ID: 1001108278

View in Genome Browser
Species Human (GRCh38)
Location 5:168874406-168874428
Sequence GCTCAATAAACAATAAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001108278_1001108281 28 Left 1001108278 5:168874406-168874428 CCTTCGCTTATTGTTTATTGAGC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1001108281 5:168874457-168874479 TAAAAACAGAACAATGAAAAAGG 0: 1
1: 0
2: 18
3: 159
4: 2071
1001108278_1001108280 -4 Left 1001108278 5:168874406-168874428 CCTTCGCTTATTGTTTATTGAGC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1001108280 5:168874425-168874447 GAGCATTACATACTAGGCATAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1001108278_1001108279 -10 Left 1001108278 5:168874406-168874428 CCTTCGCTTATTGTTTATTGAGC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1001108279 5:168874419-168874441 TTTATTGAGCATTACATACTAGG 0: 1
1: 0
2: 3
3: 22
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001108278 Original CRISPR GCTCAATAAACAATAAGCGA AGG (reversed) Intronic
905287919 1:36896193-36896215 ACTGAAGAAAGAATAAGCGAAGG + Intronic
905389653 1:37628330-37628352 GCTTAACAAACAATTAGAGACGG - Intronic
908964544 1:69742788-69742810 GCTCTATAAACAATAAGGTCAGG - Intronic
916161925 1:161925468-161925490 ACTCAATAAACATTCAGAGAAGG + Intronic
918559350 1:185845981-185846003 GGTCAATAAACAGTAATCAATGG - Intronic
918706699 1:187671988-187672010 GCTCAATAAACAACTATTGAGGG - Intergenic
921576091 1:216836646-216836668 GCTCAGAAAAAAATAAGCAATGG - Intronic
923568466 1:235093865-235093887 GCTCAACAAACATTTAGCGAAGG - Intergenic
924048627 1:240058274-240058296 GGTCAATAAAAAACAAGGGATGG - Intronic
1071336466 10:84604491-84604513 GCTCAATAAACATCCAGTGAAGG + Intergenic
1071892175 10:90022083-90022105 GCCCAATATAAAATAAGCCAGGG + Intergenic
1074607831 10:114991861-114991883 TCTCAAAAAAAAAAAAGCGAGGG - Intergenic
1079958344 11:26891505-26891527 GCTCCATTAAAAATAAGCAAAGG + Intergenic
1081194467 11:40144338-40144360 GCTCAATAAACAATGAATGAAGG - Intronic
1084990942 11:72925055-72925077 GCTCAAAAAAAAATAAGGCATGG + Intronic
1085916359 11:80893140-80893162 GTTCAATGAACAATAAGACAGGG + Intergenic
1086726758 11:90195622-90195644 GCTGAATAAAAAATAAGCAATGG + Intergenic
1087704093 11:101469037-101469059 TGTCAATAATCAAGAAGCGATGG - Intronic
1090617217 11:128526109-128526131 GCACAATAAACAATGAGGGTAGG + Intronic
1090857980 11:130627685-130627707 GCTCAATTAAAAATGAGCAAAGG + Intergenic
1090862310 11:130665053-130665075 TCTCAATAAACCATATGCTATGG + Intergenic
1091320776 11:134647765-134647787 GCTTAAGGAACAATAAGAGATGG + Intergenic
1092600092 12:10051353-10051375 GCTCAATTAACTAGAAGCCAGGG - Intronic
1092806427 12:12227707-12227729 GCTCAATTAAGAATAAGAAAAGG - Intronic
1093850782 12:24035104-24035126 GCTCAATAGACAATATACGATGG + Intergenic
1098691556 12:73495626-73495648 ACACAATAATCAATAAGCAATGG - Intergenic
1099790103 12:87322789-87322811 GCTCAATAATAAACAAGCAAAGG + Intergenic
1101557508 12:105824156-105824178 GCTCAATAAAGGAGAAGGGAAGG - Intergenic
1103104277 12:118209404-118209426 TCTCAAAAAATAATAAGAGAAGG - Intronic
1104418807 12:128617911-128617933 GGTCAACAAACAACAAGCCATGG + Intronic
1109398932 13:61798748-61798770 GCTCAAAGCACAAAAAGCGAGGG - Intergenic
1112134494 13:96561696-96561718 CCTCATTAAAAAATAAGCAAAGG + Intronic
1112539460 13:100293781-100293803 GTTCAGTAAATAATAAGGGAGGG - Intronic
1115137060 14:30123066-30123088 GCTCAATAAATAATTAGAGCTGG + Intronic
1120666484 14:87312323-87312345 ACTCAATAAATAACAAGTGAGGG - Intergenic
1122278729 14:100609258-100609280 GCTCAGTAAATACTAAACGAAGG - Intergenic
1133822848 16:9252308-9252330 GCTCAATACACAAGAAAAGAAGG + Intergenic
1134739283 16:16528382-16528404 GCTCAATAAGTAATAAATGAAGG + Intergenic
1134757569 16:16681745-16681767 GCTCAAGAAACAAAAATCTAAGG + Intergenic
1134915610 16:18068495-18068517 GCTCTATAAAGAATAAGTGTTGG + Intergenic
1134928217 16:18183769-18183791 GCTCAATAAGTAATAAATGAAGG - Intergenic
1134988499 16:18677421-18677443 GCTCAAGAAACAAAAATCTAAGG - Intergenic
1135774855 16:25248471-25248493 TCTCATTAAAAAATAAGCCAAGG + Intronic
1138054505 16:53818245-53818267 ACTCTATAAACAATAAAAGAGGG + Intronic
1138935587 16:61717819-61717841 GATGAATAATAAATAAGCGATGG + Intronic
1141425997 16:83944995-83945017 GCTCCATAAACATTAATTGAAGG - Intronic
1148526605 17:48344068-48344090 GCTCAATAAACAATAAATGCTGG + Intronic
1150146353 17:62772888-62772910 GCACATTAAATAACAAGCGATGG - Intronic
1153027601 18:685758-685780 GCTCAAACAAAAATAAGCAAAGG - Intronic
1153052355 18:910968-910990 ACTCAATAAACAAGAAACAAAGG - Exonic
1155555703 18:27016626-27016648 GGTCAATAAACACTAATCAAAGG + Intronic
1155637986 18:27977861-27977883 GCTCCATAAAAAAAAAGCAATGG + Intronic
1158268234 18:55683627-55683649 GCCCAATACACAAAAAGAGATGG + Intergenic
1158640564 18:59200115-59200137 GTTCACTAAACAATATGCTAAGG - Intergenic
1160600319 18:80007682-80007704 CCTAAATAAACAATATGAGAGGG + Intronic
1167517196 19:49930180-49930202 GCTAAATAAACAATGAGGGGCGG + Intronic
925506500 2:4570953-4570975 ACTCAATAAACAAAAAAAGAAGG - Intergenic
932852918 2:75204002-75204024 CCTCATTAAAAAGTAAGCGAAGG - Intergenic
939042815 2:137211982-137212004 GCTAAATAAACAATAAACAAAGG + Intronic
940648125 2:156413243-156413265 GCTCTAAAAAGAATAAGCAAAGG - Intergenic
943154462 2:184155801-184155823 GCTAAATACACCATAAGTGAAGG - Intergenic
947105115 2:226661077-226661099 GCTCAACAAATAATTAGGGAAGG + Intergenic
947920680 2:233868557-233868579 GATCAAGAAACATTAAGCGCTGG - Intergenic
1168743329 20:213713-213735 GCTCAATAAATACTCAGTGAAGG + Intergenic
1170070938 20:12366790-12366812 GCTAAATAAATCATAAGCAAAGG + Intergenic
1170207410 20:13813460-13813482 GCTCAATAAACGCTAAGTGAAGG - Intronic
1174503500 20:51002402-51002424 GCTCAATAAACATTTATTGAAGG - Intergenic
1174848107 20:53963677-53963699 GCTCAAAAAACCCTTAGCGATGG + Intronic
1175188598 20:57196496-57196518 ACTCAACAAACAATGAGCCAAGG - Intronic
1175647666 20:60688629-60688651 GCTCAATAAAGATTGAGCCACGG - Intergenic
1177127342 21:17211751-17211773 TCTCAATAAAGAATAAAGGAAGG + Intergenic
1181754754 22:25015964-25015986 GCTCAATAAAAAATAGTTGAGGG - Intronic
1182133398 22:27876904-27876926 GCACAATAAACCATGAGCCAAGG - Intronic
953971393 3:47350943-47350965 GATCAATAAACAAAAATCAATGG - Intergenic
956203835 3:66735860-66735882 TCTCAAGAAACAATGAGCAAAGG + Intergenic
956446039 3:69326694-69326716 GCTCAACAAACAACATGAGAGGG + Intronic
957728605 3:84102222-84102244 GCTCCATAAAAAATAACAGAAGG - Intergenic
958503437 3:94943750-94943772 GCTCAATAAAAAATGATAGAGGG - Intergenic
960652262 3:119964169-119964191 GATGAATAAAAAATAAGCAAAGG + Intronic
968041375 3:195592044-195592066 GGTCAATAAACAAGAGGCAATGG + Intergenic
971401312 4:26278010-26278032 GCTCAATAAATATTCAGCAAAGG - Intronic
973307314 4:48667429-48667451 GTTCAAAAAAAAAAAAGCGAGGG - Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
980688174 4:136257200-136257222 GCTCAATAAGCAATAAATCAAGG + Intergenic
988276355 5:29085738-29085760 GCTCATTAAAAAATAAGAAATGG + Intergenic
988563231 5:32299545-32299567 GCTCTATAAACATTAAGTTAGGG + Intronic
991208737 5:64079993-64080015 CCTCAATAAAAAATAGGCAAAGG - Intergenic
998191128 5:140025443-140025465 GCTCAATAAACATTAACTGAGGG - Intronic
999198735 5:149801147-149801169 GCTCAATAAACACTTGGAGAGGG - Intronic
999667913 5:153933142-153933164 GGTTAATAAAAAATAAGAGACGG + Intergenic
1000873820 5:166610581-166610603 GATCCTTAAACAATAAGCAATGG + Intergenic
1000950706 5:167478861-167478883 GCTCAATGAACATTAAGGGGTGG - Intronic
1001108278 5:168874406-168874428 GCTCAATAAACAATAAGCGAAGG - Intronic
1003488304 6:6598696-6598718 GGTCAATATACAATAAGGGTGGG - Intronic
1004013959 6:11715567-11715589 GCTTGATAAACAATAAGCCTCGG - Intronic
1005440215 6:25859554-25859576 GCTCAAGAAACACAAAGCCATGG + Intronic
1007053358 6:38856211-38856233 GCACATTAAACAATATGAGAAGG - Intronic
1013191280 6:107806193-107806215 CCCCAATAAACAATGAGCAAGGG + Intronic
1014656763 6:124115376-124115398 GCTCAATATAGAATATGTGAAGG - Intronic
1018073469 6:160187941-160187963 GATCAAGAAACAATGAGAGAAGG + Intronic
1019228483 6:170535910-170535932 GGTCAATAAGCAATAAGCAGAGG + Intronic
1020798375 7:12703052-12703074 TCTCAAAAAAGAAAAAGCGATGG + Intergenic
1020849057 7:13326290-13326312 GCTCAATAAAAAATAATCAGAGG + Intergenic
1023640999 7:42257852-42257874 GCTTAATATACAAAAAGCAATGG - Intergenic
1024136049 7:46410009-46410031 ACTCAATAAAAAATAAAGGATGG - Intergenic
1027498516 7:78918517-78918539 GCTCAATAAACATTTAATGATGG + Intronic
1028509459 7:91607809-91607831 GTTCAATAAACAATAAATAAAGG + Intergenic
1028821121 7:95213117-95213139 GCTCAAAAAACAAGCAGAGAAGG - Intronic
1032420413 7:131774747-131774769 GCTCAATAAATAAAAAGGCAAGG - Intergenic
1037589032 8:20297714-20297736 GCTCAATAAACAATAAACTAGGG - Intronic
1042328287 8:67551296-67551318 TTTCAATAAAAAATAAGCAATGG - Intronic
1044006549 8:86943802-86943824 TCACAATAAACAAAAAGGGAAGG + Intronic
1046217242 8:111164539-111164561 GCTCAATAAGCAAAGAGTGAAGG - Intergenic
1050046148 9:1547688-1547710 GCCCAATAAAAAATAGGCAAAGG + Intergenic
1050601710 9:7259530-7259552 GCTCCACAAACAACAAGCAATGG - Intergenic
1051452201 9:17209651-17209673 GCTCATTATACAATAAGAGAGGG - Intronic
1052555343 9:30007115-30007137 GCACAATAATCAATATGCCAAGG + Intergenic
1054763103 9:69020998-69021020 GCTCAACAAACAATGATGGATGG + Intergenic
1055545055 9:77361992-77362014 ACTCATTAAATAATAAGCAAAGG - Intronic
1186388879 X:9138011-9138033 GCTCAAGAAAAAATAAGCTAAGG + Intronic
1187319221 X:18225699-18225721 ACTCAAAAAACAATAAACGTTGG - Intergenic
1190169371 X:48099793-48099815 GCTCAATAAACAATATTCTTGGG + Intergenic
1193400391 X:81035949-81035971 GCACAATAAAAAATAACAGAGGG + Intergenic
1194598053 X:95883882-95883904 TCTCAATACACAATCAGCCAAGG - Intergenic
1194761901 X:97804678-97804700 GCTCAATAAATACTAATAGATGG - Intergenic
1196744767 X:119061282-119061304 ACTCAATAAAAAATGAGCAAGGG + Intergenic
1199992394 X:152994440-152994462 GTCCAATAAAAAATAAACGAGGG - Intergenic
1201513478 Y:14791211-14791233 GCTCAATGATCAAGAAGCAATGG - Intronic