ID: 1001114837

View in Genome Browser
Species Human (GRCh38)
Location 5:168930879-168930901
Sequence GCCTCCTAGACAATAACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001114833_1001114837 17 Left 1001114833 5:168930839-168930861 CCTTGGCCACTTTCTTGGTGCCA 0: 1
1: 0
2: 0
3: 10
4: 249
Right 1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG No data
1001114832_1001114837 18 Left 1001114832 5:168930838-168930860 CCCTTGGCCACTTTCTTGGTGCC 0: 1
1: 0
2: 1
3: 18
4: 231
Right 1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG No data
1001114834_1001114837 11 Left 1001114834 5:168930845-168930867 CCACTTTCTTGGTGCCACATGCC 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG No data
1001114836_1001114837 -10 Left 1001114836 5:168930866-168930888 CCATGAGTGATGTGCCTCCTAGA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG No data
1001114835_1001114837 -3 Left 1001114835 5:168930859-168930881 CCACATGCCATGAGTGATGTGCC 0: 1
1: 0
2: 1
3: 11
4: 174
Right 1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001114837 Original CRISPR GCCTCCTAGACAATAACCTG TGG Intronic
No off target data available for this crispr