ID: 1001111577

View in Genome Browser
Species Human (GRCh38)
Location 5:168901037-168901059
Sequence CATCACAGGGTGATGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001111577_1001111581 5 Left 1001111577 5:168901037-168901059 CCTGACTTCATCACCCTGTGATG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1001111581 5:168901065-168901087 ATGTAACAAAATTGCAGGCCAGG 0: 1
1: 0
2: 5
3: 31
4: 391
1001111577_1001111582 13 Left 1001111577 5:168901037-168901059 CCTGACTTCATCACCCTGTGATG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1001111582 5:168901073-168901095 AAATTGCAGGCCAGGCACAGTGG 0: 10
1: 68
2: 586
3: 3104
4: 11765
1001111577_1001111580 0 Left 1001111577 5:168901037-168901059 CCTGACTTCATCACCCTGTGATG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1001111580 5:168901060-168901082 TGTGCATGTAACAAAATTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001111577 Original CRISPR CATCACAGGGTGATGAAGTC AGG (reversed) Intronic
901061863 1:6475342-6475364 CATCCCAGGGTGCAGAGGTCTGG - Intronic
909584020 1:77269568-77269590 CATCACATGATGATGATTTCAGG - Intergenic
911404754 1:97422632-97422654 CATGACAGGGTGGTGGATTCTGG + Intronic
911857577 1:102899990-102900012 TATTACATTGTGATGAAGTCTGG - Intronic
913451530 1:118996020-118996042 TAGCACAGGGTGCTAAAGTCTGG - Intergenic
921149492 1:212388171-212388193 CATTGCAGAGTGATGAAGTAGGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063955221 10:11259212-11259234 CCTCACATGGTGCTGAAGTCAGG - Intronic
1065019595 10:21493894-21493916 CATTACAGGCTGATTAAGTTTGG + Exonic
1065339662 10:24693040-24693062 CACTATATGGTGATGAAGTCTGG + Intronic
1065426977 10:25616010-25616032 CATCACAGGCTGATGTGCTCTGG - Intergenic
1066565182 10:36714849-36714871 TGTCACATGGTGGTGAAGTCTGG - Intergenic
1066624308 10:37390679-37390701 GAGCACAGGGAGATGAAGCCTGG - Intergenic
1067000527 10:42607465-42607487 TATCACATAGAGATGAAGTCTGG - Intronic
1067501273 10:46807239-46807261 CATATCAGGGTGATGATGTTTGG + Intergenic
1068903506 10:62297283-62297305 CAACACAGGGTGAAGAAAGCAGG + Intergenic
1070583127 10:77739196-77739218 CATCAGAGGTTGATGCAGTTTGG + Intergenic
1074591298 10:114816315-114816337 GATCACAGAGTGAGGAAGTAAGG + Intergenic
1075530023 10:123221263-123221285 CTTCACAGGGTAATGTAGTGGGG + Intergenic
1075726577 10:124613616-124613638 CACTACAGGGAGCTGAAGTCAGG - Exonic
1077139224 11:1016323-1016345 CAACAGAAGGCGATGAAGTCTGG + Exonic
1077472869 11:2772428-2772450 CATCTCAGGCTCCTGAAGTCAGG + Intronic
1078106158 11:8359347-8359369 AAACACAGGGTGATGACGTGGGG - Intergenic
1078592737 11:12659162-12659184 CATCACATGGCTATGAAGGCAGG + Intergenic
1078906739 11:15694553-15694575 CATCACAGGGTGTTGTGGTGGGG + Intergenic
1079045687 11:17100584-17100606 TATCACATAGTGATAAAGTCTGG + Intronic
1080775360 11:35381190-35381212 CATCACACGGTGATCCAGACTGG + Intronic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1084583843 11:70042342-70042364 CAGCACAGGGAGAGGAACTCAGG + Intergenic
1085973772 11:81625871-81625893 CATCCAAGGGTCCTGAAGTCTGG - Intergenic
1086926347 11:92644392-92644414 CATCACCCAGTGAGGAAGTCAGG - Intronic
1087584303 11:100098870-100098892 CACCACCGGGTGAACAAGTCCGG - Intronic
1088917149 11:114236249-114236271 CATAACAGGGCTATGAAGTTAGG + Intronic
1090304820 11:125682229-125682251 CAGCAGAGTGTGATAAAGTCAGG + Intergenic
1091785193 12:3239079-3239101 CCTCCCAGGATGATGAAGTCAGG - Intronic
1096869525 12:54584662-54584684 TATTACATGGTGCTGAAGTCTGG - Intronic
1100130796 12:91490872-91490894 CACCACAGGGTAATGAAGATGGG - Intergenic
1101712930 12:107285454-107285476 TGTCACAGAGAGATGAAGTCAGG + Intergenic
1102670540 12:114615157-114615179 CATCACAGGGTGGAGAGGGCAGG + Intergenic
1102779368 12:115550732-115550754 CATGCCTGGGTGATGAAGTATGG - Intergenic
1104434887 12:128747878-128747900 CAGCACAGGGTGGGGGAGTCTGG + Intergenic
1106025129 13:25949036-25949058 CCACAGAGGGGGATGAAGTCAGG - Intronic
1106400204 13:29422611-29422633 CATCACAGGCTTATGAAATTTGG - Intronic
1108589188 13:51897065-51897087 CACCACAGGGTGATGCAGAGTGG + Intergenic
1109504256 13:63278926-63278948 TATTACATGGTGATAAAGTCTGG - Intergenic
1109722890 13:66299064-66299086 CATAACAGGGTGAGAAAGACAGG + Intergenic
1110973947 13:81805742-81805764 GATCACAGGGTGATGATGAAAGG - Intergenic
1113481632 13:110625974-110625996 CAGCACAGTGTGATGACGCCTGG + Intronic
1114054649 14:18956907-18956929 CATCACATAGTGATGAAATCAGG + Intergenic
1114107905 14:19445024-19445046 CATCACATAGTGATGAAATCAGG - Intergenic
1117582993 14:57171757-57171779 AAGCACAGGGAGATGAAGTCTGG + Intergenic
1118257706 14:64219846-64219868 CATAAAAGGGTAATGAGGTCAGG - Intronic
1119275452 14:73351098-73351120 TATCACATAGTGGTGAAGTCTGG - Intronic
1119900343 14:78254280-78254302 CATCACAGGTTGATAAAATGAGG - Intronic
1124032810 15:26026779-26026801 AATCACAGGGGGTTGAAGTTAGG + Intergenic
1125042685 15:35210015-35210037 CATGAAAGTGTGCTGAAGTCTGG + Intergenic
1125456525 15:39865637-39865659 GATCACATAGTGGTGAAGTCAGG - Intronic
1126725139 15:51623634-51623656 AATCACAGGGTAAGGAAGTAGGG + Intergenic
1128614288 15:69097223-69097245 CATCACAGCATGGTGCAGTCAGG - Intergenic
1131207110 15:90459581-90459603 CATCAAAGGCGGAGGAAGTCGGG + Intronic
1132549323 16:547853-547875 CATGACCAGGTGGTGAAGTCGGG - Exonic
1133729437 16:8567202-8567224 CAAAACAGGGTGATGAGGCCGGG - Intergenic
1134222395 16:12365376-12365398 CATCACATGGTGTTTATGTCAGG + Intronic
1137544535 16:49391929-49391951 CTTGACAGGGTGATAAGGTCAGG - Intronic
1137746643 16:50825550-50825572 AATCACTGGGTCATGAGGTCAGG + Intergenic
1138690059 16:58758827-58758849 TATCACATAGTAATGAAGTCTGG + Intergenic
1139373824 16:66484576-66484598 CATCACAGGACGATGGAGACAGG + Intronic
1140238868 16:73183272-73183294 TATCACACAGTGATGAAGTCTGG - Intergenic
1141175612 16:81716935-81716957 AATCACAGGGGGTTGAAGTGAGG + Intergenic
1146087249 17:29841037-29841059 AATCACATGGTCAAGAAGTCAGG + Intronic
1147263418 17:39221892-39221914 CATCGCAGGGTGATGAGTTGGGG - Intronic
1147531286 17:41280595-41280617 CAACACTGGGTCATGATGTCAGG - Intergenic
1148822111 17:50365793-50365815 CATCCCATGGTGCTGAAGTAGGG - Intergenic
1149334804 17:55624758-55624780 CATGATAGGGTGATCAGGTCTGG + Intergenic
1149867593 17:60159317-60159339 CAGCGCACGGTGATAAAGTCCGG + Exonic
1156258240 18:35419952-35419974 CATTACAGTGTCTTGAAGTCTGG + Intergenic
1158780173 18:60639473-60639495 CATCAGACAGTGAAGAAGTCTGG - Intergenic
1165106502 19:33472877-33472899 CATCACTGGGTCATGGAGTGTGG - Intronic
925200215 2:1961244-1961266 CATTGCATGGTGGTGAAGTCTGG - Intronic
927801113 2:26100660-26100682 AAACACAGGGTTATGAAATCTGG - Intronic
927818947 2:26245231-26245253 CATCACAAGTTAACGAAGTCTGG + Intronic
928285599 2:29987615-29987637 CCTTAAAGGGTGAGGAAGTCAGG - Intergenic
928694917 2:33839951-33839973 CACCACATGATGATGCAGTCAGG - Intergenic
933838529 2:86265872-86265894 TATTACATAGTGATGAAGTCTGG - Intronic
934526671 2:95056358-95056380 CTTCAGAGAGTGATGAAGCCAGG + Intergenic
938083759 2:128384946-128384968 CACCACAGAGGGATGAGGTCAGG - Intergenic
938472659 2:131579761-131579783 CATCAGATAGTGATGAAATCAGG + Intergenic
938588705 2:132716621-132716643 CATCAAAGGGTGACAAACTCTGG + Intronic
939750907 2:146044999-146045021 GATCACAGGATCATGAGGTCAGG - Intergenic
940001258 2:148968245-148968267 CATCACAGGCTGAGAAAGTGTGG + Intronic
944554845 2:200877704-200877726 CATTAGAGAGAGATGAAGTCTGG + Intronic
945520969 2:210826923-210826945 CATCCTATGGTGGTGAAGTCTGG + Intergenic
948485626 2:238279114-238279136 CATCACTGGGTGAAGAAGGGAGG - Intronic
948757383 2:240167484-240167506 CTGCCCAGGGTGAGGAAGTCCGG - Intergenic
1170014950 20:11769862-11769884 CATCACAGAGTGAGGGAGTCCGG - Intergenic
1171008241 20:21489561-21489583 CACCAAAGAGTGATGAAGTTGGG + Intergenic
1172456993 20:35084321-35084343 TATCGCATGGTGGTGAAGTCAGG - Intronic
1174137365 20:48389473-48389495 CATCCAAGGGTGAAGAAGGCAGG + Intergenic
1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG + Exonic
1177298275 21:19205207-19205229 CATGACAGGTGCATGAAGTCAGG - Intergenic
1178082997 21:29084804-29084826 AATCACTGTGTGATGATGTCAGG - Intronic
1180473118 22:15679299-15679321 CATCACATAGTGATGAAATCAGG + Intergenic
1182837664 22:33357439-33357461 TATTACATAGTGATGAAGTCGGG - Intronic
1184941070 22:47765650-47765672 CATCCCAGGGGGATGGAGTGCGG + Intergenic
950422072 3:12905138-12905160 GTTCACCGGCTGATGAAGTCAGG + Intronic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
953889671 3:46742767-46742789 CATCACAGGGGAAGGAAGACAGG + Intronic
956743955 3:72296739-72296761 CATCACAGGGGGATGCAGATGGG + Intergenic
959569261 3:107865660-107865682 CATTGCATAGTGATGAAGTCAGG - Intergenic
962206709 3:133440823-133440845 CAGCATAGTCTGATGAAGTCAGG + Intronic
963358151 3:144236372-144236394 CTTCACAGGATGATAGAGTCTGG + Intergenic
963851761 3:150216691-150216713 CACCACAGGGTGCTGCAGGCTGG - Intergenic
964407215 3:156361432-156361454 TATCAAGGGGTGATAAAGTCAGG - Intronic
965972081 3:174571690-174571712 TTAAACAGGGTGATGAAGTCTGG + Intronic
966880411 3:184346750-184346772 CAGCACAGGGTGTGAAAGTCCGG - Exonic
967723962 3:192844349-192844371 CATGACAGGGTGATGAAGATAGG - Intronic
967958928 3:194902699-194902721 AATCACAGGGTGAGGGAGACTGG - Intergenic
970465140 4:16315061-16315083 CATCACAGAGTGACGCAGACTGG - Intergenic
971105951 4:23524497-23524519 CATCCCAGGGAGGTGAAGTATGG - Intergenic
971599396 4:28573007-28573029 TATCACAGGGTGATATAGTTTGG + Intergenic
974420484 4:61666070-61666092 CAACAGAGGGAAATGAAGTCTGG - Intronic
976453205 4:85216413-85216435 CATCACAGGGTCCTGAGGTGAGG - Intergenic
977088636 4:92639724-92639746 CATTACATAGTGGTGAAGTCAGG - Intronic
981636202 4:146882994-146883016 CACCTGAGGGTGATGAAGTAAGG - Intronic
983569022 4:169184638-169184660 AATCACAGGATGAGGAAGGCTGG + Intronic
985813730 5:2111154-2111176 CAGCACAGGGGGAGGAACTCTGG - Intergenic
985929302 5:3044023-3044045 CATCAAATGTTGATGAAGTATGG + Intergenic
986096293 5:4557085-4557107 CATCACAGGCATATGAATTCTGG + Intergenic
986461554 5:7977928-7977950 CATCACAGTGAGGTGAAGGCAGG + Intergenic
988909678 5:35826726-35826748 CCTCACAGGATGATGGAGTGAGG - Intergenic
992009504 5:72512551-72512573 AATCACAGGGGGTGGAAGTCAGG + Intergenic
992997032 5:82344206-82344228 CATCACTGGGTTATAAAGTCAGG + Intronic
993517959 5:88861288-88861310 CATCCCAGACTGATGAAATCAGG + Intronic
993540023 5:89137769-89137791 GATCAAAGGGAGAAGAAGTCTGG + Intergenic
994908507 5:105871288-105871310 CATCACATGGCTAGGAAGTCAGG - Intergenic
1001111577 5:168901037-168901059 CATCACAGGGTGATGAAGTCAGG - Intronic
1006114023 6:31765841-31765863 CATCACAGGGTGGGCAAGGCCGG - Intronic
1006358538 6:33574584-33574606 CATCACAGTGGTATGAAGGCTGG + Intronic
1009241518 6:61191911-61191933 CATCACAGGGTGTAGCATTCTGG + Intergenic
1010029089 6:71254474-71254496 GTTCCCATGGTGATGAAGTCAGG + Intergenic
1010493888 6:76509001-76509023 GAACACAAGGTGATGAGGTCAGG - Intergenic
1010925198 6:81736244-81736266 CATCACAGGATGTTGAGGTAAGG - Intronic
1012823133 6:104114053-104114075 CATTGCAGAGTGGTGAAGTCAGG + Intergenic
1013016519 6:106164874-106164896 CAACACAGGGTGTTGAAGGCCGG + Intergenic
1015215705 6:130747682-130747704 TATCTCAGGGTGATGAATTATGG - Intergenic
1015444093 6:133283730-133283752 TATTGCATGGTGATGAAGTCTGG + Intronic
1016227563 6:141758627-141758649 CATCACATGGTGAGGAAGCATGG - Intergenic
1016558535 6:145368320-145368342 CAACACAGTGTGATAAAGACAGG + Intergenic
1017575070 6:155793243-155793265 GGTCACAGGGCCATGAAGTCAGG - Intergenic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1017631801 6:156403259-156403281 CATCACATGGTGATATAGTTTGG + Intergenic
1018029628 6:159831686-159831708 CAGCTCAGGGTGATAAGGTCTGG + Intergenic
1018346083 6:162900349-162900371 AATCACAGGTTGAAGAAGTGAGG - Intronic
1018407844 6:163506068-163506090 CTTCACAAGGTGATGGAGGCGGG - Intronic
1019295565 7:272250-272272 CATCCCAGGGAGAGGAAATCTGG - Intergenic
1019646340 7:2131304-2131326 CATCACAAGGTGGAGAAGTGAGG - Intronic
1020212325 7:6166099-6166121 GATGGCAGTGTGATGAAGTCAGG + Intronic
1021851140 7:24809631-24809653 CATGACAGGGAGGTGAAGACTGG + Intronic
1023608070 7:41947471-41947493 CATCAGAGGGTGATGTTGCCGGG + Intergenic
1026197901 7:68188736-68188758 TATTACATAGTGATGAAGTCTGG - Intergenic
1032435039 7:131893742-131893764 CATCTCAGGCTGATAAAATCTGG - Intergenic
1035055804 7:156035356-156035378 CATCACTGTGTGATGCAGGCTGG - Intergenic
1038145622 8:24892762-24892784 CATTACAGTGTGATGGGGTCAGG - Intergenic
1038616694 8:29102137-29102159 CTTCACAGGGAGATGAACTCAGG + Intronic
1039490033 8:37940460-37940482 CATCGCATAGTGGTGAAGTCAGG - Intergenic
1042078606 8:65024204-65024226 CACCACAGGGTGATAATGGCGGG - Intergenic
1047709731 8:127539625-127539647 CATCAGATAGTGATGAAGCCTGG + Intergenic
1050279444 9:4034954-4034976 CATAGCAGTGTGGTGAAGTCAGG - Intronic
1050613469 9:7377211-7377233 CATCACAGCATGAGGAAGTATGG + Intergenic
1050798606 9:9579757-9579779 TATCACATAGTGGTGAAGTCAGG + Intronic
1052483302 9:29061016-29061038 AAGTACAGGCTGATGAAGTCTGG + Intergenic
1057907290 9:98992774-98992796 GGTCACAGGGTAGTGAAGTCAGG + Intronic
1058857598 9:109079246-109079268 AATAGCAGGGTGAGGAAGTCAGG - Intronic
1060382052 9:123184906-123184928 CATCCAGGGGTAATGAAGTCAGG - Intronic
1060851983 9:126885597-126885619 CTTCATATGGTGATGAAGTGTGG - Exonic
1189991170 X:46596515-46596537 CATCACAGGGTGATTTTATCGGG - Intronic
1192564926 X:72155638-72155660 CATCACAGGTTGAAGAACCCAGG + Intergenic
1193845968 X:86470721-86470743 CATTGCAGAGTGGTGAAGTCTGG - Intronic
1195159126 X:102154525-102154547 GATCCCAGGGAGGTGAAGTCTGG - Intronic
1196023169 X:111011406-111011428 CATGCCAGGGAGATGAAGTGTGG - Intronic
1196023218 X:111012062-111012084 CATATCAGGGAGATGAAGTGTGG + Intronic
1201296523 Y:12467960-12467982 AATCATAGGGGGTTGAAGTCAGG - Intergenic
1201672682 Y:16541882-16541904 AATCATATAGTGATGAAGTCAGG + Intergenic