ID: 1001123986

View in Genome Browser
Species Human (GRCh38)
Location 5:169002998-169003020
Sequence CAGTGGGGCACTTATTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001123980_1001123986 30 Left 1001123980 5:169002945-169002967 CCTAGTAAAAGAAGAAGTTTGTC 0: 1
1: 1
2: 1
3: 18
4: 292
Right 1001123986 5:169002998-169003020 CAGTGGGGCACTTATTCTTTGGG 0: 1
1: 0
2: 2
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001123986 Original CRISPR CAGTGGGGCACTTATTCTTT GGG Intronic
900208988 1:1444304-1444326 CAGTTGGGCAGCTCTTCTTTTGG + Intergenic
903154673 1:21435761-21435783 CAGTGGGACACTCACTCTTCGGG + Intergenic
903328556 1:22585414-22585436 CAGTGGACTCCTTATTCTTTAGG + Intronic
908648150 1:66302147-66302169 CAGTGGGTCACTTCTGCTTCAGG - Intronic
908710025 1:67004949-67004971 CAGTGGGGAACTTATCATCTGGG + Intronic
910037498 1:82805439-82805461 AAGTGGGGCACATATTGTTTGGG + Intergenic
916295605 1:163216044-163216066 CAGTGGAGCACTGATTCTGTAGG + Intronic
919468861 1:197954221-197954243 CAGTGGAGCACATATTAGTTTGG - Intergenic
919837651 1:201586732-201586754 CAGTGGGGCCCTAATTCAATAGG - Intergenic
924459328 1:244244573-244244595 AAGTGGGTCACTCATTCTTGGGG + Intergenic
1064713795 10:18154426-18154448 GAGTGGGGCTCTAATTCATTAGG + Intronic
1068475809 10:57522948-57522970 CAGTGGGGTGCTTATCCCTTAGG - Intergenic
1070807939 10:79281602-79281624 CAGGCTGGCACTTACTCTTTGGG + Intronic
1078127132 11:8577968-8577990 CAGTGAGTCATTTTTTCTTTAGG + Intronic
1081225142 11:40512481-40512503 CAGAGGGGCAGTTATTTTTCTGG + Intronic
1087558793 11:99757420-99757442 GAGTGGGGCACTTATAGTATGGG - Intronic
1091453619 12:589038-589060 CTGTGGGAGACTTATTCTGTGGG - Intronic
1092851283 12:12629515-12629537 CAGGGGGGCAAGAATTCTTTTGG + Intronic
1093784629 12:23177889-23177911 CTGTGGGGCTCTTAGTCCTTAGG + Intergenic
1097241385 12:57577897-57577919 AAGTGAGTCACTTATCCTTTAGG - Intronic
1097970080 12:65624137-65624159 CAGTGGGGCTTATATTCTTATGG - Intergenic
1100416183 12:94378573-94378595 CAAAGGGGTATTTATTCTTTGGG - Intronic
1103004882 12:117413230-117413252 TTGTGGGGCCCTTATTCTGTTGG + Intronic
1103327724 12:120132526-120132548 CAGTGGGGCACTCATGCAGTAGG - Intronic
1108047452 13:46396640-46396662 CAGTGGGGCTCTGTTCCTTTTGG - Intronic
1110307285 13:74003905-74003927 CAGTGGGGCAGTTTTTGTTTTGG - Intronic
1110732063 13:78890020-78890042 CAGTGGAGAACTTATTGGTTGGG - Intergenic
1111017338 13:82398625-82398647 CAGTGAGACACTTTTTCTGTTGG - Intergenic
1114164801 14:20210008-20210030 CAGTGGTGTGTTTATTCTTTGGG + Intergenic
1116223619 14:42119278-42119300 CAAAAGGACACTTATTCTTTTGG - Intergenic
1128133255 15:65244888-65244910 GAGTGGGCCACTTACTCTGTGGG + Intronic
1128614583 15:69099209-69099231 CAGTTGGGCAGATATTCTTTGGG + Intergenic
1128870347 15:71150468-71150490 CAGAGGGGCAATTATTCTTTGGG - Intronic
1130642952 15:85696550-85696572 CAGTGTGCCAGTTCTTCTTTTGG + Intronic
1133176037 16:4015262-4015284 CAGTGGGGCATTTATTAACTCGG - Intronic
1133633114 16:7640632-7640654 CAGTGAGGCAATTATTCTGGGGG + Intronic
1133874017 16:9716170-9716192 CATTGGGGATCTTATTATTTTGG + Intergenic
1140708148 16:77650267-77650289 CAATGGGGCACCTACTCTTCAGG - Intergenic
1141108090 16:81249980-81250002 CAGTGAGGCAGTCATTGTTTTGG + Intronic
1141151106 16:81565259-81565281 CAGTGGGGCAAATCTTCCTTTGG - Intronic
1144686078 17:17227213-17227235 CAGTGGGCCACTTGTTTTTGTGG - Intronic
1146547996 17:33755783-33755805 CAGTGGGTCACCTCTTCCTTTGG - Intronic
1153417384 18:4862465-4862487 CAGAGGGTCCCTTATACTTTTGG + Intergenic
1164109255 19:22139351-22139373 CAGTTGGGCAGTCATCCTTTTGG + Intergenic
1168108516 19:54179157-54179179 CAATGGGGTTCTTCTTCTTTTGG + Intronic
931218823 2:60270796-60270818 CATGGGGGCACTTGTTCTTGTGG - Intergenic
934522778 2:95030406-95030428 CAGTGAGGAACTTTTCCTTTTGG + Intronic
937389517 2:121471933-121471955 CAGTGGGTGACTTTTCCTTTGGG - Intronic
942916306 2:181311978-181312000 CACTGGGGCATTTAATCTTCTGG - Intergenic
944289976 2:197994002-197994024 CAGTGAGTCACTTACCCTTTAGG + Intronic
944371600 2:198990268-198990290 TAGTGGGTCACTTATTTTTATGG - Intergenic
946552408 2:220817047-220817069 CAGAGGAGCAGTTTTTCTTTAGG + Intergenic
947033604 2:225825452-225825474 CAGTCAGGCACCTATTCTGTAGG - Intergenic
947654279 2:231812964-231812986 CAGGGGGGCACCTCTTCCTTTGG + Intergenic
947836561 2:233180118-233180140 CAGTGGGGAAGTTCTTCTTAAGG + Intronic
948315912 2:237028257-237028279 CAGTGGGGCAGTTATTGAGTTGG + Intergenic
1170644382 20:18184000-18184022 CAGAGCTGCACTCATTCTTTTGG + Intronic
1170690514 20:18611238-18611260 CAGTGTGTCACATTTTCTTTTGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172926356 20:38540088-38540110 CAGTGGAACACTTGTCCTTTTGG + Intronic
1174866664 20:54143032-54143054 CAGTGAGGCACTCATTCTGGGGG + Intergenic
1176044853 20:63087272-63087294 GAGTGAGGCACTGATTCTTAAGG + Intergenic
951608203 3:24460951-24460973 CAGTGAGGCTCTTATACTTCTGG - Intronic
952604214 3:35124740-35124762 CAGTGGGGCACTGCTGATTTGGG + Intergenic
954882080 3:53843362-53843384 GAGTGAGGCTCTTAGTCTTTTGG - Intronic
958111948 3:89159537-89159559 CAGTGGAGAATTTATTATTTTGG - Intronic
962963816 3:140335455-140335477 CAGTGGGGCTTTTTTTTTTTTGG - Intronic
966493068 3:180550774-180550796 CAGTGGGGCACCTAATGCTTTGG - Intergenic
969565154 4:7972932-7972954 CTGTGGGGCCCTTATTTTTCAGG + Intronic
969949423 4:10819132-10819154 CAGTGGGGTAGTTAATATTTGGG - Intergenic
974402673 4:61426007-61426029 CAGTGGGGCACTTCTACACTGGG - Intronic
977294615 4:95197280-95197302 CAGTGGAGTACTTATTCTCAGGG - Intronic
980835270 4:138184122-138184144 AAGGGCAGCACTTATTCTTTGGG - Intronic
983585387 4:169348738-169348760 CTGTGGAGAATTTATTCTTTTGG + Intergenic
984458780 4:180006940-180006962 CAGTGTGGCAATTCCTCTTTAGG + Intergenic
984830158 4:183965687-183965709 CATTCGGGCACTTATGCTTAGGG + Intronic
986772179 5:10984275-10984297 AAATGGGGCACTTACTCTATGGG - Intronic
986816350 5:11416030-11416052 CAGTGTGACATTTATTCTTCAGG - Intronic
987197811 5:15544753-15544775 CATTGTGGCCCTTATTGTTTGGG + Intronic
995518756 5:112979934-112979956 CAGTTTGGCGCATATTCTTTCGG - Intronic
998250863 5:140551295-140551317 CAGTGGGGCCTCTAATCTTTGGG - Intronic
998314305 5:141167148-141167170 CAGTGGAACAATAATTCTTTTGG + Intergenic
1001123986 5:169002998-169003020 CAGTGGGGCACTTATTCTTTGGG + Intronic
1004694878 6:18024345-18024367 CAGTCAGGCTCCTATTCTTTAGG - Intergenic
1005836533 6:29713692-29713714 CAGTGGGGCTATATTTCTTTAGG + Intergenic
1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG + Intergenic
1005850521 6:29817352-29817374 TAGTGGGGCGCTATTTCTTTAGG + Intergenic
1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG + Intergenic
1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG + Intergenic
1007156510 6:39750402-39750424 CAGTAGGACTCTCATTCTTTAGG + Intergenic
1007766756 6:44165263-44165285 CAGTTGGGGAATCATTCTTTTGG + Intronic
1008827723 6:55718545-55718567 CTGAGGGACACTTATTCTTAGGG - Intergenic
1010932162 6:81816373-81816395 CAGTGGAGAAATGATTCTTTAGG - Intergenic
1012584436 6:100905062-100905084 CAGTGCAGCACTACTTCTTTGGG + Intergenic
1014117259 6:117679535-117679557 CAGTTGGGCAGTTTTTCCTTTGG + Intronic
1014265031 6:119267896-119267918 CTGTGGGAGACTTATTCTATGGG + Intronic
1015598682 6:134891555-134891577 CATTGGGGCACTTTTACTCTGGG - Intergenic
1020915118 7:14183952-14183974 CAGTTGGGCACTCAGTATTTGGG - Intronic
1021025147 7:15657923-15657945 CAGTGGGGAACTTCTACTTCAGG - Intronic
1023140137 7:37093905-37093927 CATTGGGGAAATTATTCTTCAGG + Intronic
1023254097 7:38295742-38295764 CAGTGTGGCACTGATGCTGTGGG + Intergenic
1030191460 7:106814635-106814657 CCATGGGGCTCTTATCCTTTGGG - Intergenic
1030862859 7:114658284-114658306 CAGTAGAGCACTTTTACTTTGGG + Intronic
1036169987 8:6474463-6474485 CAGTGGTGCAATTTTTTTTTTGG - Intronic
1037101712 8:15055063-15055085 AAGGATGGCACTTATTCTTTAGG - Intronic
1040074082 8:43211882-43211904 CTCTGGGTGACTTATTCTTTGGG + Intergenic
1045112586 8:98948624-98948646 CAGTGGAGCACTTCTTGTTCTGG + Intronic
1047554082 8:125909910-125909932 CAGTGGGGCACAAATTATTTTGG - Intergenic
1051296998 9:15607318-15607340 CAGAATGGCAGTTATTCTTTTGG - Intronic
1052196822 9:25727460-25727482 CAGTGAGGTCCTTATTATTTTGG + Intergenic
1052338756 9:27344833-27344855 CTGTGGGGCACCTATGCTCTGGG - Intronic
1053844459 9:42221945-42221967 TTGTGGTGCACTGATTCTTTTGG - Intergenic
1193076044 X:77356748-77356770 AAGTATGACACTTATTCTTTAGG - Intergenic
1193981376 X:88185663-88185685 CAGTGGGGCACTTACTAGTGGGG + Intergenic
1198767418 X:140093302-140093324 CAGTGGTGCTCTTTTTTTTTAGG + Intergenic
1200804919 Y:7423491-7423513 CAGTTGGGCAGTTCTTCTATTGG + Intergenic