ID: 1001116917

View in Genome Browser
Species Human (GRCh38)
Location 5:168947709-168947731
Sequence TGGATGCAGACCCAAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001116905_1001116917 13 Left 1001116905 5:168947673-168947695 CCTGGAAGAATGTGCCCCACATG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1001116917 5:168947709-168947731 TGGATGCAGACCCAAGGGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 236
1001116909_1001116917 -1 Left 1001116909 5:168947687-168947709 CCCCACATGCAGGGCCTGAGGCT 0: 1
1: 0
2: 4
3: 31
4: 272
Right 1001116917 5:168947709-168947731 TGGATGCAGACCCAAGGGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 236
1001116910_1001116917 -2 Left 1001116910 5:168947688-168947710 CCCACATGCAGGGCCTGAGGCTG 0: 1
1: 1
2: 0
3: 32
4: 341
Right 1001116917 5:168947709-168947731 TGGATGCAGACCCAAGGGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 236
1001116904_1001116917 16 Left 1001116904 5:168947670-168947692 CCTCCTGGAAGAATGTGCCCCAC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1001116917 5:168947709-168947731 TGGATGCAGACCCAAGGGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 236
1001116911_1001116917 -3 Left 1001116911 5:168947689-168947711 CCACATGCAGGGCCTGAGGCTGG 0: 1
1: 0
2: 6
3: 51
4: 494
Right 1001116917 5:168947709-168947731 TGGATGCAGACCCAAGGGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001116917 Original CRISPR TGGATGCAGACCCAAGGGCT GGG Intronic
900149219 1:1170948-1170970 TGGGTGCAGCCCCCAGGGCCAGG - Intergenic
900744609 1:4352642-4352664 TGCTTGCAGCCCCCAGGGCTGGG + Intergenic
902923684 1:19681996-19682018 CGGATGCAGACCCAGTGGCTTGG + Intergenic
904398736 1:30241765-30241787 TGGAGACAGCCCCAAAGGCTGGG + Intergenic
904917710 1:33982350-33982372 TGGCTTCAGAGCCCAGGGCTTGG - Intronic
906152896 1:43598226-43598248 TGGAGACAGCCCCAAAGGCTGGG - Intronic
908919262 1:69170185-69170207 AGGATGCAAACCCCAGGCCTTGG + Intergenic
909550814 1:76896857-76896879 TGCATGCAGACATGAGGGCTAGG + Intronic
909614686 1:77593105-77593127 AGGATCCCAACCCAAGGGCTGGG - Intronic
909910182 1:81249069-81249091 TGCATGCAGACATGAGGGCTAGG - Intergenic
912952746 1:114131671-114131693 TGAATGCAGAGCCATGGGCTGGG - Intronic
913293614 1:117297958-117297980 TGGATTCTGTCCCATGGGCTAGG - Intergenic
915087259 1:153397226-153397248 GGGATGCAGACTCGAGGGCCAGG - Intergenic
920050853 1:203164024-203164046 TGGAGACAGTGCCAAGGGCTGGG - Intronic
922337744 1:224631462-224631484 AGAATGAATACCCAAGGGCTGGG - Intronic
923022019 1:230172338-230172360 TGGAAGCAGACCCCAGCCCTAGG + Intronic
923428026 1:233891457-233891479 AGGATGCAAGCCCAAGGCCTTGG + Intergenic
924657032 1:245981961-245981983 TGGGTGCAGACCCACGGTCATGG + Intronic
1062847287 10:717779-717801 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062847309 10:717849-717871 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062847331 10:717919-717941 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062847353 10:717989-718011 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062847375 10:718059-718081 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062847397 10:718129-718151 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062847418 10:718199-718221 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062847495 10:718478-718500 TGGATGGACACAGAAGGGCTTGG - Intergenic
1062931002 10:1352566-1352588 TGCATGCAGACATGAGGGCTGGG - Intronic
1063509380 10:6631679-6631701 TGCATGCAGACATGAGGGCTAGG + Intergenic
1063970915 10:11380752-11380774 TGCCTGCAGACCCAGGGACTGGG + Intergenic
1065442908 10:25770834-25770856 TGCATGCAGACATGAGGGCTAGG + Intergenic
1065726987 10:28676974-28676996 TGAATGCAGACCCCAGCGCTGGG + Intergenic
1066362489 10:34744918-34744940 TGGGTGCACACCCAGGAGCTCGG + Intronic
1070762863 10:79035591-79035613 TGTATGCCCACCCCAGGGCTGGG - Intergenic
1071897527 10:90083122-90083144 TGCATGCAGACATGAGGGCTAGG + Intergenic
1072011110 10:91303824-91303846 TGCATGCAGACGTGAGGGCTAGG + Intergenic
1073291729 10:102416603-102416625 TGGAGCCAGGCCCAAGGGCTGGG + Exonic
1075552475 10:123402359-123402381 TGGATGCTGACCCAGGCCCTGGG - Intergenic
1076348884 10:129801099-129801121 TGGATGGAGTCCCTGGGGCTGGG + Intergenic
1076543246 10:131227572-131227594 TGGATGCAGGCGCATGGGCTGGG - Intronic
1077138024 11:1011283-1011305 TGGCTGCACATCCAAGGCCTCGG - Exonic
1077251544 11:1563022-1563044 TGGATGCAGGGCCAAGGGCCTGG + Intronic
1077485147 11:2835073-2835095 TGGGTGCAGGCCCGGGGGCTGGG + Intronic
1077766171 11:5162366-5162388 TGCATGCAGACCTGAGGGCTAGG + Intronic
1081580312 11:44347282-44347304 TGGATGCTTGCCCAAGGGCTTGG - Intergenic
1082770841 11:57206381-57206403 TGACTGCAGAGCCAAGGTCTGGG + Intergenic
1083534628 11:63456535-63456557 TGCATGCAGACATGAGGGCTAGG - Intergenic
1083674097 11:64316013-64316035 TGGGGTCAGCCCCAAGGGCTGGG + Exonic
1084598945 11:70133535-70133557 AGCATGCAGACCCCAGAGCTGGG - Intronic
1084694624 11:70746177-70746199 TGGGGGCAGAGCCCAGGGCTGGG + Intronic
1089070073 11:115692981-115693003 TGCATGCAGCACCCAGGGCTGGG - Intergenic
1089895497 11:121926657-121926679 AGGATGAAGACCCAAGACCTGGG + Intergenic
1090984149 11:131750924-131750946 TGGATGCAGGCCCCTGGGATTGG - Intronic
1091087449 11:132736009-132736031 TTGATTCAGACACAAGGCCTGGG - Intronic
1091627967 12:2137223-2137245 TGGAACCAGAGCCCAGGGCTAGG - Intronic
1092013747 12:5139210-5139232 TGGATGGAGGCCCAGGGCCTTGG + Intergenic
1092474699 12:8808547-8808569 TGCATGCAGACATGAGGGCTAGG - Intergenic
1092592533 12:9965155-9965177 TGCATGCAGACATGAGGGCTAGG + Intronic
1092626537 12:10335015-10335037 TGCATGCAGACATGAGGGCTAGG + Intergenic
1093267829 12:17023965-17023987 TGCATGCAGACATGAGGGCTAGG + Intergenic
1093763508 12:22937044-22937066 TGGATGGTGAGCCAAGGCCTTGG - Intergenic
1093926494 12:24913559-24913581 TGGATGCAAACCCATGAGCTGGG + Intronic
1093951295 12:25166767-25166789 TGCATGCAGACATGAGGGCTAGG - Intronic
1097516691 12:60616489-60616511 TCCATGAAGACCCAAGGGCTAGG + Intergenic
1097736354 12:63185852-63185874 TGGATGAGGAGCCAAGAGCTAGG + Intergenic
1098273777 12:68793628-68793650 AGGCTGCAGGCTCAAGGGCTGGG + Intronic
1099873070 12:88371686-88371708 TGCATGCAGACTTGAGGGCTAGG - Intergenic
1102346297 12:112163322-112163344 GGCCTGCAGACCCCAGGGCTGGG - Intronic
1105344329 13:19559944-19559966 TGGGGTCAGCCCCAAGGGCTGGG - Intergenic
1105535705 13:21261630-21261652 TGGGGTCAGCCCCAAGGGCTGGG + Intergenic
1105561689 13:21498333-21498355 TGGATGGAGACACAAGGAATTGG - Intronic
1105581696 13:21704068-21704090 TGGATGCAAACCCATGAGCTGGG - Exonic
1105810817 13:23993646-23993668 TGGATTCAAACCCACAGGCTAGG + Intronic
1106193930 13:27477159-27477181 TGGATACAGGAGCAAGGGCTTGG + Intergenic
1108478016 13:50840624-50840646 AGGATGGGGACTCAAGGGCTGGG + Intronic
1108913204 13:55580327-55580349 TGCATGCAGACATGAGGGCTAGG + Intergenic
1111457707 13:88506449-88506471 AGGATGCAGGCCCAAAGCCTTGG + Intergenic
1112597033 13:100816668-100816690 TGCATGGAGACCACAGGGCTAGG - Intergenic
1113324572 13:109269133-109269155 TGCATGCAGACATGAGGGCTAGG - Intergenic
1116490365 14:45497466-45497488 TGCATGCAGACATGAGGGCTAGG + Intergenic
1116703076 14:48264452-48264474 TGCATGCAGACCTGAGGGCTAGG + Intergenic
1118000263 14:61516588-61516610 TGGTTGCAAAACCAAGTGCTGGG + Intronic
1119193980 14:72703258-72703280 TGGATGGAGACACAGGGGATTGG + Intronic
1119320018 14:73725032-73725054 TGGATTGAGACCCCAGAGCTTGG + Intronic
1120711417 14:87797319-87797341 TGGATGCAGATCCAGGCTCTAGG + Intergenic
1121501945 14:94444873-94444895 TGGTTGGAGAGCCAATGGCTGGG - Intronic
1121535249 14:94686571-94686593 TGGAAGCAGAGCCACTGGCTGGG + Intergenic
1121642259 14:95493622-95493644 TGAATGCAGCCCCATGGGATGGG + Intergenic
1121655939 14:95595687-95595709 TGGAAACAGACTCAAGGACTGGG - Intergenic
1121818821 14:96949502-96949524 TGGAAGCAGACCCAGGGTATTGG - Intergenic
1124900772 15:33820394-33820416 TAGATACAGCCCCAAGGGCATGG - Intronic
1125629538 15:41135835-41135857 TGCATGCAGACATGAGGGCTAGG - Intergenic
1126878647 15:53071086-53071108 TGGATCTAGATCTAAGGGCTGGG + Intergenic
1127490050 15:59453914-59453936 TGCATGCAGGCCCAAGGCCCTGG - Intronic
1129115115 15:73361307-73361329 AGTCTGCAGTCCCAAGGGCTAGG - Intronic
1131882298 15:96873905-96873927 TGCATGCAGACGTGAGGGCTAGG + Intergenic
1132569411 16:637528-637550 TGAATGCAGAGCCAGGCGCTTGG - Intronic
1134173705 16:11989357-11989379 TGCATGCAGACAGATGGGCTCGG - Intronic
1135143303 16:19940030-19940052 TAGAAGCAGACCCCAGGGCTTGG + Intergenic
1137648738 16:50099534-50099556 TGGAGCCAGACACAAAGGCTTGG - Intronic
1138418945 16:56886855-56886877 TGGAGGCTGCCCCAGGGGCTTGG - Intronic
1139669051 16:68479306-68479328 TGCATGCAGAGCTGAGGGCTAGG - Intergenic
1139943505 16:70622880-70622902 TGTATGCAGACATGAGGGCTAGG + Intronic
1140097229 16:71884773-71884795 TGGCTGCAGACCCAGGGGCAGGG + Intronic
1141033373 16:80608503-80608525 TGGTGGCAGACCCATGGGCATGG + Intronic
1141254835 16:82391363-82391385 AGGATGCAAACCCAAGAGGTAGG - Intergenic
1141381474 16:83581059-83581081 TAGATGCAAAACCAAAGGCTAGG - Intronic
1141826851 16:86486606-86486628 AGGATGCAGACCCAGGAGTTGGG + Intergenic
1142128157 16:88420312-88420334 TGGATGCAGCTGAAAGGGCTGGG + Intergenic
1146672528 17:34751461-34751483 AGTATGCAGCCCCATGGGCTGGG + Intergenic
1150213220 17:63452942-63452964 TGGGTGGAGAACCAGGGGCTTGG - Intergenic
1155962211 18:32004075-32004097 TGCATGCAGACATGAGGGCTAGG - Intergenic
1156052363 18:32952409-32952431 AGGGTGCAGACCCAAAGCCTTGG - Intronic
1158640319 18:59198011-59198033 TGGAAGCAGGGCCCAGGGCTGGG + Intergenic
1159230687 18:65604793-65604815 TGGATTAAGACCAAAGTGCTGGG - Intergenic
1159509232 18:69375255-69375277 TGGTTGGAGACCCTAGGGCTTGG - Intergenic
1160351452 18:78184493-78184515 TCACTGCAGACCCAAGGGCTGGG - Intergenic
1163111382 19:15162684-15162706 TGGATCCAGACACAAGTACTTGG - Intronic
1163845680 19:19637115-19637137 GGTTTGCAGACCCAAGTGCTTGG - Intronic
1165109586 19:33493902-33493924 GGCATGCAGATGCAAGGGCTTGG - Intronic
1167046395 19:47051905-47051927 TGCATGCAGACATGAGGGCTAGG + Intergenic
1167368394 19:49066265-49066287 TGAATGCACACCCAAAGCCTGGG - Intergenic
1167579239 19:50332191-50332213 TGGAGGCAGGAGCAAGGGCTGGG + Intronic
925225573 2:2181661-2181683 CGGATGCAGTGCCAAGGACTGGG + Intronic
925923951 2:8657493-8657515 AGGCTGCAGAGGCAAGGGCTGGG + Intergenic
926146254 2:10398684-10398706 GGGATGCAGATCTAAGGGCGGGG - Intronic
926463872 2:13166075-13166097 TGCACGCAGACCTGAGGGCTAGG + Intergenic
928771012 2:34701975-34701997 TGCATGCAGACATGAGGGCTAGG - Intergenic
928778521 2:34793334-34793356 TGCATGCAGACATGAGGGCTAGG - Intergenic
928928787 2:36602662-36602684 TGCATGCAGACATGAGGGCTAGG - Intronic
931026178 2:58115505-58115527 TGCATGCAGACATGAGGGCTAGG + Intronic
931608724 2:64077265-64077287 TGCATGCAGACATGAGGGCTAGG + Intergenic
932853994 2:75215855-75215877 TGCATGCAGACATGAGGGCTAGG + Intergenic
933079478 2:77968732-77968754 TGCATGCAGACATGAGGGCTGGG - Intergenic
939094789 2:137822207-137822229 TGCATGCAGACATGAGGGCTAGG - Intergenic
940107595 2:150116439-150116461 TGCATGCAGACTTGAGGGCTAGG - Intergenic
941223014 2:162808281-162808303 TGGAGGCAGAACCAGGGGATAGG + Intronic
941506820 2:166356638-166356660 TGGATGGATACACAAGGGGTTGG - Intronic
943460972 2:188171287-188171309 TGCATGCAGACATAAGGGCTAGG + Intergenic
944925152 2:204456624-204456646 TGGAAGCAGACCTAAGGTTTAGG - Intergenic
945928934 2:215835073-215835095 TGTATGAAAAACCAAGGGCTGGG - Intergenic
948446810 2:238039604-238039626 TGGAGGCAGAGCCCAGGACTTGG + Intronic
949031353 2:241798899-241798921 TGGGTGCCGGCCCATGGGCTAGG - Intronic
1169074697 20:2753486-2753508 TGTATGCAAAGCCCAGGGCTTGG + Intronic
1171135005 20:22688033-22688055 TGGATCCAGAGACAAGGGCTTGG - Intergenic
1171403533 20:24894250-24894272 TGGCTGCAGAGCAAAGGGCAGGG + Intergenic
1173245886 20:41337262-41337284 TGCATGCAGGACTAAGGGCTGGG - Intergenic
1173460457 20:43239149-43239171 TGGATTCAGACCCTAGGGAATGG + Intergenic
1173619778 20:44428276-44428298 GGGATGCAGACCTCAGGCCTTGG - Intronic
1174401472 20:50278212-50278234 TGGAGGCAGAAGGAAGGGCTTGG - Intergenic
1174449147 20:50609173-50609195 TGGATGCAAAAGCCAGGGCTGGG + Intronic
1176034592 20:63030006-63030028 TGGAGGCAGAGCCTGGGGCTGGG + Intergenic
1178001408 21:28164829-28164851 TGCACGCAGACCTGAGGGCTAGG - Intergenic
1178644334 21:34373023-34373045 TGGATGCAGAGCAGAGGGCTGGG - Intergenic
1180629964 22:17221695-17221717 TGGAAGCAGAGACAAGAGCTGGG + Intronic
1180958784 22:19753270-19753292 TGCATGCAGACACACGGACTGGG - Intergenic
1181778631 22:25177789-25177811 GGGAAGCAGAACCGAGGGCTGGG - Intronic
1182925170 22:34115594-34115616 TGGTGGCAGAATCAAGGGCTAGG + Intergenic
1184371619 22:44085800-44085822 TGGATGGATGCCAAAGGGCTGGG - Intronic
1184653567 22:45930371-45930393 TGGGTGCAGCCCCCAGGCCTCGG + Intronic
1185138187 22:49085601-49085623 AGGATGCAGAAACGAGGGCTTGG - Intergenic
951298600 3:20969595-20969617 TGCATGCAGACATGAGGGCTAGG + Intergenic
951332115 3:21380650-21380672 TGCATGCAGACATGAGGGCTAGG + Intergenic
952180315 3:30910101-30910123 TAGCTGAACACCCAAGGGCTGGG - Intergenic
952330675 3:32361899-32361921 TGCATGTAGACCCTAGTGCTTGG - Intronic
953825488 3:46248393-46248415 TGCATGCAGACATGAGGGCTAGG + Intronic
954601481 3:51874063-51874085 TGCATGCAGCCCTCAGGGCTTGG - Exonic
958183092 3:90084688-90084710 TGCATGCAGACATGAGGGCTAGG - Intergenic
964983857 3:162716225-162716247 TGCATGCAGACATGAGGGCTAGG - Intergenic
966890059 3:184400729-184400751 TGGATGAAGACCCAGAGGCTGGG + Intronic
967152339 3:186661644-186661666 TGCATGCAGACAGGAGGGCTAGG - Intronic
967996574 3:195171295-195171317 TGGTAACAGACCCCAGGGCTTGG - Intronic
969814219 4:9674688-9674710 TGTCTGCAGACCCCAGAGCTGGG - Intergenic
970443588 4:16106085-16106107 AGGGTGCAAACCCAAGGGCTGGG + Intergenic
970729887 4:19090328-19090350 TGGATGCCCACACAAGGCCTTGG - Intergenic
973717714 4:53693702-53693724 AGCCTGCAGAACCAAGGGCTAGG - Intronic
974428188 4:61766382-61766404 TGCATGCAGACATGAGGGCTAGG + Intronic
976463927 4:85346045-85346067 TGGATCAAGACTCAAGGGCCTGG - Intergenic
977074990 4:92441049-92441071 TGCATGCAGACATGAGGGCTAGG + Intronic
977225122 4:94385555-94385577 TGCATGCAGACATGAGGGCTAGG + Intergenic
979850094 4:125563718-125563740 TGCATGCAGACATGAGGGCTAGG + Intergenic
979894952 4:126147232-126147254 TGCATGCAGACATGAGGGCTAGG + Intergenic
980416647 4:132496865-132496887 TCAAGGCAGACCCAAGGACTAGG - Intergenic
980680984 4:136160008-136160030 TGAATGCAGACCCCAGGGAGAGG + Intergenic
981539934 4:145836372-145836394 TGCACGCAGACACGAGGGCTAGG - Intronic
982234509 4:153239958-153239980 TGGATGCAGTCCCAACTACTCGG - Intronic
984165138 4:176296934-176296956 TGCACGCAGACACGAGGGCTAGG + Intergenic
985389651 4:189481551-189481573 TGCATGCAGACATCAGGGCTAGG + Intergenic
985582560 5:706411-706433 TGCACGCAGACCTGAGGGCTAGG - Intergenic
985706180 5:1402725-1402747 TGGACGCACACCCATGGGCCCGG + Intronic
986081420 5:4398655-4398677 TGGATGCAGAGCCAGCCGCTGGG + Intergenic
986389087 5:7267210-7267232 TGCATGCAGACATGAGGGCTAGG - Intergenic
987594446 5:19978681-19978703 TGGATGCTGACCAAAGCACTTGG + Intronic
988202378 5:28084034-28084056 TGCATGGAGCCCCAAGGTCTGGG - Intergenic
992855394 5:80855746-80855768 TGGATGCACACCTAAGGACAAGG - Intronic
993500762 5:88663891-88663913 TGGTTGCATAGACAAGGGCTCGG + Intergenic
994532333 5:100986342-100986364 TGCATGCAGACATGAGGGCTAGG + Intergenic
995124951 5:108570564-108570586 TGCATGCAGACATGAGGGCTAGG + Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
996817635 5:127591432-127591454 TGGGTGAAGACCCAAGGCCTAGG + Intergenic
1000697658 5:164408070-164408092 TGGAGGCAGAGCCATGGGTTAGG + Intergenic
1000885079 5:166740997-166741019 TGCATGCAGACTTGAGGGCTAGG + Intergenic
1001116917 5:168947709-168947731 TGGATGCAGACCCAAGGGCTGGG + Intronic
1002772646 6:302845-302867 TGGATGGAAAGCCAAGGGCAGGG + Intronic
1003146549 6:3514889-3514911 GGGCTGCAGACCAGAGGGCTGGG + Intergenic
1003351968 6:5326462-5326484 TGGCTGCTGTCCCCAGGGCTTGG + Intronic
1005838919 6:29727726-29727748 GAGATGCAGAACCATGGGCTGGG + Intronic
1006373183 6:33657758-33657780 TGGGTGCAGCACCAAGAGCTGGG + Intronic
1006717986 6:36132200-36132222 TGGCTGGAGACCCAAGGTCAGGG + Intronic
1006877775 6:37313602-37313624 TGGAAGCAAACCCATGTGCTTGG - Intronic
1007391768 6:41553505-41553527 TGGATGGATACCCATGGACTGGG + Intronic
1010829482 6:80512401-80512423 TGCACGCAGACATAAGGGCTAGG + Intergenic
1013006097 6:106074921-106074943 TTGATGCAGGACCAAGGCCTCGG - Intergenic
1014556058 6:122843453-122843475 TGCATGCAGACGTGAGGGCTAGG - Intergenic
1015340262 6:132090957-132090979 TGGATCCTTAACCAAGGGCTGGG + Intergenic
1016249108 6:142019644-142019666 TGCATGCAGACATGAGGGCTAGG - Intergenic
1017777396 6:157690941-157690963 TGGAAGGGGACCCGAGGGCTGGG - Intergenic
1018461002 6:163998233-163998255 CGGATGCATACCCAAGGGATCGG + Intergenic
1018786843 6:167114811-167114833 TGGATGCAGAGCTAAGGACGGGG - Intergenic
1020736533 7:11956125-11956147 TGTATGCAGAACCAAGTGTTGGG - Intergenic
1022709823 7:32839999-32840021 TGCATGCAGACATGAGGGCTAGG + Intergenic
1027162620 7:75813606-75813628 AGGATGCAGTTCCAAGGGCATGG - Intronic
1029450526 7:100639726-100639748 TGGGTGCAGATCCAAAAGCTAGG - Intronic
1031173453 7:118319917-118319939 TGGATGCAGACCCTAAGGGAGGG + Intergenic
1031364552 7:120887713-120887735 TGCATGCAGACATGAGGGCTAGG + Intergenic
1031400192 7:121319180-121319202 TGCATGCAGACATGAGGGCTAGG - Intergenic
1031473981 7:122200689-122200711 GGAATTCAGACCCAAGGGCCAGG + Intergenic
1031525857 7:122820875-122820897 TGCATGCAGACATGAGGGCTAGG - Intronic
1032264685 7:130362742-130362764 TTTATGCAGAACCAAAGGCTTGG - Intronic
1034084604 7:148312133-148312155 TGCATGCAGACATGAGGGCTAGG + Intronic
1038971420 8:32640459-32640481 TGGACGCAGACACAAGTGCATGG + Intronic
1040580368 8:48693942-48693964 TGGCTGCAGAAGCAATGGCTGGG + Intergenic
1046559490 8:115818223-115818245 TGCATGCAGACATGAGGGCTAGG - Intergenic
1046765000 8:118059546-118059568 TGGCTGCAGACCACAGGGTTTGG + Intronic
1046920799 8:119726276-119726298 TGGATTCAAACCCAAGGGCCTGG - Intergenic
1048212708 8:132468765-132468787 TGAATTCAGACCTCAGGGCTGGG - Intronic
1048326063 8:133440450-133440472 TGGAAGGAGACAGAAGGGCTGGG - Intergenic
1049289680 8:141795197-141795219 TGGGTGAAGGCCCAAGGGCAGGG - Intergenic
1052653557 9:31330030-31330052 TGCATGCAGACATGAGGGCTAGG - Intergenic
1053158203 9:35794403-35794425 TGGAAGCCCACCCAAGGGCTAGG - Intronic
1053616649 9:39773706-39773728 TGGATGTAGAACCTAGGGATAGG - Intergenic
1054236867 9:62568678-62568700 TGGATGTAGAACCTAGGGATAGG + Intergenic
1054551006 9:66603184-66603206 TGGATGTAGAACCTAGGGATAGG + Intergenic
1055881950 9:81012634-81012656 TGCATGCAGACATGAGGGCTAGG - Intergenic
1056711183 9:88992848-88992870 TGGATGCAGACCTTAATGCTAGG + Exonic
1060527746 9:124330012-124330034 AGGCTGCTGACCCAAGAGCTGGG + Intronic
1060553425 9:124496397-124496419 TGGTGGGAGACCCAAGGGCTGGG - Intronic
1061557097 9:131377605-131377627 TGGATGTGGAGCCCAGGGCTGGG - Intergenic
1062589037 9:137264876-137264898 TGGAGCCAGGCCCAGGGGCTGGG + Intronic
1062614061 9:137388114-137388136 TGGATTCACATCCAAGAGCTGGG + Intronic
1187099755 X:16181267-16181289 TGCATGCAGACATGAGGGCTAGG + Intergenic
1187847638 X:23557171-23557193 TGGATTCACATCCAAAGGCTAGG + Intergenic
1188419749 X:29979163-29979185 TGCACGCAGACTCGAGGGCTGGG - Intergenic
1189847274 X:45149174-45149196 TGGATGCAGGGAGAAGGGCTGGG + Exonic
1190681623 X:52831161-52831183 TGGCTGCAGACCCAGGAGCTGGG + Intergenic
1190998696 X:55637145-55637167 TGGCTGCAGACCCAGGAGCTGGG + Intergenic
1192607979 X:72539665-72539687 TGGATCCAGGCCCATGAGCTGGG - Intronic
1193724068 X:85019992-85020014 TGGCTCAAGACCCATGGGCTAGG + Intronic
1194293405 X:92102329-92102351 TGTACGCAGACCTGAGGGCTAGG + Intronic
1194308327 X:92275153-92275175 TGCACGCAGACCTGAGGGCTAGG + Intronic
1194822561 X:98526351-98526373 TGCATGCAGACATGAGGGCTAGG + Intergenic
1195006525 X:100690712-100690734 TGGAAGGAGAGCCAATGGCTTGG + Intronic
1196226994 X:113178880-113178902 TGCATGCAGACATGAGGGCTAGG + Intergenic
1196341505 X:114603383-114603405 TGCATGCAGACATGAGGGCTAGG + Intronic
1196497078 X:116334453-116334475 TGCATGCAGACATGAGGGCTAGG - Intergenic
1197114670 X:122818228-122818250 TGGATTGAGACCCACTGGCTTGG + Intergenic