ID: 1001129623

View in Genome Browser
Species Human (GRCh38)
Location 5:169053129-169053151
Sequence CTGTAGCTACAGTTGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001129619_1001129623 29 Left 1001129619 5:169053077-169053099 CCTGTAGGGTCTGCTGCTTCCTG 0: 1
1: 0
2: 2
3: 23
4: 478
Right 1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG 0: 1
1: 0
2: 2
3: 6
4: 147
1001129620_1001129623 10 Left 1001129620 5:169053096-169053118 CCTGCGCATGCTAATGCTCTTCT 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG 0: 1
1: 0
2: 2
3: 6
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001129623 Original CRISPR CTGTAGCTACAGTTGGGAGT TGG Intronic
901285565 1:8075922-8075944 CTGGAGCTCCAGGTGGGAGGTGG + Intergenic
903386647 1:22931199-22931221 CAGTAACTACAGTCGGAAGTTGG - Intergenic
903968244 1:27102813-27102835 CTGCAGCTACGGGAGGGAGTGGG - Intronic
905509207 1:38505260-38505282 ATGTGGATACATTTGGGAGTCGG + Intergenic
906102099 1:43270406-43270428 CTGCAGCTAGAGTTAGGGGTTGG + Intronic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
910438895 1:87232178-87232200 CTGTGGGTACAGATGGTAGTAGG - Intergenic
911689713 1:100819374-100819396 TTGTTGCCACAGTTGGGAGGTGG - Intergenic
913251250 1:116913389-116913411 CTGTAGCTGGAGCTGGGAGGAGG + Intronic
916292193 1:163179013-163179035 TTTTTGCCACAGTTGGGAGTTGG - Intronic
917442302 1:175078784-175078806 CTGTACCCATAGTTGAGAGTAGG + Intronic
921920425 1:220662920-220662942 TTGTTGCTACAGTTAGCAGTGGG - Intronic
922391794 1:225151317-225151339 CTGTGGATATAGTTGGGGGTGGG + Intronic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
923766818 1:236900050-236900072 CTGGACATACAGGTGGGAGTTGG - Exonic
1062832856 10:617520-617542 CCACAGCTACTGTTGGGAGTTGG - Intronic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1069652177 10:70057335-70057357 TTGTAGCTACATTTGGGTGGGGG + Intronic
1070142765 10:73750947-73750969 CTGTAGCTACAGTTGTATGCTGG + Intronic
1071949131 10:90682858-90682880 GTGCAGCTGGAGTTGGGAGTTGG + Intergenic
1074455177 10:113590034-113590056 CAAAAGTTACAGTTGGGAGTGGG + Intronic
1074570324 10:114618539-114618561 CTGGTGCTGCAGTTGGTAGTGGG - Intronic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1080371715 11:31654810-31654832 CTGTATCTAGAGATGGGAGCAGG + Intronic
1083226035 11:61285509-61285531 CTGGAGCTACCCTGGGGAGTAGG - Intronic
1085550336 11:77364089-77364111 CTGAAGCTACAGTCCTGAGTAGG + Intronic
1086573367 11:88309918-88309940 CTGTAGAAACTGTAGGGAGTAGG - Intronic
1087159899 11:94938527-94938549 TTATAGAGACAGTTGGGAGTCGG + Intergenic
1090202172 11:124864931-124864953 TTGCAGCAAGAGTTGGGAGTAGG - Intergenic
1090496352 11:127216678-127216700 CCTCAGCTACAGTTTGGAGTAGG + Intergenic
1091777804 12:3195972-3195994 CTCTAGCTGCAGTCGTGAGTGGG + Intronic
1092082926 12:5733041-5733063 CTGTTTCTCCAGCTGGGAGTTGG - Intronic
1092165428 12:6339623-6339645 CTGGAGCACCAGTTGGGAGGAGG - Intronic
1095516101 12:43007204-43007226 CTGTGGATACAGTTGCTAGTGGG - Intergenic
1099392806 12:82101427-82101449 CTGTGGCTTCAGTTTGGAGAGGG - Intergenic
1100918552 12:99455737-99455759 CTGTGGCTACTGTTGGGGGTGGG - Intronic
1102456657 12:113075109-113075131 CTGTAGCAACAGTTGCTTGTGGG - Intronic
1104814330 12:131637301-131637323 CTGAGTCTACAGTTGGGAGCTGG - Intergenic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1106472818 13:30072772-30072794 GTGTAGCTCCAGGTGGAAGTGGG + Intergenic
1111094967 13:83501157-83501179 CTGTAGCTAAAGCAGGGAGATGG - Intergenic
1115336899 14:32251117-32251139 ATGCAGCTACAGCTGGGATTCGG + Intergenic
1119171742 14:72540890-72540912 CCGTGGCAACAGGTGGGAGTGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120064404 14:80023455-80023477 CTGGAGGTACAGTTTGAAGTCGG + Intergenic
1120469804 14:84908507-84908529 ATGTAGCTTCATTTGGGAGAGGG - Intergenic
1121760454 14:96440569-96440591 CTGTAGGTATAGTTTGGATTTGG - Intronic
1123440193 15:20285324-20285346 CTGTGGCTTCAGGTGGGTGTGGG + Intergenic
1128155946 15:65392079-65392101 ATGTAGCTTCAGTGGGGACTGGG - Intronic
1129065537 15:72900993-72901015 CTGTAGGTACAGTTGTGATTAGG + Intergenic
1129091609 15:73157051-73157073 CTGCTGCCACAGTTAGGAGTGGG - Intronic
1129095754 15:73205715-73205737 CTGTCTCTACAGTTTGGGGTGGG + Intronic
1138500429 16:57439396-57439418 CTGTAGCTTTTGTTGGGGGTTGG - Intronic
1139176658 16:64697768-64697790 AAGTAGCTACAGCAGGGAGTTGG - Intergenic
1139601101 16:67987755-67987777 CTGTACCTAGAGGTGGCAGTCGG + Exonic
1140212770 16:72983839-72983861 CTGTACCCACACTTGGCAGTGGG - Intronic
1141226522 16:82121391-82121413 CTGTTGCTATAGTTGTGAATTGG + Intergenic
1145399514 17:22519934-22519956 CTGTTGCTATGGTTGTGAGTAGG - Intergenic
1148020162 17:44548130-44548152 CTGAAGCTGTTGTTGGGAGTTGG - Intergenic
1150949843 17:69790590-69790612 CTGTTGCTGAAGTTGGGAGAAGG + Intergenic
1152095431 17:78269294-78269316 CTGTAGCTGAAGGTGGGAGGGGG - Intergenic
1155053048 18:22165007-22165029 CTGGAGCTCCAGGTGGGAGCTGG - Intergenic
1159098616 18:63935094-63935116 CTGAAGCTGCAGCTGGCAGTGGG + Exonic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
926780281 2:16464630-16464652 CAGTAGCTACATTTGTGTGTAGG - Intergenic
934567956 2:95350974-95350996 CTGAAGCCAGAGTTGGGAGTTGG + Intronic
940387518 2:153090791-153090813 CTGTGGCTACTGTGGGGAATGGG + Intergenic
940804380 2:158169546-158169568 ATGCAGAGACAGTTGGGAGTAGG - Intergenic
941092837 2:161198174-161198196 CTGTTGCTCCATTTTGGAGTGGG - Intronic
943019100 2:182551516-182551538 CTGGACCTGAAGTTGGGAGTAGG - Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
945864534 2:215161704-215161726 CTGCAGCTACTGTGGGGAATGGG - Intergenic
1170544050 20:17418342-17418364 CAATAGGTAGAGTTGGGAGTAGG + Intronic
1170608990 20:17895921-17895943 CCGTGGCTACAGCTGGGTGTAGG + Intergenic
1171182278 20:23099511-23099533 CTGAATCTACAGTGGGGAGATGG - Intergenic
1174335183 20:49854602-49854624 CTGTATCTACTGTTGGGGGTAGG + Intronic
1174411314 20:50338540-50338562 CTGGAGCTACAGGTGGGGTTGGG - Intergenic
1178478966 21:32962580-32962602 CTGTTGCTACTGGTGGGGGTGGG + Intergenic
1182819414 22:33202231-33202253 CAGTTTCTAAAGTTGGGAGTGGG - Intronic
1184981052 22:48096327-48096349 GTGTAGGTACAGGTGGGATTGGG + Intergenic
949780707 3:7684539-7684561 ATGTAGCTGCAGTGTGGAGTTGG - Intronic
953872992 3:46643819-46643841 CAGTAGTTACAGTTGCTAGTAGG - Intergenic
955266484 3:57449657-57449679 CTGGAGTTACAGGTGGGCGTGGG - Intronic
955489974 3:59472142-59472164 CTGTACCTCCTGTTGGGGGTGGG - Intergenic
955722314 3:61895754-61895776 CTGTTGCTGCAGATGAGAGTTGG + Intronic
958480791 3:94643427-94643449 CTGTGGCTGCTGTTGGGAGTGGG + Intergenic
958647106 3:96887763-96887785 CTGTGGCTACTGTTGGGGATGGG + Intronic
961085483 3:124063723-124063745 CTGTAGCTATATTTGGCAGATGG + Intergenic
961464055 3:127070857-127070879 CTGTGGCTACAGTTCGGAGAGGG + Intergenic
961683273 3:128613051-128613073 CTGGGGATACAGTCGGGAGTGGG - Intergenic
962567340 3:136674932-136674954 CTCTAGCAAAAGTTGGGGGTTGG + Intronic
965921946 3:173927699-173927721 CTGGAGCGGCAGTTGAGAGTGGG - Intronic
972270118 4:37502725-37502747 CTGCAGCTGCAGGAGGGAGTAGG + Intronic
972347995 4:38209848-38209870 CTGTTGCAACAATTGGGATTAGG + Intergenic
972409101 4:38774210-38774232 CTTTAGGTACAGTTTGGATTTGG + Exonic
974128983 4:57730089-57730111 CTGGAGTTCCAGGTGGGAGTGGG - Intergenic
977739692 4:100463655-100463677 CTGCAGCTGGAGATGGGAGTGGG - Intronic
979484536 4:121255413-121255435 CTGTAGCTATGGTTTGGAGCAGG - Intergenic
981914547 4:150019474-150019496 CTGTAGCTACAGGTGTTAGAGGG - Intergenic
984909473 4:184659271-184659293 CAGTAGCTACAGTTGAGTTTAGG + Intronic
985005766 4:185534687-185534709 TTGTAGCTAGAGTTAGAAGTTGG + Intronic
986157133 5:5187540-5187562 CCGAAGCTTCAGCTGGGAGTGGG - Intronic
986174688 5:5341719-5341741 CTGTGGCTGCAGTGGGCAGTGGG + Intergenic
986292240 5:6409585-6409607 ATGTAGCTAGATTTAGGAGTAGG + Intergenic
986521125 5:8619534-8619556 CTGTTGCCATAGTTGTGAGTAGG - Intergenic
986827647 5:11539395-11539417 CTGTAGCTCCAGTGGGTTGTGGG - Intronic
987109121 5:14668214-14668236 ATGCTGCTACAGTTCGGAGTAGG + Intronic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
995817805 5:116191610-116191632 CTGTGGCTGCTGTTGGGGGTTGG - Intronic
997570499 5:134923671-134923693 CTGTTGCTATAGTTGTAAGTAGG + Intronic
999897034 5:156045840-156045862 CTGTGGCTACAGTTGGAGGGGGG - Intronic
1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG + Intronic
1002201293 5:177530090-177530112 GTGCAGATGCAGTTGGGAGTAGG + Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1003886275 6:10524027-10524049 AGGAAGCCACAGTTGGGAGTTGG + Intronic
1004427267 6:15514782-15514804 CTGTGACTGCAGTTGGGGGTAGG - Intronic
1004735037 6:18397277-18397299 CTTAAGCTATTGTTGGGAGTAGG + Intronic
1008270514 6:49483727-49483749 CTGTAGTTCCAGGTGGGCGTGGG - Intronic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1013791984 6:113847851-113847873 GGGTAGCTACAGTTGAGATTGGG + Intergenic
1014020671 6:116585169-116585191 TTGTAGCTACATATGGGACTAGG - Intronic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1023387201 7:39670928-39670950 CTGTGGGACCAGTTGGGAGTAGG - Intronic
1023972455 7:45000844-45000866 CGCTAGCTACATTTGGCAGTGGG + Intronic
1025807550 7:64849613-64849635 CTGCAGCTGCAGTGGGAAGTGGG + Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1031149861 7:118041095-118041117 ATGTAATTACAGTGGGGAGTGGG - Intergenic
1033690606 7:143732950-143732972 CTGTAGATACAGCTGTGAATAGG - Intergenic
1035024427 7:155816756-155816778 CTGAAGCTACATTTGGGAGTTGG + Intergenic
1037434620 8:18849572-18849594 CTGTTGCCATAGTTGTGAGTAGG - Intronic
1040388162 8:46927938-46927960 CTGTAGCCACATGAGGGAGTGGG - Intergenic
1041431405 8:57784910-57784932 ATGGAGCTACGGTTGGGTGTGGG - Intergenic
1042121253 8:65490809-65490831 GAGTAGCTTCAGTTGGGAGCAGG - Intergenic
1042185324 8:66131000-66131022 GACTAGCCACAGTTGGGAGTGGG + Intronic
1042798222 8:72687863-72687885 AAGGAGCTATAGTTGGGAGTTGG + Intronic
1046223680 8:111248756-111248778 CTGTTGCCATAGTTGTGAGTAGG + Intergenic
1047350284 8:124067073-124067095 CTGGAGAGACAGTGGGGAGTAGG + Intronic
1047853835 8:128888397-128888419 CTGTAACTACAGTAGGAATTAGG + Intergenic
1048192800 8:132305670-132305692 CAGAAGCTACTGTTGGGGGTTGG - Intronic
1055730211 9:79273177-79273199 TTGTATCTAAACTTGGGAGTTGG - Intergenic
1056808479 9:89746213-89746235 CTGGAGCTACAAGTGGGAGGGGG + Intergenic
1057575992 9:96243242-96243264 CTCCAGCTTCAGCTGGGAGTGGG + Intronic
1057925489 9:99143560-99143582 CTGTATGTAAAGTGGGGAGTGGG - Intronic
1058784576 9:108374610-108374632 CTGTGGCTACTGTGGGGAATAGG + Intergenic
1059673783 9:116516937-116516959 CTGTAGCTGCTGTGGGGAATGGG - Intronic
1061896457 9:133651048-133651070 CTGTAGCTACAACTGGAAGGTGG - Intronic
1062001996 9:134220843-134220865 TTGTAGCTACAGATGAGAATAGG + Intergenic
1187590720 X:20714189-20714211 TTGGAGCTGGAGTTGGGAGTGGG + Intergenic
1190873456 X:54443922-54443944 TTGAAGCAACAGTGGGGAGTAGG - Intronic
1191783661 X:64894692-64894714 CTGGAGTCAGAGTTGGGAGTAGG + Intergenic
1194909919 X:99629746-99629768 CTGTATATACAGTTGGGAAGAGG - Intergenic
1194933953 X:99924736-99924758 CAGTGGCTACAGTTTGGAGGAGG - Intergenic
1195615797 X:106910886-106910908 CTATAGCTAGACTTGGGTGTGGG + Intronic
1197992399 X:132332152-132332174 AGGTAGATACTGTTGGGAGTTGG + Intergenic
1198989309 X:142492310-142492332 CTGTAGCTACAGGTGCCAGAAGG - Intergenic
1200078774 X:153565345-153565367 CTGTAGCTAAAGGTGTGTGTGGG + Intronic