ID: 1001110612

View in Genome Browser
Species Human (GRCh38)
Location 5:168893221-168893243
Sequence GTTCACCTGATTCAAAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001110610_1001110612 4 Left 1001110610 5:168893194-168893216 CCTTGGTTGGGTGTGGACAGGGA 0: 1
1: 0
2: 0
3: 35
4: 236
Right 1001110612 5:168893221-168893243 GTTCACCTGATTCAAAAGGATGG 0: 1
1: 0
2: 0
3: 15
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001110612 Original CRISPR GTTCACCTGATTCAAAAGGA TGG Intronic
905144838 1:35880077-35880099 GTTTACCTGAATCAACAAGATGG - Intronic
906872907 1:49503615-49503637 GGTCACCTGATTCAAGAGGTGGG - Intronic
907473703 1:54691356-54691378 GCTCTCATGATTCAAAAGAAAGG - Intronic
908150756 1:61299283-61299305 GTTCAAAAGATTGAAAAGGAAGG - Intronic
910130959 1:83905043-83905065 TTCTACCTGATTCAAAAAGATGG + Intronic
910840236 1:91554382-91554404 GTTTACATAATTCAAAAAGAAGG + Intergenic
915776110 1:158488528-158488550 GTGCACCTGAATGAAAAGTAAGG - Intergenic
917074618 1:171191410-171191432 GTTTAACTGATTCAAAACTATGG + Intronic
918289051 1:183088613-183088635 GTTTAACTTATTCAAAAGCAAGG - Intronic
918768952 1:188528389-188528411 TTTCACATGATTCAAAATCAAGG + Intergenic
921582124 1:216907214-216907236 GTTCACCTGATGGTGAAGGAAGG + Intronic
1064240963 10:13628170-13628192 TTTCAACTGATTCACAAGAAGGG - Intronic
1070169559 10:73922369-73922391 CTTCATCTAATTCAAAGGGAGGG - Intronic
1070241697 10:74688586-74688608 GTTGACCTGATCCTAAAGTATGG - Intronic
1073799440 10:107025412-107025434 AGTCACCTGATTCAAAAGAGAGG - Intronic
1081021968 11:37958501-37958523 GCTCACCTGATGCAAAAGGTGGG + Intergenic
1082099191 11:48157804-48157826 ATTCTCCTGATTCAACAAGAGGG - Intronic
1089198383 11:116708579-116708601 GTTCTCCTGCTTGAAAGGGAAGG + Intergenic
1090759573 11:129824591-129824613 GTTCTCTTGATTCAAGATGAAGG + Intronic
1092362309 12:7847447-7847469 GTTCATCTGAATCACAAGGAAGG + Intronic
1092399110 12:8157674-8157696 CTTCAACTGATTCAAAAAGAAGG - Intronic
1099040717 12:77651121-77651143 ATTAACCTGAGTCAAAAGAAAGG - Intergenic
1102297450 12:111747956-111747978 GTTCACCTGATTCCAAGGCCCGG + Intronic
1108288397 13:48932268-48932290 GTTCAACTGCTGCTAAAGGAAGG - Intergenic
1109303133 13:60610092-60610114 GTTCCCATGATTTGAAAGGAAGG - Intergenic
1109522566 13:63532466-63532488 GTTATGCTGATTCAAAAGGTGGG - Intergenic
1111838442 13:93419269-93419291 GATCACCAAATTTAAAAGGATGG + Intronic
1114219209 14:20682304-20682326 TTGCAGCTCATTCAAAAGGAAGG - Intergenic
1114822000 14:26031970-26031992 GTTCCCCTGTCTAAAAAGGAAGG - Intergenic
1119644830 14:76340623-76340645 ATTCACCTGATGGACAAGGAAGG - Intronic
1120432046 14:84431513-84431535 ATTCATCTGATTAAAAAGTATGG - Intergenic
1120672704 14:87382561-87382583 TTTCTCCTAATTCAAAAGGTAGG + Intergenic
1120975219 14:90242382-90242404 GTTTTCCTGATTGAAATGGAAGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122311500 14:100798610-100798632 GTTTAGAGGATTCAAAAGGAGGG + Intergenic
1122485533 14:102077075-102077097 GCTGACCTCATTCAAAAAGAGGG - Intergenic
1124136096 15:27037618-27037640 GTACACCTGAAGGAAAAGGAAGG + Intronic
1128401192 15:67282742-67282764 GTTTACCTGGTTTAAAAGGTTGG - Intronic
1129984328 15:79903909-79903931 ATCCACCTGGTTCAAAAGGAAGG + Intronic
1134801132 16:17085786-17085808 GTTCACCTCATTCCTATGGAGGG + Intergenic
1135647829 16:24178761-24178783 GGTCTCCTTATTCAAAGGGATGG - Intronic
1137372204 16:47918064-47918086 TTTAACCTAATTCATAAGGAAGG - Intergenic
1141389151 16:83649843-83649865 GAGGACCTGATTCAAAAGGCGGG + Intronic
1146984463 17:37201531-37201553 GTTCACTTGCTTCAAAAGGCAGG + Intronic
1150454181 17:65293907-65293929 GTAAACCTGATTCAAAGGGAGGG + Intergenic
1151104491 17:71596550-71596572 GTTTACCTGAATAAAAAGGAAGG - Intergenic
1154408628 18:14121609-14121631 GTTTAACTGATACAAAAGAAAGG - Intronic
1157389590 18:47289938-47289960 GCTCCACTGATTCAAAAGAAAGG - Intergenic
1157821391 18:50773288-50773310 GTTCTCCTGATTCACAAGCATGG - Intergenic
1158210372 18:55042423-55042445 GTTAATCTAATTGAAAAGGAGGG + Intergenic
1159479677 18:68972517-68972539 TCTCACCTGGTTCAAAACGATGG + Intronic
1164799705 19:31066616-31066638 GTGCACATGATTCATCAGGAAGG - Intergenic
1165300119 19:34963499-34963521 GGTCCCCTGACTCAAAAGCAAGG + Intronic
927029853 2:19109604-19109626 GCTCATCTGAGCCAAAAGGAAGG + Intergenic
927838015 2:26416701-26416723 GGTCACCTGATTCACAACAAAGG - Intronic
928719306 2:34100838-34100860 GTTCAGCTGCTTCTATAGGAAGG - Intergenic
930367084 2:50453408-50453430 GTCTACCTGAATCAAAAAGAAGG - Intronic
930369945 2:50489624-50489646 GTTCACGTGATTCTAATGGTGGG + Intronic
932760354 2:74435691-74435713 GTTCCCCTGTTTCAAATGGATGG - Intronic
933493556 2:83019175-83019197 CTTCACCTGTTTCAAAGGGCAGG + Intergenic
941992690 2:171572589-171572611 CTTCACCCGATTTAACAGGAAGG - Intergenic
948257682 2:236579654-236579676 GTTCAACTGCTTCAACAGCAAGG - Intronic
1171836316 20:30153476-30153498 GTTCTCCTCTATCAAAAGGAAGG - Intergenic
1172227210 20:33313019-33313041 GCTCACCTGAGTCACCAGGAAGG - Intergenic
1174420380 20:50395566-50395588 GGACTCCTGATTCAAGAGGAAGG + Intergenic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1175479649 20:59301975-59301997 GTTCACTTCATTCAGAGGGAGGG - Intronic
1177500810 21:21952031-21952053 GTTCACCAGACCCAAAAGTAGGG - Intergenic
1179538221 21:42066219-42066241 ATTCTCCTGATTGAAAAGAAGGG + Intronic
1182163408 22:28146713-28146735 GTTTCCCTGATTCAAATGGAAGG - Intronic
1184949969 22:47834240-47834262 GTTCACCTGTTACTATAGGAGGG - Intergenic
950716339 3:14850280-14850302 GTTCAGCTGATACTGAAGGATGG - Intronic
962407853 3:135115644-135115666 GTTTACCTGATTCCACAGTAGGG - Intronic
964219549 3:154327664-154327686 CTGTACCTGATTCCAAAGGAAGG - Intergenic
973199317 4:47481867-47481889 ACTCACCTGATACAAAGGGAAGG + Intergenic
973874522 4:55203537-55203559 GATCACATGATTCCAAAAGATGG + Intergenic
977296442 4:95214845-95214867 TTTCTCCTGATGCAAAAGAAGGG + Intronic
978714762 4:111828109-111828131 GTTCACCAGAATACAAAGGAAGG - Intergenic
989163524 5:38413415-38413437 GTTCACTTGGTTCAAAATGCAGG + Intronic
989709682 5:44382275-44382297 ATTGATCTGATTTAAAAGGAAGG + Intronic
990999248 5:61766447-61766469 GCTCTCCGGATTGAAAAGGAAGG - Intergenic
991970594 5:72137123-72137145 GTTCAGTTTATTCATAAGGATGG + Intronic
1000494163 5:161957490-161957512 GTTCAGGTGCTTCAACAGGATGG + Intergenic
1001110612 5:168893221-168893243 GTTCACCTGATTCAAAAGGATGG + Intronic
1001528724 5:172447267-172447289 TTTCACCTGATTACAAACGAAGG - Intronic
1004896198 6:20150320-20150342 GATCACCAGATTCAAGAGGGTGG + Intronic
1005305236 6:24507112-24507134 GTTCAACTAAGTCTAAAGGAGGG - Intronic
1007835542 6:44671275-44671297 ATTCACCTGCTTCAAAGAGAGGG - Intergenic
1012853947 6:104478957-104478979 ATTCCCCAGAATCAAAAGGAGGG + Intergenic
1013894421 6:115068640-115068662 ATTCAACTGCTTGAAAAGGAAGG + Intergenic
1015529947 6:134211774-134211796 GTTCAAGTGATTCAGTAGGAGGG - Intronic
1016911200 6:149200975-149200997 GTTCACATTTGTCAAAAGGATGG - Intergenic
1016989024 6:149916725-149916747 GTACACCTAATTGAAAAGGAGGG - Intergenic
1016993970 6:149947939-149947961 GTACACCTAATTGAAAAGGAGGG + Intronic
1017004363 6:150019598-150019620 GTACACCTAATTGAAAAGGAGGG - Intronic
1017051772 6:150400061-150400083 GTTCACCTGAATCCCAAGCAGGG - Exonic
1020599259 7:10251442-10251464 TTTCAAATGATTGAAAAGGAGGG + Intergenic
1023376462 7:39561005-39561027 GTTCACTTTTTTAAAAAGGAGGG + Intergenic
1023553320 7:41392026-41392048 GATCAGGTGATTCAAAAGGCGGG + Intergenic
1025250593 7:57348924-57348946 GGACTCCTGATTCAAGAGGAAGG - Intergenic
1030043750 7:105476024-105476046 GCTCAAGTGATTTAAAAGGAGGG - Intronic
1033384608 7:140860252-140860274 GTTGACCTTTTCCAAAAGGATGG - Intronic
1034966570 7:155395029-155395051 GTTCTCCTGAAACAAAAAGATGG - Exonic
1036003928 8:4640093-4640115 GTTCATCTGATTCAACCTGATGG - Intronic
1037052783 8:14397676-14397698 TTTCTCCTGATTCAATATGAAGG + Intronic
1040127461 8:43754268-43754290 TTTCTCGTGATTCAAAAGGTGGG + Intergenic
1043711668 8:83426394-83426416 TTTCACCCTATTCAAATGGAGGG + Intergenic
1045187388 8:99852955-99852977 GTTCACCTGAGACAGAAGCAAGG + Intronic
1045676573 8:104614478-104614500 GTTCCCCTGATTCTAAATTATGG - Intronic
1047776278 8:128073386-128073408 GGTGACCTGTGTCAAAAGGAAGG - Intergenic
1051417185 9:16854162-16854184 GTTCAAGTGTTTTAAAAGGAAGG + Intronic
1051655769 9:19380189-19380211 GTTCAGCTGCTTCAAGATGAAGG - Exonic
1052199911 9:25765288-25765310 GTTCACCAAAGTCAAAATGAAGG + Intergenic
1056634598 9:88321029-88321051 GTTCACCTAATTAATAAAGATGG + Intergenic
1057236229 9:93363904-93363926 GTTCTTCTGATTCAGAAGCATGG + Intergenic
1057825627 9:98370303-98370325 TTTCACCTGCATCAAGAGGACGG + Intronic
1059634968 9:116161327-116161349 GTTCTCAGGATGCAAAAGGAGGG + Intronic
1060057299 9:120425871-120425893 GTTCACCTGAGTGGAAAGGGTGG + Intronic
1203759245 EBV:3467-3489 TTTCCCCCGATTCAAGAGGAGGG + Intergenic
1186566495 X:10668483-10668505 GTTCACATAATTTAAAAAGACGG + Intronic
1192782525 X:74308535-74308557 GTTAACCTGATTCAGTAAGAGGG - Intergenic
1198523712 X:137478300-137478322 GTGCCCCTGATTGACAAGGATGG - Intergenic
1199085488 X:143624422-143624444 ATCCAACTGATTCAAAAGAATGG + Exonic
1200247454 X:154533713-154533735 GTTCACCTGGTTCAAGGGCATGG + Intronic
1200926716 Y:8661312-8661334 GTTCTCCTGCTTCTATAGGAGGG + Intergenic