGGCATTTGATGGG + Intergenic
1186637527 X:11422424-11422446 CCATGTAAGGAGCACTTGGAAGG + Intronic
1193107119 X:77688594-77688616 CTGTGTAAATAGGATTTGGATGG - Intronic
1199390170 X:147269629-147269651 CTAGGCAAGTGGCATTAGAAGGG + Intergenic
1199623638 X:149720990-149721012 TTAGGCAAGTGGCATTTGAAGGG + Intergenic