ID: 1001128117

View in Genome Browser
Species Human (GRCh38)
Location 5:169039132-169039154
Sequence TTGTAGACCCAGTTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001128117 Original CRISPR TTGTAGACCCAGTTTGAGGA TGG Intronic
900056442 1:634497-634519 TAGTAGGCCTAGTATGAGGAGGG - Intergenic
902616633 1:17627224-17627246 TTGCAGACCCAGTGTGTGTAGGG + Intronic
903543191 1:24108250-24108272 CTGGAAACCCTGTTTGAGGAGGG - Intronic
903840183 1:26233626-26233648 CTGTGGACCAAGTTTGGGGAGGG + Intergenic
904548493 1:31295859-31295881 TTCTAGACCTATTTTGAGGACGG + Intronic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
906063653 1:42964393-42964415 TAGGAGACCCAGTGTGAGGCAGG - Intergenic
909386553 1:75064330-75064352 TTGTATACCAAGTTTGTTGAGGG + Intergenic
909903240 1:81164279-81164301 TTTTATACCCAGTTTCATGAAGG - Intergenic
910225737 1:84934239-84934261 TTGTAGACCAAGTTCTTGGAGGG - Intronic
911415132 1:97562341-97562363 TTGTAAATACACTTTGAGGAGGG + Intronic
911593991 1:99780213-99780235 TTGGAGACCCAGTTCTTGGAAGG - Intergenic
911642984 1:100308496-100308518 TTGTCCACCCAGATTGAGGGTGG + Intergenic
914512035 1:148342485-148342507 TTGTAGGCCCAAGTTGATGAAGG + Intergenic
915013282 1:152709626-152709648 TTCTAGTCCCAGTTTGATGGTGG + Intergenic
915473749 1:156140503-156140525 ATATAGACCCAGTCTGAGGGTGG + Intergenic
916875287 1:168962257-168962279 TAGAAGATGCAGTTTGAGGATGG + Intergenic
916883010 1:169039987-169040009 TTCTATATCCAGTTTGATGAGGG - Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
924175427 1:241386701-241386723 TTTAAGACCCAGTTTCAGGCAGG + Intergenic
1063397336 10:5702131-5702153 TTCCATACCCAGTTTGATGAGGG + Intronic
1068619178 10:59159898-59159920 GTGTAGACAAAGTCTGAGGAGGG + Intergenic
1068957840 10:62836054-62836076 TTGTAGTCCCAGGCTGAGGCAGG + Intronic
1070040732 10:72776534-72776556 TTCTATACCCATTTTGATGAGGG - Intronic
1071220756 10:83462481-83462503 TTGTAGAACCACCTTGAGGAAGG + Intergenic
1073536287 10:104279618-104279640 TTCTAGACCAGGTTAGAGGAGGG - Intronic
1075830191 10:125402998-125403020 TTCTATACCCAGTTTGTTGAGGG + Intergenic
1077912341 11:6583920-6583942 TTCTATACCCAGTTTTTGGAGGG - Intronic
1080654233 11:34245965-34245987 TTGTGGCCCCAGGATGAGGAGGG - Intronic
1080753935 11:35177329-35177351 TTGGAGCCATAGTTTGAGGAAGG - Intronic
1082212803 11:49525967-49525989 TTATATACCCAGTTTAAGCAAGG + Intergenic
1086636793 11:89098542-89098564 TTATATACCCAGTTTAAGCAAGG - Intergenic
1087205450 11:95389109-95389131 TGATAGACACAGTTGGAGGAAGG - Intergenic
1087840823 11:102919383-102919405 TTGTAGAACTAGGTTCAGGAAGG + Intergenic
1089193537 11:116675969-116675991 TTCTATACCCAGTTTGATGAGGG - Intergenic
1090484502 11:127100797-127100819 ATGTAGGCTCAGTGTGAGGAAGG + Intergenic
1091652671 12:2321330-2321352 TTGGAGTCCCATTTTGAGCAAGG + Intronic
1093213958 12:16340811-16340833 TTCTATACCCAGTTTGTTGAGGG + Intergenic
1093394743 12:18667640-18667662 TTGAAGACCCAGTTTGTACAAGG + Intergenic
1094189446 12:27682644-27682666 TATAAGACCCAGTTTGATGAAGG + Exonic
1101976890 12:109367477-109367499 TTTCATACCCAGTTTGTGGAAGG + Intronic
1102919964 12:116784555-116784577 TAGTAGACCCATTTTCAAGAAGG + Intronic
1104265974 12:127232692-127232714 TTGTAGTCACAATTTGAGGCTGG + Intergenic
1104614101 12:130254216-130254238 TCATTGACCCAGTTTGCGGATGG + Intergenic
1104869484 12:131984479-131984501 TTGTACACCCACTTTGAGAAAGG + Intronic
1105238671 13:18588554-18588576 TTCTATACCCAGTTTGTGGAGGG + Intergenic
1105469034 13:20675028-20675050 TTCTAGTCCAAGTTTGAGCATGG + Intronic
1110724539 13:78804650-78804672 TTCTATACCCAGTTTGTTGAGGG - Intergenic
1112165466 13:96914429-96914451 TTCTATACCCAGTTTGTTGAGGG + Intergenic
1116057183 14:39877975-39877997 TTGAAGACACAGTTTAAGAATGG - Intergenic
1116854912 14:49943705-49943727 TTGTAAAGACAGTTTGATGACGG + Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1126667466 15:51088441-51088463 TTACAGATCCAGTTTGAGGTGGG + Intronic
1127324173 15:57878809-57878831 TTCTATACCCAGTTTGATGAAGG - Intergenic
1128241072 15:66101330-66101352 TTGAAGGCCCAGTGTGGGGAGGG - Intronic
1131100560 15:89685977-89685999 TTGTAGACCATGTTTGAGGTAGG - Intronic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1134650705 16:15906516-15906538 TGGAAGACCCACTTTGTGGATGG + Intergenic
1135742347 16:24986768-24986790 TTTTAGAATCACTTTGAGGATGG + Intronic
1138198120 16:55069114-55069136 TAGTAGCCCCATTTTGTGGAGGG - Intergenic
1138300489 16:55923883-55923905 TTCTATACCCAGTTTGATGAGGG - Intronic
1138893271 16:61171046-61171068 TTCTATACCCAGTTTGCTGAGGG - Intergenic
1140318734 16:73927097-73927119 TTGTTGAAGCATTTTGAGGATGG + Intergenic
1140701581 16:77586534-77586556 TTGTTGAACCTGTTTTAGGAAGG + Intergenic
1142140857 16:88472109-88472131 CTGTGGACCCAGTTCGTGGAGGG + Intronic
1142609006 17:1097667-1097689 TTGTATACCCAGTTTGCAGATGG + Intronic
1144516302 17:15919539-15919561 TTGTAGTCCCTGGTTGAGGGTGG - Intergenic
1144699667 17:17328720-17328742 TTCAAGACCCAGTCAGAGGATGG + Intronic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1154296389 18:13153576-13153598 TTTTATACTCAGTTTGATGATGG + Intergenic
1154512059 18:15116385-15116407 TTCTATACCCAGTTTGTGGAGGG + Intergenic
1156679872 18:39575448-39575470 TTTGAAACCCAGTTTGCGGAAGG + Intergenic
1159438280 18:68445972-68445994 GTGTCCACCCAGATTGAGGATGG - Intergenic
1160065801 18:75573251-75573273 TTGGAAACCGACTTTGAGGATGG + Intergenic
1160182823 18:76650495-76650517 TTGTTGAAGCAGTTTGACGATGG + Intergenic
1162040029 19:7965231-7965253 TTGTAAAACCATTTTCAGGATGG + Intronic
1165566730 19:36735924-36735946 TTCTATACCCACTTTGATGAGGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1167248281 19:48387155-48387177 TACTAGACCCATTTTGAAGATGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
925951105 2:8912057-8912079 TTGTATACCAATTTTGATGAGGG - Intronic
926765803 2:16321958-16321980 TTGTAGCCCCAGTTTTTGGAAGG + Intergenic
926961272 2:18360894-18360916 TTGTGGAATAAGTTTGAGGAAGG + Intronic
929772437 2:44903597-44903619 TTGTTGTCCCAGTTTTAGCATGG - Intergenic
929922607 2:46183189-46183211 TTTTAGGTCAAGTTTGAGGAAGG + Intronic
932673465 2:73757843-73757865 TTGTAGACACATTTACAGGATGG + Intergenic
933272314 2:80246215-80246237 TTCAAGACCCAGTTTGTGAATGG + Intronic
938511630 2:131953156-131953178 TTCTATACCCAGTTTGTGGAGGG + Intergenic
938763923 2:134447924-134447946 TGGTAACCCCAGTTAGAGGAAGG - Intronic
939226524 2:139371564-139371586 TTGTAGACCCAGGTTGACATAGG - Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
943857942 2:192823038-192823060 TTTTATACCCAGTTTGTTGAGGG - Intergenic
945656895 2:212634962-212634984 TTGTAGTCCCAGGCTGAGGTTGG + Intergenic
945756498 2:213853874-213853896 TTGTGGACAAAGCTTGAGGAGGG + Intronic
945888037 2:215397837-215397859 TCGTACACCCAGCTAGAGGAAGG + Exonic
946434225 2:219641359-219641381 TTGTACACCATGTTTGAGTATGG - Intronic
947885527 2:233566603-233566625 TTGGTGGCCCAGTCTGAGGAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169932568 20:10850513-10850535 TTCTAGACCCGGTTTGAAAATGG + Intergenic
1173957937 20:47049018-47049040 TTGAAGACCCATTTTGCAGATGG + Intronic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1176587860 21:8607051-8607073 TTTTAGTCCCAGTATGAGCAAGG + Intergenic
1176782663 21:13216826-13216848 TTCTATACCCAGTTTGTGGAGGG + Intergenic
1177104614 21:16939367-16939389 TTCTACACCCAGTTTGTTGAGGG + Intergenic
1177979846 21:27898768-27898790 TTCTATACCCAGTTTGTGGAGGG - Intergenic
1180270692 22:10584050-10584072 TTTTAGTCCCAGTATGAGCAAGG + Intergenic
1184403483 22:44287051-44287073 TTTAAGACCCTGTTTGAGGCTGG + Intronic
949139495 3:614694-614716 TTTTAGTCCCAGTATGAGCAAGG - Intergenic
949317797 3:2776082-2776104 TTGAACACAAAGTTTGAGGATGG + Intronic
950249752 3:11454469-11454491 GTGGAGAGCCAGTTTGAGTATGG + Intronic
950340080 3:12235605-12235627 TTGTAGCACCAGTATGAAGAAGG + Intergenic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
951636059 3:24778566-24778588 TTGTAGCCCCAGTTTCTGGTAGG - Intergenic
953229108 3:41048080-41048102 TTCTATACCCAGTTTCATGAGGG + Intergenic
955114103 3:55980012-55980034 TTGTAGACTGTGTTTGGGGATGG - Intronic
960792154 3:121444778-121444800 TTGTAAACCCAGTTTTTTGAGGG + Intronic
960833676 3:121880899-121880921 TTCTAGACCTAGTTTGTTGAGGG + Intronic
960866525 3:122206246-122206268 TTCTATGCCCAGTTTGATGAGGG + Intronic
961109749 3:124273955-124273977 TGGTAGACCCTGTGTGATGAAGG + Intronic
961314285 3:126023920-126023942 TTGTAGTGGCAGCTTGAGGATGG - Intronic
961702761 3:128759478-128759500 TTGTGGGCCCAGTTTGAGAATGG + Intronic
962015564 3:131436538-131436560 TTCTAGACCCAGTTTTTTGATGG - Intergenic
963320771 3:143807012-143807034 TCGGAGAGCCAGTATGAGGAAGG - Intronic
963634748 3:147780244-147780266 ATGTAGTCCCATTTTGAGAAGGG - Intergenic
964936759 3:162098617-162098639 ATGGAGACCGAGTCTGAGGAGGG + Intergenic
965026486 3:163308335-163308357 TTCTATACCCAGTTTGATGAGGG - Intergenic
965736068 3:171822477-171822499 TTATAGACCCAGATTAAAGACGG - Intergenic
967935168 3:194721656-194721678 ATGTGGACACAGTTTAAGGAAGG + Intergenic
969711289 4:8845674-8845696 CTCTACACCCAGTTTGGGGATGG + Intergenic
971568786 4:28183190-28183212 TTCTATACACAGTTTGATGAAGG + Intergenic
971797554 4:31248175-31248197 TTCTACACTCAGTTTGATGAGGG - Intergenic
973288498 4:48446241-48446263 TTGTAGTCCCAGTTACAGGGAGG - Intergenic
974267284 4:59602077-59602099 TTCTATACCCAGTTTTTGGAGGG - Intergenic
974783634 4:66588359-66588381 TTATAGACCCATTATAAGGAAGG + Intergenic
974920571 4:68234047-68234069 TTGTAGTCCCAGGCTGAGGCAGG + Intronic
978404723 4:108367098-108367120 CTGTAGACCAAGTGAGAGGATGG + Intergenic
981862275 4:149371111-149371133 ATGTAGACCCTGTTTGATAAGGG - Intergenic
981900984 4:149862952-149862974 TTCTGTACCCAGTTTGAGGAAGG - Intergenic
982340223 4:154289898-154289920 TTCTATACCCAGTTTGTTGAAGG - Intronic
987992396 5:25230457-25230479 TTTTATACCTAGTTTGATGAGGG - Intergenic
990526344 5:56631576-56631598 TTTATGACCCAGATTGAGGAAGG - Intergenic
992545247 5:77807929-77807951 TTTTACACCTAGTTTGAGGTGGG + Intronic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
992954380 5:81892186-81892208 GTGTAGACCCAGCTAGAGAATGG + Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
995279126 5:110313104-110313126 TTCTATTCCCAGTTTGATGAGGG - Intronic
996040363 5:118802686-118802708 TTCTATACCCAGTTTGATAATGG - Intergenic
996092030 5:119360935-119360957 TTGTAGACCAAGTGAGAGGCAGG + Intronic
996905171 5:128591075-128591097 TTATAGACCCACTTGGAGGTTGG + Intronic
1001128117 5:169039132-169039154 TTGTAGACCCAGTTTGAGGATGG + Intronic
1004415276 6:15417619-15417641 CTGTAGTCCCAGTTACAGGAGGG + Intronic
1007502568 6:42309896-42309918 TTGTAGTCCCAGGTTGAGGCGGG - Intronic
1008314989 6:50029060-50029082 TTGTATACCCAGTTTTTTGAAGG - Intergenic
1008862619 6:56168281-56168303 TTGTAGACGTTGTTTGATGAAGG - Exonic
1010871036 6:81039847-81039869 TTCTATACCCAGTTTGTTGAGGG - Intergenic
1011221572 6:85059923-85059945 TTGCAGACTCAGTTTGAGTCTGG - Intergenic
1011343541 6:86344709-86344731 TTCTATACCCAGTTTTATGAGGG - Intergenic
1012505165 6:99937381-99937403 TTTTATAACCAGTTTGATGAGGG + Intronic
1013672413 6:112419628-112419650 TTCTAGACCCAGTTTTTTGAGGG + Intergenic
1014262823 6:119239172-119239194 TAATAGACCCAGTTTCAGGCCGG - Intronic
1014737714 6:125113375-125113397 TAGTAGTCCCAGTTTCAAGATGG + Intergenic
1016487211 6:144554337-144554359 TTATAGACCTGGTTTGATGAAGG - Intronic
1016567900 6:145477747-145477769 TTCTATACCCAGTTTGTTGATGG - Intergenic
1017848247 6:158278803-158278825 TTGTAGAACCAGTGAAAGGAAGG + Intronic
1018761157 6:166895383-166895405 TTGTTGTCCCTGCTTGAGGAAGG + Intronic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1023648334 7:42342556-42342578 TTGTAGGACCATTTTGAGCATGG - Intergenic
1026077822 7:67188991-67189013 TTCTAAATCCAGTGTGAGGAAGG + Intronic
1026699032 7:72623126-72623148 TTCTAAATCCAGTTTGAGGAAGG - Intronic
1028398528 7:90399102-90399124 TTCTATACCCAATTTGATGAGGG - Intronic
1028817517 7:95164153-95164175 TGGTATAGCCAGTTTGAAGATGG - Intronic
1028907804 7:96174619-96174641 TTGTAGACCAAAATTGTGGATGG + Intronic
1037282536 8:17258321-17258343 TTCTATACCCAGTTCGATGAGGG + Intronic
1042082158 8:65066513-65066535 TTCTATACCCAGTTTTATGAGGG + Intergenic
1044553518 8:93537459-93537481 TTGTAGAGCCACTGTCAGGAGGG - Intergenic
1048272690 8:133042095-133042117 TTTTATACCCATTTTGGGGAGGG + Intronic
1048406914 8:134132547-134132569 TTGTAGACTCAGCTGTAGGAAGG - Intergenic
1048910808 8:139133159-139133181 TTGTATACCTAGTGTGAGGGTGG - Intergenic
1052733165 9:32312977-32312999 TTCTAGACCCAGTTTTTTGAGGG - Intergenic
1053073622 9:35115426-35115448 TTGTAGGCCCAACTTGAGGCAGG - Intronic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1059727533 9:117024083-117024105 TTGAAGAACTCGTTTGAGGATGG - Intronic
1062251375 9:135597035-135597057 TTGTTGGCCCAGGTTTAGGAGGG + Intergenic
1203406636 Un_KI270538v1:25779-25801 TTGGAGGCCCAGTTTGAAAAAGG + Intergenic
1203617866 Un_KI270749v1:85635-85657 TTTTAGTCCCAGTATGAGCAAGG + Intergenic
1185983673 X:4807025-4807047 TTGTAGAAGCAGTTTAGGGAGGG + Intergenic
1186884714 X:13901783-13901805 TTGTAGTCCTAGGTTGAGTAGGG - Intronic
1187319077 X:18224277-18224299 TTGTGATCCCAGTTTGAGGTGGG - Intergenic
1187871825 X:23771075-23771097 TTTTAGACACAGTCTCAGGAGGG + Intergenic
1187872426 X:23775665-23775687 TTTTAGACACAGTCTCAGGAGGG + Intergenic
1188299826 X:28494958-28494980 TTGTTGACACATTTTGATGATGG + Intergenic
1189940960 X:46120441-46120463 TTGTGGCACCATTTTGAGGAAGG + Intergenic
1190708345 X:53048726-53048748 TTTTAGATCCGGGTTGAGGAGGG - Intergenic
1190795167 X:53734290-53734312 TCGTTGAACCAGTTAGAGGAGGG - Intergenic
1192304064 X:69939760-69939782 TTCTATACCCAGTTTGTTGAGGG + Intronic
1192947272 X:75978385-75978407 TTGTATACCCAGTTTATTGATGG + Intergenic
1193247651 X:79248688-79248710 TTCTATACCCAGTTTTTGGAGGG - Intergenic
1194042620 X:88961142-88961164 TTCTATACCCAGTTTTATGAGGG + Intergenic
1194823843 X:98537534-98537556 GTGCAGACCCAGATTGAGGGTGG - Intergenic
1196749187 X:119099455-119099477 TTTTAGCCCCGGTTTGAGAATGG - Intronic
1196944950 X:120814525-120814547 TTTTATACCCAGGTTTAGGAAGG - Intergenic
1197260933 X:124317097-124317119 TTCTATACCCATTTTGATGAGGG - Intronic
1197593836 X:128443054-128443076 TTGTAAACATAGTTTTAGGATGG + Intergenic
1198027633 X:132723637-132723659 TTGTATACCCAGTTTTTTGAGGG - Intronic
1199245242 X:145597084-145597106 TTCTATACCCAGTTTGATTAGGG - Intergenic