ID: 1001114830

View in Genome Browser
Species Human (GRCh38)
Location 5:168930824-168930846
Sequence GGCCAAGGGACTCAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001114830 Original CRISPR GGCCAAGGGACTCAGTGTCC TGG (reversed) Intronic
900147985 1:1166706-1166728 GGACAAGGGCCTCTGTCTCCAGG - Intergenic
900414538 1:2528960-2528982 GGCCATGGCCCTCAGGGTCCTGG + Exonic
901219794 1:7577056-7577078 ACCCAAGGGACTCAGTAGCCTGG + Intronic
902550996 1:17219541-17219563 GGTCAAGGGACTGAGGGACCAGG + Intronic
902923200 1:19679412-19679434 GGCCCAAGGACTCAGGGTCTGGG - Exonic
903067393 1:20708219-20708241 GGCCATGAGTCTGAGTGTCCCGG - Intronic
903546653 1:24128213-24128235 TGCCAAGGAACTCTGTGTCAGGG + Exonic
904482961 1:30805544-30805566 AGTCAAGTGACTCAGTGTGCCGG - Intergenic
905226526 1:36482644-36482666 TGAAAAGAGACTCAGTGTCCAGG + Intronic
906040471 1:42784886-42784908 GGAGAAGGGCCTCAGTTTCCAGG - Intronic
910266809 1:85346530-85346552 GGCCAGGGGAATCAGGGCCCAGG + Intronic
912958535 1:114174119-114174141 GGCCAAGGGACTGAAAGGCCAGG + Intergenic
913267628 1:117060380-117060402 GGGCTAGGGTCTCAGCGTCCCGG + Intronic
915170214 1:153972487-153972509 TGCCAAGGTCCTCAGTGTCTGGG + Intronic
919927965 1:202202330-202202352 ATCCAAGGTATTCAGTGTCCTGG + Intronic
922806829 1:228394640-228394662 GGCCAAAACACTCAGTGGCCTGG + Exonic
1068464971 10:57377828-57377850 GGCCAAGGGGTTCAGTCTCCAGG + Intergenic
1069839043 10:71327829-71327851 GGACAAGGGACGCTGGGTCCAGG - Intronic
1072735967 10:97880027-97880049 GGCCAGGGGATGCTGTGTCCTGG - Intronic
1073379193 10:103065192-103065214 GGCCAGGGCACACAGTTTCCAGG + Intronic
1073461670 10:103669054-103669076 GGCCAGCGGGCTCAGTGGCCTGG + Intronic
1073467842 10:103704680-103704702 GGCCAAGGGCCTGTGTGCCCAGG + Intronic
1073654612 10:105399656-105399678 GGCCAAGGGAAGCAGTGTCAGGG + Intergenic
1075292038 10:121239020-121239042 GACCTAGGGAATCAGTCTCCAGG - Intergenic
1077309966 11:1883951-1883973 GACCAAGGGGCTGGGTGTCCTGG - Exonic
1078759836 11:14243132-14243154 GGAGAGGGGACTGAGTGTCCAGG - Intronic
1080989213 11:37509572-37509594 GTTCAAGGGACTCAGAATCCAGG - Intergenic
1081703362 11:45165567-45165589 GGGCAAGGCACTCACTCTCCAGG - Intronic
1082124893 11:48420804-48420826 GACCAAGGGTATGAGTGTCCAGG - Intergenic
1082695797 11:56363072-56363094 GGCCAGGAGACTCAGTCTGCAGG - Intergenic
1084192179 11:67504302-67504324 GGCCACGGGACCCCATGTCCGGG + Intronic
1084948569 11:72652235-72652257 GGAGAAGGGACTCTGTCTCCTGG - Intronic
1085252673 11:75153866-75153888 GGCCCAGAGAATCTGTGTCCTGG + Intronic
1088842985 11:113642191-113642213 CACCCAGGGAGTCAGTGTCCTGG + Intergenic
1089012584 11:115143092-115143114 GGCCAGGGGAGTCAGGGCCCTGG - Intergenic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1092261701 12:6956369-6956391 GGCCAAGGGGCTCACTGTCTTGG + Intronic
1092914515 12:13177944-13177966 GGGAAAGGGTGTCAGTGTCCTGG + Intergenic
1094807404 12:34106849-34106871 GCCCAAGGGATGCTGTGTCCTGG + Intergenic
1098694638 12:73537512-73537534 GGCCCAGGGCCCCAGTGTCATGG - Intergenic
1099837135 12:87920987-87921009 GGCCCAGGAACTCTGTCTCCTGG + Intergenic
1102035424 12:109768381-109768403 GGCCAAGGGACCCAGAGTGCTGG - Exonic
1102454918 12:113065395-113065417 GTCCAAGGTACTCGGTGGCCCGG - Intronic
1102954258 12:117049130-117049152 GCGCAAGGGACCCAGTGGCCTGG - Exonic
1106177348 13:27342610-27342632 GAGCACGGGACTCAGTGGCCGGG - Intergenic
1106589864 13:31089897-31089919 TGCCCAGGGCCTTAGTGTCCAGG + Intergenic
1108133023 13:47323662-47323684 GCACAAGGCACTCAGTGGCCAGG + Intergenic
1113458690 13:110466980-110467002 GGCCGTGGGACTCAGTGTTTAGG + Intronic
1113754348 13:112799525-112799547 GGTCATGAGACTCATTGTCCAGG + Intronic
1113950773 13:114069867-114069889 GGCCAGGAGACTCAGGGGCCGGG + Intronic
1114768652 14:25403993-25404015 TGCCAGCTGACTCAGTGTCCAGG + Intergenic
1118255449 14:64201452-64201474 GGCCATGGCACTCCCTGTCCTGG + Intronic
1118732068 14:68675366-68675388 AGGGAAGTGACTCAGTGTCCAGG + Intronic
1119936430 14:78596322-78596344 GTCCAAGGGACTCACTTGCCTGG - Intronic
1121744754 14:96279476-96279498 GGGCAAGGGACTTAGGGACCCGG - Intergenic
1129412124 15:75355895-75355917 GCCCCAGGGACTCAGTGTGGCGG + Exonic
1129908677 15:79208113-79208135 TGTCAAGGGACCAAGTGTCCAGG - Intergenic
1132324943 15:100961175-100961197 GGCAAAGGGCCTGAGTGTGCTGG + Intronic
1135419741 16:22297711-22297733 GGTCAAGGAAGTCAGAGTCCGGG - Intronic
1137286822 16:47023076-47023098 GGTCAAGGAAAGCAGTGTCCTGG + Intergenic
1141369637 16:83474985-83475007 GGCCGAGACACTGAGTGTCCAGG + Intronic
1141799218 16:86295821-86295843 GTCTAAGGGAGTCACTGTCCGGG - Intergenic
1142123756 16:88400069-88400091 GGTGAAGGGAGGCAGTGTCCGGG + Intergenic
1143184912 17:5004262-5004284 AGCCAAGGGCCTCACTGACCTGG + Intronic
1146457666 17:33020015-33020037 GGCCAAGGGAATGAGTCTCTTGG + Intronic
1146661777 17:34669688-34669710 GGCCAAGGGACTGTGGGTCAGGG + Intergenic
1147650335 17:42058389-42058411 GTCCTAGGCACTCAGTGTCCGGG - Intronic
1147771140 17:42868352-42868374 GGCCTATGAAGTCAGTGTCCAGG + Intergenic
1147911785 17:43860406-43860428 GGCCATGGGATTCACTGTCCAGG + Intronic
1148599852 17:48885860-48885882 GACCAAAGAACTCACTGTCCAGG + Intergenic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1151388099 17:73767735-73767757 GGCCAAGGGGCACAGCGTTCGGG - Intergenic
1151495305 17:74454829-74454851 GGCCAAGGGTCACAGTTCCCAGG - Intergenic
1151746462 17:76014318-76014340 GGCCCAGGGCCTCCGTGGCCTGG + Intronic
1152643984 17:81460493-81460515 GGCCAAGGGCTTCAGTGCCATGG - Intronic
1155364597 18:25036973-25036995 GTCCAAGTGGCTCAGTGTCTGGG + Intergenic
1157597461 18:48872445-48872467 GGCGTAGGGACCCAGTCTCCTGG + Intergenic
1160265898 18:77340717-77340739 TGCCAACTAACTCAGTGTCCTGG + Intergenic
1160292422 18:77606936-77606958 GGCAAAGGGTCTAATTGTCCAGG + Intergenic
1160896816 19:1407042-1407064 GGCCAAGTGACTCAGCCTCTCGG + Intergenic
1161106132 19:2444948-2444970 GGCCAAGGGGCTGCATGTCCAGG - Intronic
1161124225 19:2546863-2546885 AGCCACGGGGTTCAGTGTCCTGG - Intronic
1161321155 19:3642122-3642144 ACACAAGTGACTCAGTGTCCCGG + Intronic
1163120459 19:15214134-15214156 GTCCCAGGGAAGCAGTGTCCAGG - Intergenic
1163225201 19:15955688-15955710 GGCCAAGGCTCCCTGTGTCCAGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165816102 19:38643274-38643296 GCCCTAGGGACTCAGTGTCTGGG + Intergenic
1166270685 19:41711642-41711664 AGCCAAGGGACTCCTAGTCCTGG + Intronic
1167229011 19:48269942-48269964 GATCATGGGACTCATTGTCCAGG - Intronic
925188475 2:1865129-1865151 CGCCCAGGGACTCAGTACCCGGG - Intronic
926242253 2:11097271-11097293 CGCCAAGGCACTCAGTTCCCTGG - Intergenic
929605071 2:43228049-43228071 GGCCCAGGGAGCCAGAGTCCAGG + Intergenic
932044164 2:68330607-68330629 GACCCAGGGACTCATTGTCTTGG - Intergenic
933655097 2:84880708-84880730 CTCCAAGCGACTCAGTGCCCTGG - Intronic
935346276 2:102111357-102111379 GGCCAAGAGATACAGTGTTCTGG - Intronic
936084294 2:109456009-109456031 GGCCAAGGGGCTCCGTGAGCAGG - Intronic
938368571 2:130755236-130755258 AGCAAGGGGACTCTGTGTCCTGG + Intergenic
941180626 2:162254921-162254943 GGCCAAGGTACTCACCTTCCTGG - Intergenic
944208285 2:197180133-197180155 AGCCAAGGGCCCCAGTGTTCTGG - Intronic
946171783 2:217899948-217899970 GCACAAGGGACTTTGTGTCCTGG - Intronic
946444531 2:219726989-219727011 GGACAAGGGACTCACTGTCAAGG + Intergenic
947027427 2:225752404-225752426 GGTCATGGGACTCAGTGACTAGG - Intergenic
947582974 2:231333088-231333110 GACCAGGGGGCCCAGTGTCCTGG - Intronic
948288471 2:236806215-236806237 TGCAAAGGGACTAAGTGTCCAGG + Intergenic
1171398701 20:24857737-24857759 GGACAAGGGATTCAGCGCCCAGG - Intergenic
1174395841 20:50246459-50246481 GGCCTAGGGACTCTGTCTTCAGG + Intergenic
1175879077 20:62246218-62246240 GGCCCCGGGACGCTGTGTCCAGG + Intronic
1175888414 20:62305006-62305028 GGCCAGGGGTGTCAGTGCCCAGG + Intronic
1175982351 20:62745079-62745101 GGCCATGGGCCTCAGTGGCTGGG - Intronic
1177376221 21:20273976-20273998 GATCATGGGACTCATTGTCCAGG - Intergenic
1179934360 21:44592805-44592827 TGCAGAGGGACTCTGTGTCCCGG - Intronic
1180984583 22:19896938-19896960 GGGCGAGGGACCCTGTGTCCTGG - Intronic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1181133036 22:20745291-20745313 GCCCCAGGGCCTCAGTGACCTGG + Intronic
1184403231 22:44285976-44285998 AGCCCAAGGACTCAGGGTCCTGG - Intronic
1184728290 22:46358552-46358574 GGCCAGGGGACCAAGTCTCCAGG + Intergenic
1184918301 22:47588375-47588397 GGCCCAGGGCATCAGTGTCCAGG - Intergenic
1185029115 22:48432364-48432386 GGCCCAGGGGCTCAGTGCCAAGG - Intergenic
1185398754 22:50605363-50605385 GGCCAAAGGACTCGGTGCCTGGG - Exonic
951133337 3:19074801-19074823 GGCCCAGGGCCTCATTGCCCTGG + Intergenic
955348980 3:58180253-58180275 GTCCAAGGGAGTGGGTGTCCAGG + Intergenic
957154766 3:76533797-76533819 GACCATGAGACTCACTGTCCAGG + Intronic
957155383 3:76537900-76537922 GACCATGAGACTCACTGTCCAGG + Intronic
961109091 3:124268588-124268610 GGCCATGGGACTCACTGGTCAGG - Intronic
964300783 3:155282999-155283021 GATCACGGGACTCATTGTCCAGG + Intergenic
968428023 4:535871-535893 GGCCAAGGGTCCCTGTGGCCTGG - Intronic
968454209 4:688942-688964 GTCCGAGGGACTGAGGGTCCCGG + Intronic
968573161 4:1353112-1353134 TGCCAAGGGATTCCGTCTCCGGG - Exonic
968689983 4:1985401-1985423 GGTCAGAGGCCTCAGTGTCCCGG - Intronic
969313090 4:6365571-6365593 GGCCAAGGGACCCTGAGCCCAGG - Intronic
971577282 4:28291748-28291770 CTCCAAGGGAATCAGTGTCAGGG + Intergenic
972321779 4:37978348-37978370 GGCCAAGGGACTGAGTGCATGGG - Intronic
972399222 4:38684952-38684974 GTCCAAGAGACCCTGTGTCCTGG - Intronic
982266290 4:153541467-153541489 GGCCAAGGCACTCACTGGCGTGG + Intronic
985575044 5:670067-670089 GGCCAGGGGACTCAGAGCCTGGG - Intronic
987034430 5:14005926-14005948 GGACAAGGGACTCAGCCTCTTGG + Intergenic
987061361 5:14246938-14246960 GGCAAAGGGACTCAGTGAGCAGG - Intronic
992003882 5:72460021-72460043 GGCCAAGGGACCGCTTGTCCGGG + Intronic
996529931 5:124518035-124518057 GACCAAGGGACACAGTGAGCAGG - Intergenic
998165009 5:139837818-139837840 GGCCCAGGGCCACAGTGACCCGG + Intronic
999399825 5:151256010-151256032 GGCCCAGGGACTCAAGGTCAGGG - Intronic
1001114830 5:168930824-168930846 GGCCAAGGGACTCAGTGTCCTGG - Intronic
1001121601 5:168985420-168985442 GGCAAGGGGAGTCTGTGTCCTGG + Intronic
1001216816 5:169864153-169864175 GGCCAAGGGGCTCACAGCCCAGG + Intronic
1002800131 6:514711-514733 GCCCAAGGGACGCAGAGGCCAGG + Intronic
1003347606 6:5285243-5285265 GGCCAAAGGGAGCAGTGTCCAGG + Intronic
1005282325 6:24287224-24287246 GCCTAAGGGACTCATTGTCCCGG + Intronic
1010013416 6:71076036-71076058 GCCCCAGGGACTCAGTGGGCTGG + Intergenic
1011192801 6:84750621-84750643 GGCCAAGGGACCCAGCTTCCAGG - Intronic
1011949164 6:92942751-92942773 GGTCAAGGGACTCAGTCAACTGG - Intergenic
1017414743 6:154207691-154207713 GGCCAAGGGCCACAGTTTGCAGG + Intronic
1017907520 6:158767233-158767255 GCCCAAGGGGCTCTGTCTCCAGG - Intronic
1018853640 6:167659473-167659495 TGCAAAGGGGCTCAGTGCCCTGG + Intergenic
1019295266 7:270540-270562 GGCCAAGGGGCCCAGAGTCATGG + Intergenic
1019612514 7:1944124-1944146 GGCCACGGGACTCCCTTTCCAGG + Intronic
1020013220 7:4817487-4817509 GGCCGAGGGACTCTGGGCCCTGG + Intronic
1030385556 7:108863738-108863760 GCCCAAGGGACTGAGTGGACAGG + Intergenic
1033556183 7:142490143-142490165 GGCCAAGGAAATCTGTGTCTGGG + Intergenic
1034025677 7:147700895-147700917 TGCCAAGGGACTCCCTGTCGTGG + Intronic
1038911760 8:31972619-31972641 GGCCAAGAGAGTCAGTGAGCTGG - Intronic
1039499283 8:38003920-38003942 GGTCATGAGACTCATTGTCCAGG + Intergenic
1040578784 8:48677821-48677843 GGCCCAGGGTCTCAGAGTCTTGG + Intergenic
1041178443 8:55222001-55222023 GGCCCATGGACTCAGTCTCCTGG - Intronic
1041207605 8:55513925-55513947 GCCCATGGGCCTCAGTTTCCTGG - Intronic
1043001762 8:74768460-74768482 GGCCAAAGGCCCCAGAGTCCCGG + Intronic
1046633387 8:116644494-116644516 GGCCAAGTGATTCCGGGTCCGGG + Exonic
1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG + Intronic
1049694193 8:143975673-143975695 GGCCAGGGTGGTCAGTGTCCTGG - Intronic
1053271438 9:36752253-36752275 GGCCCAGGAGCTCTGTGTCCTGG + Intergenic
1056199572 9:84261841-84261863 GGACAAGTTACTCAGTGTCTCGG - Intergenic
1056280827 9:85039766-85039788 GGCCAAATGGCTGAGTGTCCTGG - Intergenic
1061168830 9:128940394-128940416 GGCCCAGGGGCTCCGTGTACAGG - Exonic
1061276136 9:129570227-129570249 CTCCAATGGACACAGTGTCCTGG + Intergenic
1061284246 9:129613279-129613301 GGGCCGGGGACTCAGAGTCCAGG - Intronic
1062072735 9:134566562-134566584 GGCCAAGGGGCCCAGAGGCCTGG - Intergenic
1185479482 X:435323-435345 GGCCCAGGGACCCCGTCTCCCGG - Intergenic
1188785121 X:34336295-34336317 AGCCAAGGGACTTGGTGCCCTGG - Intergenic
1189097810 X:38158592-38158614 GCCCCAGGGACTCAGAGTCTAGG + Intronic
1189127534 X:38463876-38463898 GGCCAAAGGCCTCAGAGCCCTGG + Intronic
1190931357 X:54951628-54951650 GGCCAAGGGAGTCACTGTCATGG + Intronic
1196825762 X:119739111-119739133 GGCCAAGTGAAACAGTGGCCAGG + Intergenic
1200068182 X:153514928-153514950 GGCCAAGGAACAAAGTGTCATGG - Intergenic