ID: 1001110453

View in Genome Browser
Species Human (GRCh38)
Location 5:168891677-168891699
Sequence CATTCTGACCAAAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001110443_1001110453 24 Left 1001110443 5:168891630-168891652 CCTGAGGTCCAAGCACTATGGAG 0: 1
1: 0
2: 2
3: 10
4: 202
Right 1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG 0: 1
1: 0
2: 1
3: 25
4: 334
1001110444_1001110453 16 Left 1001110444 5:168891638-168891660 CCAAGCACTATGGAGATAAGATG 0: 1
1: 0
2: 1
3: 18
4: 136
Right 1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG 0: 1
1: 0
2: 1
3: 25
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001110453 Original CRISPR CATTCTGACCAAAGGGAAAA AGG Intronic
903098357 1:21002784-21002806 CATTCTGTCCAGAGGGATAAGGG + Exonic
903355253 1:22742419-22742441 CACTCAGATCAAAAGGAAAATGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904095487 1:27973590-27973612 CCATTTGACTAAAGGGAAAAGGG + Exonic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
905303662 1:37003088-37003110 CCTGGTGGCCAAAGGGAAAAGGG - Intronic
906401973 1:45511148-45511170 CATTCCTACCAAAGGAAGAAAGG + Exonic
907621234 1:55982930-55982952 CATGATGACCCAATGGAAAATGG + Intergenic
908915290 1:69119412-69119434 CATTCAAACCAAAGGCAAAGAGG - Intergenic
909119570 1:71584433-71584455 CACTCTGACTAAAGAGAAATAGG + Intronic
910392492 1:86759325-86759347 AATTCTGACCACAGGGAGAAAGG - Intergenic
910803066 1:91164560-91164582 CATTCTGGCCACACGGAACAGGG + Intergenic
911224407 1:95289362-95289384 CATCGTGACCAAGGGCAAAATGG - Intergenic
911370539 1:96989592-96989614 GTTTCTGACCAAAGGGAAGGAGG - Intergenic
911732185 1:101302599-101302621 CATTCTGAACACAGGGAATCTGG + Intergenic
911763166 1:101640160-101640182 GATTCTGTCCAAATGGAGAAAGG - Intergenic
912129526 1:106584725-106584747 CATTCTGAACAAGGAGAAAAGGG - Intergenic
912702191 1:111886741-111886763 CATTTTAACCAAAAGGAGAAAGG + Intronic
912703525 1:111895670-111895692 CATTCTGAGCATATGGAGAAGGG - Intronic
912956672 1:114158646-114158668 CATTCTGAAAAAAGGAAGAAAGG - Intergenic
913047134 1:115083899-115083921 AATTCTAATCAAAGGCAAAATGG + Intronic
915508266 1:156371048-156371070 CCATCTGAGCAAGGGGAAAAAGG + Intronic
915952573 1:160199217-160199239 CATCCTGAGCAAGGGGAAACAGG + Intronic
916444581 1:164860526-164860548 CATCATGAGCAAAGGTAAAAAGG - Intronic
918463359 1:184797703-184797725 CAGACAGAACAAAGGGAAAAGGG - Intronic
919116765 1:193289571-193289593 CATTATTACCAAAGGAAAAGGGG + Intergenic
919783654 1:201240689-201240711 CATTCTAACCTAAGTGAAATTGG - Intergenic
920602918 1:207347234-207347256 CATGGATACCAAAGGGAAAATGG + Intronic
921086425 1:211797832-211797854 CACTATTTCCAAAGGGAAAAAGG + Intronic
923922941 1:238589124-238589146 CATTCTGCCTGAAGGGAAAAAGG - Intergenic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1063468490 10:6264643-6264665 CATTTTGAGTAAAGGGAACAAGG - Intergenic
1066316746 10:34254950-34254972 CATACAGACCAAAGGAAAGAAGG + Intronic
1066546497 10:36505765-36505787 CACTCTGACCCCAGGGAATAAGG - Intergenic
1066951713 10:42125277-42125299 CATTCTGACAAAAATGAACAGGG + Intergenic
1067176514 10:43953614-43953636 GATTCTGCCCAAAAGGAGAAGGG - Intergenic
1068302333 10:55160549-55160571 CATTCTTACCTAAGGGCAAATGG + Intronic
1068732056 10:60369416-60369438 CATTCTGACAAGAGGGACTATGG + Intronic
1068968338 10:62936194-62936216 CATTCTGGCCAAAGACATAAGGG - Intergenic
1071354615 10:84781993-84782015 CATTCAGACTAAAAGTAAAAGGG - Intergenic
1071356386 10:84800471-84800493 CAGACTGACCAATGGGAACATGG - Intergenic
1072040496 10:91601799-91601821 AATTCTGACAACAGAGAAAAGGG - Intergenic
1073648229 10:105329456-105329478 AATTCTGAACTAAGGCAAAAGGG - Intergenic
1073809777 10:107139902-107139924 CAATTTCACCAAAGGCAAAACGG - Intronic
1074366187 10:112859285-112859307 CATTCAGAAGAATGGGAAAAAGG - Intergenic
1074500167 10:114016634-114016656 CAGTCTGCCCAGAGGTAAAATGG - Intergenic
1075565778 10:123503109-123503131 CATTCTCAGCAAATGGAATAGGG - Intergenic
1077177273 11:1196566-1196588 CCTTCTCACCGGAGGGAAAAAGG + Intronic
1078103784 11:8345758-8345780 CATTCTGACCGAAGAGGACAGGG + Intergenic
1079413239 11:20209098-20209120 CATTCAGCCTAAAGAGAAAAGGG - Intergenic
1079493502 11:21015393-21015415 CACTATGAGCACAGGGAAAAGGG - Intronic
1080322414 11:31027461-31027483 CATTCTGACCCCCTGGAAAATGG - Intronic
1080911487 11:36604073-36604095 AATTCTCACCTAAAGGAAAAGGG - Intronic
1081025461 11:38007755-38007777 CAGTCTTACCTAAGAGAAAAAGG - Intergenic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1082579843 11:54852498-54852520 CATTGAGGCCAAAGGCAAAAAGG + Intergenic
1083113643 11:60436488-60436510 CATTCAAACCAAAGGCAAAGAGG + Intronic
1083351642 11:62033619-62033641 AATTCTGACCAAAAGGATCAGGG - Intergenic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1085812415 11:79696089-79696111 AATTCTGTGCTAAGGGAAAAAGG - Intergenic
1086177511 11:83909241-83909263 CAGTCCCACAAAAGGGAAAATGG - Intronic
1087259658 11:95996454-95996476 CCTTCAGACCCTAGGGAAAAGGG - Intronic
1087277174 11:96172219-96172241 AATTCTGACCACAGGGAGAATGG - Intronic
1087587223 11:100137858-100137880 CATTCTGCCCACAGTGTAAAGGG + Intronic
1088805264 11:113346607-113346629 AATTCTGTCCAAAGAGAAATAGG - Intronic
1091517700 12:1201154-1201176 CATTGTGACAAAAAGGAGAAAGG - Intronic
1091912541 12:4243636-4243658 CTTTTTGACCAAAGGAGAAATGG + Intergenic
1093207817 12:16271469-16271491 CAGTCTTACCAAAGGTAGAAGGG - Intronic
1093224015 12:16459444-16459466 CAGGCTAACCAAAGGGAGAAAGG - Intronic
1093293723 12:17361707-17361729 CTTTCTGACTAAAGGTAAGATGG + Intergenic
1093830272 12:23747519-23747541 CATATTGACAAAAGAGAAAACGG - Intronic
1094079902 12:26522582-26522604 CCATTTAACCAAAGGGAAAATGG - Intronic
1094712013 12:32973768-32973790 AATTCTGACCAAAGGGAACTTGG + Intergenic
1097333558 12:58357836-58357858 CCTTCTCACCAATGGGAAATGGG - Intergenic
1099310172 12:81010241-81010263 CAATCTGAAGAAAGAGAAAAAGG - Intronic
1100602740 12:96126049-96126071 CATTCAGACCAGAGTAAAAAAGG - Intergenic
1101202973 12:102456008-102456030 CATAATGACCAAAGAGATAAAGG - Intronic
1102144779 12:110646549-110646571 GCCTCTGACCCAAGGGAAAAAGG - Intronic
1105329285 13:19399933-19399955 ACTTGTGATCAAAGGGAAAATGG + Intergenic
1107456328 13:40558889-40558911 AAGTCTGACGAAAGGAAAAAAGG + Exonic
1107604361 13:42042990-42043012 CATTTGGAGCAAGGGGAAAAGGG + Intronic
1107625653 13:42280332-42280354 CATTTTGACCAAATGCCAAATGG - Intronic
1108204229 13:48071980-48072002 CATGCTGGCAAAAGGGTAAAAGG + Intronic
1108552549 13:51560927-51560949 CATTCTGTCTCTAGGGAAAAAGG - Intergenic
1108813101 13:54254329-54254351 ATTCCTGACCAAAGGGAACAGGG + Intergenic
1110780373 13:79458832-79458854 CTTTCTCAGAAAAGGGAAAAGGG + Intergenic
1111886810 13:94031652-94031674 CATGCTGCCCAAATGCAAAATGG + Intronic
1112060932 13:95739737-95739759 CATTCAAACCAAAGGCAAAGAGG - Intronic
1112155935 13:96816869-96816891 CACCCTTATCAAAGGGAAAATGG - Intronic
1112798128 13:103079772-103079794 CATTCTATACAAATGGAAAATGG + Intergenic
1116420290 14:44724246-44724268 CATTCTTTCCAGATGGAAAATGG - Intergenic
1116455954 14:45121148-45121170 CATTCTTAACAAAGGGTAGAGGG + Intronic
1117139371 14:52771955-52771977 CATTTTGGACAAAGGAAAAAAGG - Exonic
1117645504 14:57847528-57847550 CATTATAAACAAAGGTAAAATGG + Intronic
1118641881 14:67800034-67800056 CATTAAGACCAAATGTAAAATGG - Intronic
1120046327 14:79811237-79811259 CACTTTGACCAAAGAGATAATGG + Intronic
1120366650 14:83580066-83580088 CATTCTAAACAAAAAGAAAAAGG + Intergenic
1123064561 14:105610891-105610913 TATCCAGAACAAAGGGAAAAAGG + Intergenic
1123073862 14:105656532-105656554 TATCCAGAACAAAGGGAAAAAGG + Intergenic
1125615944 15:41012890-41012912 GATTTTTACCCAAGGGAAAAAGG + Intronic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1127834413 15:62778891-62778913 CATGCTGAGCAAAGGGAGAATGG - Intronic
1128333945 15:66774145-66774167 CAGTCTGGCCAAAAGGAAAGCGG + Intronic
1128692667 15:69737105-69737127 CACACTGACCAAAGCAAAAAAGG - Intergenic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129530903 15:76263689-76263711 CACACTGACCAAATGGAAACTGG - Intronic
1135564764 16:23503698-23503720 CATACTGAATAAAAGGAAAACGG + Intronic
1135730106 16:24887257-24887279 TATTATGACTAAAGAGAAAATGG + Intronic
1136667487 16:31825055-31825077 CATTCTAACCCACAGGAAAAAGG - Intergenic
1140444301 16:75012434-75012456 CAAGCTGACCATATGGAAAAGGG - Intronic
1140613316 16:76627783-76627805 CATTACCACCAAAGCGAAAAGGG + Intronic
1140715960 16:77725963-77725985 CATACTGGACAAAGGGACAAAGG - Intronic
1141086853 16:81101958-81101980 CACTCTGACCTAGAGGAAAAGGG - Intergenic
1141210869 16:81978433-81978455 CATTCAAACCAAAGGCAAAGAGG + Intergenic
1141228360 16:82140323-82140345 CATTCAAACCAAAGGCAAAGAGG + Intergenic
1141843944 16:86594190-86594212 CCTTCTCACCAAAGGGGAAGGGG - Intergenic
1144238049 17:13281724-13281746 TATTATGACCATAAGGAAAATGG + Intergenic
1144529539 17:16023172-16023194 CATTCTGACCACAAGAAAAATGG - Intronic
1145724886 17:27110091-27110113 CATTCTTACCTAAGTGCAAATGG - Intergenic
1146397482 17:32480316-32480338 CATTCTCATCACAGGGAAGAGGG - Intronic
1149895525 17:60425916-60425938 CCTCCTGACCAATGGGGAAAAGG - Intronic
1151060570 17:71088498-71088520 TATTCTGACGAAAAGGAACAAGG - Intergenic
1151074445 17:71254899-71254921 CATTCAGACCCATGGGGAAAAGG + Intergenic
1152734411 17:81990383-81990405 CCTTCAGACTATAGGGAAAATGG - Intronic
1203172425 17_GL000205v2_random:161376-161398 CTGTCTAACCAAAGTGAAAATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155631677 18:27901463-27901485 CATTCAGACAAAAGGGGCAAAGG - Intergenic
1155987576 18:32246295-32246317 CATTCGGAAAAGAGGGAAAATGG - Intronic
1156402027 18:36748060-36748082 CATTCAGACCACTGAGAAAATGG + Intronic
1156983264 18:43318886-43318908 CATTCTAACAAAAGTGAATAGGG + Intergenic
1159144600 18:64438088-64438110 CATTCTAAATAAAGAGAAAAAGG - Intergenic
1159299138 18:66540041-66540063 TATTATTACCAAAGTGAAAAAGG - Intronic
1162248073 19:9419496-9419518 CATGCTGCCCACTGGGAAAAGGG + Exonic
1163411788 19:17159418-17159440 GGTTCTGACCAAAAGAAAAACGG + Exonic
1163739945 19:19005286-19005308 CACTTGGACCAAAGGAAAAATGG + Intronic
1163918278 19:20262232-20262254 AATTATGACCAAAGGACAAATGG - Intergenic
1164350998 19:27341476-27341498 CATTGAGACCTAAGGGGAAATGG - Intergenic
1165008613 19:32826547-32826569 CACTCTGGCCAAAGAGAGAAGGG + Intronic
1166766137 19:45252717-45252739 CAGATTGACCCAAGGGAAAAGGG - Intronic
1167219817 19:48191570-48191592 CATTCTGATCACATGGAAAAGGG + Intronic
1168497831 19:56869127-56869149 CCTTCTGACAACAGGGAAGAAGG + Intergenic
1168591176 19:57635427-57635449 CATACAGACCAAAAGTAAAATGG - Intronic
926319938 2:11742750-11742772 CAATCTGACCAGAGGAGAAAGGG + Intronic
926892559 2:17650549-17650571 CACTCTGACCAAGGAGAGAAAGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
927858380 2:26541776-26541798 CTTTCTTGCCACAGGGAAAATGG + Intronic
927919530 2:26961328-26961350 CATTCAATCCAGAGGGAAAAGGG + Intergenic
928459338 2:31456313-31456335 CATACTGGCAAAAGGGTAAAAGG - Intergenic
929420919 2:41788775-41788797 CCGTCTTACCAATGGGAAAATGG + Intergenic
931457124 2:62419171-62419193 CATTTTCACTAAAGGGAAACAGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
931940489 2:67246723-67246745 CATACTAACCTAAAGGAAAAAGG + Intergenic
932461681 2:71885958-71885980 GATTCTGACAAAAAGAAAAAGGG - Intergenic
932864435 2:75326832-75326854 CAAACTGACCCAAGGGAATAAGG + Intergenic
933165920 2:79074526-79074548 CCGCCTGACCAAAGGCAAAAAGG - Intergenic
935840926 2:107109468-107109490 CAGTCTTACCAAAGGGGTAAAGG + Intergenic
936289190 2:111206506-111206528 CATCATGAATAAAGGGAAAAGGG - Intergenic
936725848 2:115314344-115314366 CATGCTGACTAAGGGTAAAACGG + Intronic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
937399859 2:121572863-121572885 TCTTCTGACCAATGAGAAAAGGG + Intronic
937842933 2:126543902-126543924 CAATCTAAACAAAGGCAAAAAGG + Intergenic
937851897 2:126643445-126643467 AATTATACCCAAAGGGAAAAGGG + Intergenic
938678190 2:133660190-133660212 CATTTTGACTGAAGGGAAAAAGG - Intergenic
940035607 2:149309645-149309667 CATTCTTCAGAAAGGGAAAAGGG - Intergenic
941514390 2:166454707-166454729 CTTTCTGATAAATGGGAAAAAGG - Intronic
942263975 2:174201889-174201911 CATACTGGCTAAAGGCAAAATGG - Intronic
943672024 2:190673087-190673109 CATTTTGACCTAAGGGAAAGGGG - Exonic
944396757 2:199276749-199276771 CATTTTGAAAAAAGGGAAAAAGG - Intronic
946268180 2:218567230-218567252 CATTCTGCTGAAAGGTAAAATGG - Intronic
947515536 2:230800891-230800913 AATTCTCACCAAGGAGAAAATGG + Intronic
948181883 2:235988791-235988813 CATGCTGACCACAGAAAAAAGGG - Intronic
948223074 2:236288794-236288816 GATTAGGAGCAAAGGGAAAATGG + Intergenic
1168956456 20:1837716-1837738 CCCTCTGAGCAATGGGAAAAGGG + Intergenic
1171950578 20:31417958-31417980 CATTTCGAAAAAAGGGAAAAAGG + Intergenic
1172188079 20:33043996-33044018 CATTCTGGCAAAAGGCAAAGGGG - Exonic
1173764949 20:45598690-45598712 CATTTTGGCCAAGGGGAAATAGG - Intergenic
1174089886 20:48038444-48038466 CGTTTTCTCCAAAGGGAAAAGGG + Intergenic
1174126405 20:48310129-48310151 CATTTTCTCCAAAGGGAAAATGG - Intergenic
1175036709 20:56006266-56006288 CCTTCTGAAGGAAGGGAAAAAGG - Intergenic
1176328416 21:5523186-5523208 CTGTCTAACCAAAGTGAAAATGG - Intergenic
1176399341 21:6297765-6297787 CTGTCTAACCAAAGTGAAAATGG + Intergenic
1176437816 21:6691339-6691361 CTGTCTAACCAAAGTGAAAATGG - Intergenic
1176462078 21:7018409-7018431 CTGTCTAACCAAAGTGAAAATGG - Intergenic
1176485639 21:7400187-7400209 CTGTCTAACCAAAGTGAAAATGG - Intergenic
1177309692 21:19374181-19374203 CATTTTTACCAAAGGAAAACAGG - Intergenic
1177806924 21:25883861-25883883 CATTCTGTCCCAAGGGATGAGGG - Intronic
1178339793 21:31776437-31776459 CATTCTGATCAAAGAGAACCAGG - Intergenic
1178678470 21:34651488-34651510 CATTCTGACCATATGGAACTTGG - Intergenic
1178846896 21:36181632-36181654 CATTCTGTCCCACAGGAAAAGGG + Intronic
1179480297 21:41672525-41672547 CCTCCTGACCCAAGGGGAAATGG + Intergenic
1180261127 21:46669612-46669634 GATTCTGAAGAAAGGGAAGAAGG - Intergenic
1181627855 22:24133599-24133621 CATGCTGTCCTAAAGGAAAAGGG - Intronic
1182756264 22:32682119-32682141 CATTCTGACCCCAGGGGATATGG + Intronic
1182833739 22:33324566-33324588 AATTTGGACCCAAGGGAAAATGG + Intronic
1182939660 22:34263421-34263443 CATTCAAACCAGAGGGACAAAGG + Intergenic
1184144336 22:42600023-42600045 CATACTGCCCACTGGGAAAAAGG - Intronic
1185002585 22:48255037-48255059 TATTCTAACCAAAGGGAAAATGG - Intergenic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
951502098 3:23400288-23400310 CATTCTGTCATAACGGAAAACGG + Intronic
951991681 3:28682461-28682483 CATTCAGACAAAAGGAAACAAGG - Intergenic
952100279 3:30003292-30003314 CACTCTGCCTAAAGGGTAAAGGG + Intronic
952542933 3:34386975-34386997 CATCATGAGCAATGGGAAAAAGG - Intergenic
953428357 3:42815276-42815298 CCTTAAGACCAAGGGGAAAATGG - Intronic
959272315 3:104228404-104228426 AATTCTGACAAAAGGAAAAGTGG + Intergenic
959517724 3:107288201-107288223 CTTTCTGACCAAAAATAAAAAGG + Intergenic
960957002 3:123039724-123039746 CATTCTGGCCATAAGGCAAAGGG + Intergenic
961240900 3:125410735-125410757 CATTATGAGCAATGTGAAAAGGG + Intergenic
962506819 3:136054797-136054819 CATTCTGACCAATGGCATCAGGG - Intronic
964834962 3:160928318-160928340 CATCCTGACCACAGGGCATATGG + Intronic
965357727 3:167697330-167697352 CTTTCTGTTCAAATGGAAAATGG - Intronic
965689031 3:171335660-171335682 CATACTTATCAAATGGAAAATGG - Intronic
966117182 3:176479344-176479366 GATTTTGAACAGAGGGAAAAAGG + Intergenic
966476650 3:180356438-180356460 AACTCTGGTCAAAGGGAAAAAGG - Intergenic
967956854 3:194883983-194884005 CATTCTTCCAAATGGGAAAAGGG + Intergenic
968724332 4:2236290-2236312 CTTTCTGTCCAAACGGAATAAGG - Exonic
969940193 4:10724362-10724384 AATTCTGAGCATAGGGAAGACGG - Intergenic
969943165 4:10755382-10755404 CATTAAGAAGAAAGGGAAAATGG - Intergenic
971164022 4:24163546-24163568 CATACTCACCAAAGGGAAATCGG + Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971268582 4:25115899-25115921 CATCCTGACTAACGGGTAAAAGG + Intergenic
971457151 4:26856088-26856110 GATGCTGACCAAAGGGTATAAGG - Intergenic
972152768 4:36114964-36114986 CATGCTGGCCAAAAGCAAAATGG + Intronic
972727610 4:41759140-41759162 AATTCTGAACAAAGGGGAGAGGG + Intergenic
973050002 4:45585129-45585151 CATGCTGACCAGAGGTATAAGGG - Intergenic
974339095 4:60590701-60590723 CATTATGCCAAATGGGAAAAGGG + Intergenic
974385367 4:61197724-61197746 AATTTTTACCAAAGGGAAAAGGG - Intergenic
976782355 4:88775187-88775209 CATTCAGACCAAGGGAGAAAGGG + Intronic
977089268 4:92650507-92650529 CCTTATTACCAAAGGGAAATTGG - Intronic
977218999 4:94316673-94316695 CATTCTAAGCAGAGAGAAAATGG - Intronic
977411235 4:96667972-96667994 AACCCTGACAAAAGGGAAAAAGG - Intergenic
977888577 4:102280206-102280228 ACCTATGACCAAAGGGAAAAGGG - Intronic
979822422 4:125191303-125191325 TACTCTGACCAACTGGAAAATGG + Intergenic
982362001 4:154528906-154528928 CATTCTGACCCCAGTGAAAGTGG + Intergenic
983066734 4:163218932-163218954 ATTTCTCACCAAAGGAAAAATGG - Intergenic
983344581 4:166510572-166510594 CTCTCTGACCAAAGCCAAAATGG - Intergenic
984982503 4:185296286-185296308 CATCCTGAACAAAGGCAATACGG - Intronic
985341230 4:188956767-188956789 AATCATGACTAAAGGGAAAAAGG + Intergenic
985420031 4:189775971-189775993 CATTCTTCCCATAGGAAAAATGG - Intergenic
986626389 5:9726845-9726867 CTTTCTTATCAAAAGGAAAATGG - Intergenic
987534144 5:19162408-19162430 CATTCAAACCAAAGGCAAAGAGG + Intergenic
989413966 5:41152143-41152165 TATTCTGAAGAAAGGGAACATGG + Intronic
989470529 5:41812372-41812394 CATTCTGACAATATGAAAAAGGG + Intronic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
993824698 5:92668599-92668621 GATTCTGAGCTAATGGAAAATGG + Intergenic
994065529 5:95536011-95536033 GATACTGACCAAAAGGAAAGAGG + Intronic
994724017 5:103413662-103413684 AACTCTGACTCAAGGGAAAAAGG - Intergenic
996317384 5:122175703-122175725 GCTTCTGAGAAAAGGGAAAAAGG - Intronic
996352683 5:122563072-122563094 AAGTCTGACAGAAGGGAAAAGGG + Intergenic
996523320 5:124451053-124451075 CACTCTGGACAAAGGGAACAAGG - Intergenic
996813527 5:127546406-127546428 TATTCAAACCAAAAGGAAAAAGG - Intronic
997101857 5:130978706-130978728 TATTCTCACCAATGGGAAAGTGG - Intergenic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
997405709 5:133645004-133645026 CATTAGGACCAAAGGGACAGGGG - Intergenic
997624548 5:135322910-135322932 CATTCTCAAGAAAGGGATAATGG + Intronic
998958503 5:147461165-147461187 CATGGTAACAAAAGGGAAAATGG - Intronic
998992538 5:147833785-147833807 CATTCTGAACAATGAGAAACTGG - Intergenic
999454501 5:151703533-151703555 CGTTCTAACCAAATGTAAAAAGG + Intergenic
999525162 5:152397041-152397063 GATTATGACCAAGGAGAAAAGGG + Intronic
999751066 5:154628587-154628609 CATTCAGAGTAAAGGGAAGAAGG - Intergenic
1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG + Intronic
1001592916 5:172878636-172878658 CCCTCTGTCCAAAGGAAAAAAGG - Intronic
1001778134 5:174344525-174344547 CACTCTGAGCACAGGAAAAAGGG + Intergenic
1001854829 5:175001971-175001993 CATTCTGCCCCAATGGGAAAGGG + Intergenic
1001908146 5:175490283-175490305 CATTCTGACCTTGGGGAAATAGG + Intronic
1002837051 6:873892-873914 AGTTTTGACCAGAGGGAAAAAGG - Intergenic
1004770777 6:18778662-18778684 CATTCTTTCCAAAAGGAAGATGG - Intergenic
1005082241 6:21967925-21967947 GAGTCCTACCAAAGGGAAAAGGG - Intergenic
1006247132 6:32747145-32747167 CATTCTGAGCCAAGGGCAGAGGG - Exonic
1006969153 6:38022726-38022748 AATTCTGACCAAATGGTAAAGGG - Intronic
1006971081 6:38046104-38046126 AATTCTGACAAATGGGCAAAAGG - Intronic
1009061856 6:58406098-58406120 CATTGTGGCCAATGTGAAAAAGG - Intergenic
1009259972 6:61473489-61473511 CATTCAGGCCAATGGCAAAAAGG + Intergenic
1010811995 6:80311320-80311342 CTTTATGAGCAATGGGAAAACGG + Intronic
1010925180 6:81736016-81736038 AATTTTGACCAGTGGGAAAAGGG + Intronic
1011313849 6:86009801-86009823 GATTCTGAGTAGAGGGAAAAAGG + Intergenic
1012811085 6:103959113-103959135 GATTCTGGACCAAGGGAAAAGGG + Intergenic
1015866902 6:137736335-137736357 CATTCTGATCAAGGAGCAAAAGG + Intergenic
1016737709 6:147497969-147497991 AAATGTGAACAAAGGGAAAAAGG + Intergenic
1016912391 6:149212003-149212025 AATTCTGGCCAATGGGAAAATGG - Intergenic
1016978359 6:149831136-149831158 CATTCAGAAGAAAGGAAAAATGG - Intronic
1017517883 6:155174025-155174047 CATTCTGTTCAATGGGAACATGG + Intronic
1017686675 6:156920349-156920371 TATTCTGACACAAGGGAAATTGG + Intronic
1019011272 6:168845291-168845313 CATTCTGCACAAGGTGAAAAGGG + Intergenic
1020077320 7:5266867-5266889 CATTGAAACCAAAGGGAGAAGGG + Intergenic
1020361357 7:7329944-7329966 CATTCTGCCCAAAGTGTGAAGGG + Intergenic
1020933778 7:14433650-14433672 CAATCTGTCCAAAGTTAAAAGGG - Intronic
1021149016 7:17126662-17126684 CATTATGAGCAAAGGTAAAGAGG - Intergenic
1021812022 7:24411894-24411916 TATTATGACCAAAGTGAAACAGG + Intergenic
1022266949 7:28766262-28766284 CCTTCTGAAGAAAGGGAAGAAGG + Intronic
1022538302 7:31111940-31111962 CATTATGACCAATATGAAAATGG - Intergenic
1022558530 7:31325314-31325336 CATTCTGTCCCTAGAGAAAAGGG + Intergenic
1022601446 7:31764067-31764089 CATTTTAAGCAAAGGAAAAATGG + Intronic
1022775804 7:33526673-33526695 CATTCAAACCAAAGGCAAAGAGG - Intronic
1022842068 7:34174491-34174513 CATTCAAACCAAAGGCAAAGAGG - Intergenic
1023759365 7:43449649-43449671 CTTTTTGACCCAAGGGATAATGG + Intronic
1024693156 7:51825031-51825053 CAATGTGACAAAAGGAAAAAAGG - Intergenic
1025192544 7:56907050-56907072 CATTGTCACCAAAGGAGAAAGGG + Intergenic
1025580483 7:62708969-62708991 CATTGAGGCCAAAGGCAAAAAGG - Intergenic
1025679402 7:63669872-63669894 CATTGTCACCAAAGGAGAAAGGG - Intergenic
1025757928 7:64362806-64362828 CATGCTGGCAAAAGGGTAAAAGG - Intergenic
1026584275 7:71643502-71643524 CATTTTTACAAAAGGGAAAAAGG + Intronic
1031033014 7:116755196-116755218 AATTTTCACTAAAGGGAAAAGGG - Intronic
1031070493 7:117156154-117156176 CATTCTGGGGAAAGGAAAAATGG - Intronic
1034250410 7:149686075-149686097 GATTTTGACTAATGGGAAAAAGG - Intergenic
1036290622 8:7486325-7486347 CTTTCTGACCCCAGGTAAAATGG - Exonic
1036330866 8:7825212-7825234 CTTTCTGACCCCAGGTAAAATGG + Exonic
1036739690 8:11348755-11348777 GATTCTGAACAATGGGGAAAAGG + Intergenic
1036903840 8:12691338-12691360 CATTCTGACCAGAGGCTCAATGG + Intergenic
1037869933 8:22484477-22484499 CTTTCTGACAAAATGGAATAAGG + Intronic
1038237666 8:25776379-25776401 GATTCTGAGCATAGGGAAAGAGG - Intergenic
1038564760 8:28610473-28610495 CATTTGGACCAGAGGAAAAAGGG + Intronic
1039011325 8:33096557-33096579 CTTTCTGACCAGAGGGCAACTGG - Intergenic
1040385645 8:46913298-46913320 CTTCCTGAGCAAAGAGAAAAGGG - Intergenic
1041341923 8:56855283-56855305 AAGTTTGACCAAAGGGGAAATGG + Intergenic
1041671336 8:60494440-60494462 CACGCTGACCAAACAGAAAATGG - Intergenic
1041712563 8:60907685-60907707 CTGTCTGACCAATGGGAAATCGG + Intergenic
1041980755 8:63856257-63856279 CATTCTGAGCAAATGGATAATGG + Intergenic
1043991548 8:86761998-86762020 AAATCTGAAGAAAGGGAAAAAGG - Intergenic
1045850000 8:106684437-106684459 CATTCTAACCATAGTCAAAATGG - Intronic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1045883864 8:107073034-107073056 CATTGTTCCCAAAGGGATAAAGG + Intergenic
1046310066 8:112424076-112424098 GATTCTATTCAAAGGGAAAATGG + Intronic
1046777859 8:118182864-118182886 CCTTTTCACCAAAGGGAATAGGG + Intergenic
1046814071 8:118564906-118564928 CATACTCCCCAAAGAGAAAAAGG + Intronic
1047903447 8:129448589-129448611 CATCCTCACTCAAGGGAAAATGG - Intergenic
1048012225 8:130467031-130467053 CATTCTGACCCAGGGGAAAGAGG + Intergenic
1048161650 8:132027004-132027026 TATTCCAAGCAAAGGGAAAAGGG - Intronic
1048870887 8:138796826-138796848 CCTTTTGGCCAAGGGGAAAAGGG - Exonic
1049083615 8:140460955-140460977 CATTTTTACCAATGAGAAAACGG + Intergenic
1049667505 8:143852853-143852875 TATTCTGTCCAAAGGGAGAGAGG - Intergenic
1050065080 9:1750744-1750766 AATTCTAACCAAAGGCAAAGAGG + Intergenic
1050599386 9:7235166-7235188 CTTTCTGAGCTAAAGGAAAAAGG + Intergenic
1051199207 9:14598055-14598077 CATACTGACCAAAGGCCCAAGGG + Intergenic
1051938177 9:22470074-22470096 CATTCTGAGCAAGGTGTAAATGG - Intergenic
1053070419 9:35098100-35098122 CATACTGACCAAACGAATAAAGG + Intergenic
1054363380 9:64202381-64202403 CATTCAGGCCAATGGCAAAAAGG + Intergenic
1054837191 9:69688865-69688887 CACACTGACCAAAGGAAAAAAGG - Intergenic
1054981216 9:71209078-71209100 AATTCTGGCCAATGGGAGAATGG + Intronic
1056182964 9:84103296-84103318 GTTTCTTACCAAATGGAAAAAGG - Intergenic
1056502801 9:87226331-87226353 TTCTCTGACCAAAGGGAACACGG - Intergenic
1058263777 9:102872664-102872686 GTTTCTTTCCAAAGGGAAAATGG - Intergenic
1059634447 9:116157557-116157579 CATTCGGCCAAAAGGGAAACTGG - Intronic
1060383887 9:123204578-123204600 AATTCTGACTAAAAGGAAAAAGG + Intronic
1060619382 9:125049821-125049843 CATTATGAGCAGAGTGAAAAAGG - Intronic
1061367578 9:130180563-130180585 TATTCTGACCAAGGGCAGAACGG + Intronic
1203433687 Un_GL000195v1:117282-117304 CTGTCTAACCAAAGTGAAAATGG + Intergenic
1186769002 X:12799024-12799046 CAAACTCAGCAAAGGGAAAAAGG - Intronic
1188651330 X:32634528-32634550 CATGCTGACCAAAGGGACCTAGG - Intronic
1191268972 X:58437155-58437177 CATTCAGGCCTAAGTGAAAAAGG - Intergenic
1191810684 X:65184264-65184286 TATTCTGTCAAAAGGGGAAAGGG - Intergenic
1193492254 X:82164425-82164447 CTTTCTGTGCAAAGGGCAAAGGG - Intergenic
1194937723 X:99970990-99971012 GATTCTGACCACTGGGAATAGGG + Intergenic
1195060428 X:101189129-101189151 CACACTGACCAAACGGAAACTGG + Intergenic
1195284849 X:103374705-103374727 CATTCGCACCAAAGGGTAGATGG + Intergenic
1195483893 X:105380329-105380351 CTTTCTGATTCAAGGGAAAAGGG + Intronic
1196764435 X:119230081-119230103 CATTCTGAACAAAGGTACAGAGG - Intergenic
1197038709 X:121908499-121908521 CATGCTGGCAAAAGGGTAAAAGG + Intergenic
1198580588 X:138060023-138060045 CAACCTGTCCAAAGGGAAAATGG - Intergenic
1199659958 X:150038849-150038871 CATTCTGAGTAAATGGATAATGG - Intergenic
1202602607 Y:26609670-26609692 ATTTGTGATCAAAGGGAAAATGG - Intergenic