ID: 1001130125

View in Genome Browser
Species Human (GRCh38)
Location 5:169056987-169057009
Sequence GTCTCCATAATGACAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001130122_1001130125 24 Left 1001130122 5:169056940-169056962 CCTCATTTTCTCAGCTGTAAAGT 0: 2
1: 3
2: 38
3: 298
4: 1391
Right 1001130125 5:169056987-169057009 GTCTCCATAATGACAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001130125 Original CRISPR GTCTCCATAATGACAAGAGC AGG Intronic
No off target data available for this crispr