ID: 1001132168

View in Genome Browser
Species Human (GRCh38)
Location 5:169073302-169073324
Sequence CCAGTTGGTCAGTTGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 2, 2: 0, 3: 11, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001132157_1001132168 8 Left 1001132157 5:169073271-169073293 CCTTAGCCCCGCAGGATGAACAC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1001132168 5:169073302-169073324 CCAGTTGGTCAGTTGGGCCTTGG 0: 1
1: 2
2: 0
3: 11
4: 135
1001132159_1001132168 2 Left 1001132159 5:169073277-169073299 CCCCGCAGGATGAACACCTGGTG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1001132168 5:169073302-169073324 CCAGTTGGTCAGTTGGGCCTTGG 0: 1
1: 2
2: 0
3: 11
4: 135
1001132162_1001132168 0 Left 1001132162 5:169073279-169073301 CCGCAGGATGAACACCTGGTGGT 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1001132168 5:169073302-169073324 CCAGTTGGTCAGTTGGGCCTTGG 0: 1
1: 2
2: 0
3: 11
4: 135
1001132160_1001132168 1 Left 1001132160 5:169073278-169073300 CCCGCAGGATGAACACCTGGTGG 0: 1
1: 0
2: 1
3: 35
4: 494
Right 1001132168 5:169073302-169073324 CCAGTTGGTCAGTTGGGCCTTGG 0: 1
1: 2
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001132168 Original CRISPR CCAGTTGGTCAGTTGGGCCT TGG Intronic
902548658 1:17206296-17206318 CCAGGTGGGCAGCTGGCCCTGGG - Intronic
903135015 1:21303575-21303597 CCAGTTTGTGAGTTCTGCCTTGG - Intronic
906113186 1:43338069-43338091 ACAGCTGGTGAGTTGGCCCTGGG - Intronic
906202051 1:43966652-43966674 CGAGATGGACAGGTGGGCCTGGG + Intronic
908014469 1:59816090-59816112 CCAGTTGTTTAGTTGCGTCTAGG + Intronic
910276480 1:85454459-85454481 CCTGTTGGCCAGTTGGGTCCTGG - Intronic
910455813 1:87396243-87396265 CCATTTGGTCAGCAGGGGCTAGG - Intergenic
916660954 1:166921809-166921831 CCAGTAGGTAACTTGGCCCTTGG - Intronic
917109420 1:171530140-171530162 GCAGCTGGTCAGTTGGACTTTGG + Intronic
919809140 1:201398317-201398339 CCAGGTGGGCATTTGGGTCTTGG - Intronic
1063275959 10:4568279-4568301 CCAGATCCTCAGTTGGGTCTTGG - Intergenic
1063835009 10:10002491-10002513 TCAGGTGGTCATTTGAGCCTTGG - Intergenic
1064179549 10:13102278-13102300 CTGGTGGGTCAGTTGGGCCTGGG + Intronic
1064666149 10:17653998-17654020 CCAGTTGGTCAGAAGTGCCTGGG + Intronic
1065416138 10:25488341-25488363 CCAGTTTTTCAGTTGGGCACAGG - Intronic
1069780692 10:70953554-70953576 CCAGGTGGTCAGTCTGGCCTGGG + Intergenic
1071089063 10:81897960-81897982 ACAGTGGGGCAGTGGGGCCTGGG - Intronic
1072493860 10:95935222-95935244 CCAGTTGCTCAGTTGAACCTTGG + Intronic
1073327407 10:102650740-102650762 CCAGGTGGGAAGTGGGGCCTTGG + Intronic
1073627511 10:105114573-105114595 ACAGTTGGCCACTTGAGCCTGGG + Intronic
1076368852 10:129938889-129938911 CCAACTGGTCACTTTGGCCTTGG - Intronic
1076687294 10:132203921-132203943 CTATCTGGTGAGTTGGGCCTGGG + Exonic
1078417856 11:11180453-11180475 ACAGTTGTGCAGTGGGGCCTGGG + Intergenic
1079572585 11:21962815-21962837 CAAGAGGGTCACTTGGGCCTGGG + Intergenic
1080274793 11:30491669-30491691 CCACTTGCTCAGTGGGACCTTGG - Intronic
1081462281 11:43283074-43283096 CCAGTTTGTCAGTGGGGGCTTGG - Intergenic
1083923201 11:65791405-65791427 CCATGTGGTCAGTGGGGCCCAGG + Intronic
1084166518 11:67377369-67377391 CCAGTTGGCCAGTGTGACCTTGG + Intronic
1084266514 11:68008091-68008113 CCAGAGGCTCAGTAGGGCCTGGG - Intergenic
1084598072 11:70128973-70128995 CCAGGTGGTCACTGTGGCCTGGG + Intronic
1084980061 11:72824235-72824257 CCTGTGAGTCTGTTGGGCCTTGG + Intronic
1087006363 11:93476044-93476066 CCATTTGGCCAGTAGAGCCTTGG + Intergenic
1088431123 11:109759943-109759965 CCTGTTGGAGAGTTGGGTCTAGG + Intergenic
1089462618 11:118661860-118661882 CCCCTTGGTCTCTTGGGCCTGGG + Intronic
1100926065 12:99549866-99549888 GCAGTTAGGCAGTTAGGCCTGGG - Intronic
1101584268 12:106070888-106070910 CCAGGTGGACAGCTGGGCCCTGG - Exonic
1102539699 12:113609976-113609998 TCTGTAGGTCAGTTTGGCCTCGG + Intergenic
1107041557 13:35953795-35953817 CCAGTTTCTCAGCAGGGCCTAGG + Intronic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1116440994 14:44952624-44952646 CAAGTAGGTCACTTGAGCCTAGG - Intronic
1117079951 14:52141601-52141623 CCAGTTTGTCAGCAGGGCCCAGG - Intergenic
1117591828 14:57278051-57278073 CCAGTTGGTCAGTTTGATCCAGG + Intronic
1119290626 14:73492103-73492125 CCAGTTCCTCGGTTGGGACTCGG - Exonic
1121287152 14:92745068-92745090 CCAGAGGGTCACTTGGGCCCAGG + Intronic
1132330678 15:101010211-101010233 CCTGTTGGTCAGTGGAGCCAGGG + Intronic
1135567056 16:23519268-23519290 CCAGTGGATCACTTGAGCCTAGG - Intronic
1136613139 16:31379468-31379490 ACAGGTGGTCGGTGGGGCCTTGG - Intronic
1137314089 16:47298879-47298901 CCAGGTGGTGGGTTGGGCCCTGG + Intronic
1138226763 16:55302684-55302706 CCAGTTGGCCTCTAGGGCCTGGG - Intergenic
1139515770 16:67451514-67451536 CCAGGTGGTGACATGGGCCTGGG + Intronic
1139582156 16:67880174-67880196 TCAGTTTGTCAGCTGGGGCTGGG - Exonic
1143121454 17:4610058-4610080 TCAGTTGGTCAGTTTGGGGTGGG + Intergenic
1143330647 17:6132486-6132508 CCTTTTGGTCACTTGGGCTTGGG + Intergenic
1144427906 17:15161719-15161741 CCAGTGGGTGAACTGGGCCTGGG + Intergenic
1144754149 17:17669318-17669340 TCAGTGGGGCAGTTGGGCCTAGG - Intergenic
1147110514 17:38257620-38257642 GCAGTTGGTCAGTTCAGCCAGGG + Intergenic
1147560702 17:41507246-41507268 CCCCTTGGTGAGTGGGGCCTGGG - Intergenic
1148418996 17:47530811-47530833 GCAGTTGGTCAGTTCAGCCAGGG - Intronic
1148711216 17:49682610-49682632 TCAGTTGGGCAGTTGGTCCCCGG + Intergenic
1151272672 17:73008966-73008988 CCGGTGGATCAGTTGAGCCTGGG + Intronic
1152190530 17:78884965-78884987 CCTGCTGGCCAGTTGGGCTTTGG - Intronic
1152423064 17:80204409-80204431 CTAGTTGGTCAGCTGGGGCAGGG + Intronic
1152513097 17:80803563-80803585 CCAGCTCGTCAGCGGGGCCTCGG + Intronic
1152593985 17:81229371-81229393 TCAGCAGGTCAGATGGGCCTGGG + Exonic
1154150741 18:11904544-11904566 CCAGTGGATCACTTGAGCCTAGG - Intronic
1157109108 18:44802965-44802987 TCTGTGGGTCATTTGGGCCTGGG + Intronic
1160669160 19:348589-348611 CCAGTTGGTCACAGGTGCCTGGG - Intergenic
1160812513 19:1019125-1019147 ACAGGTGGTCAGATGGGGCTGGG - Intronic
1162109187 19:8390864-8390886 CCAATAGGTGGGTTGGGCCTGGG + Intronic
1162769613 19:12941151-12941173 CCAGTTAGTTAGCTGGGGCTGGG + Intronic
1163634934 19:18433419-18433441 CCAGGTGGAGGGTTGGGCCTGGG - Intronic
1164269922 19:23663489-23663511 CATGTTGGTCAGGTGGGTCTTGG - Intronic
1164698208 19:30262659-30262681 CCAGGTGGTCAGAGGGACCTGGG + Intronic
1165760674 19:38319693-38319715 CCCGTTGGTCTGCTGGGTCTGGG + Intergenic
1165848657 19:38835980-38836002 CAGGTGGGTCAGTTGAGCCTAGG - Intronic
1167434311 19:49470311-49470333 CCAGTTTGTCGAGTGGGCCTCGG + Exonic
1167481287 19:49733234-49733256 CCAGTGGATCACTTGAGCCTAGG + Intergenic
1167945217 19:52982740-52982762 CAAGTGGGTCAGTTGAGCCCAGG + Intergenic
927880745 2:26688370-26688392 CAGGTGGGTCAGTAGGGCCTGGG - Intergenic
929023190 2:37574594-37574616 CAAGTGGGTCATTTGAGCCTGGG + Intergenic
930196246 2:48513435-48513457 CCAGCTTATCACTTGGGCCTGGG - Intronic
935098749 2:99972055-99972077 GCAGATGGTCAGCTGGCCCTAGG - Intronic
936044925 2:109180065-109180087 CCATTTGTTCAGCTGTGCCTGGG - Intronic
936412103 2:112269027-112269049 ACAGTTGGTGTCTTGGGCCTGGG + Intergenic
937245784 2:120491662-120491684 CCAGTTGGACTTTTGGTCCTTGG + Intergenic
938055010 2:128208289-128208311 CCAGTTGGGCAGCTGGGCAGAGG - Intergenic
943115441 2:183664174-183664196 ACAGTTGGACAGTTGGTCTTGGG - Intergenic
949036120 2:241816474-241816496 ACAGTTGGTCAGTGGGCCCCGGG + Exonic
1171520327 20:25770679-25770701 CTAGTTGGTCACTAGGCCCTAGG + Intronic
1171556592 20:26085814-26085836 CTAGTTGGTCACTAGGCCCTAGG - Intergenic
1176365236 21:6028864-6028886 CCCGATGGTCAGACGGGCCTGGG - Intergenic
1179758282 21:43509681-43509703 CCCGATGGTCAGACGGGCCTGGG + Intergenic
1180877525 22:19181636-19181658 CCTGGTGGACAGCTGGGCCTGGG - Intronic
1181089104 22:20459918-20459940 CCTGCTGGTCAGCGGGGCCTGGG + Intronic
1184428903 22:44429497-44429519 CCAGATGCTCAGATGGGCCTGGG - Intergenic
1184948640 22:47823033-47823055 TCAGTAGTTGAGTTGGGCCTGGG - Intergenic
950885805 3:16361838-16361860 CCAGTTAGCCAGTTGGTTCTAGG + Intronic
951097835 3:18652492-18652514 TCATTTGGTCACTTGGGCTTAGG - Intergenic
951926118 3:27910328-27910350 CAAGTTGGTCCACTGGGCCTTGG - Intergenic
955232695 3:57113066-57113088 CCATTTGTTCAGGTGGGCCTGGG - Intronic
955884467 3:63583170-63583192 TCAGTTGATCAGTTGGGGCAGGG + Intronic
958143957 3:89600175-89600197 TCAATTGTTCAGTTGGGGCTTGG + Intergenic
961531000 3:127540397-127540419 CCAGTCCGTCAGGTGGGCCCGGG - Intergenic
962967958 3:140371538-140371560 CCAGTTGGCCACCTGTGCCTGGG + Intronic
962999366 3:140663812-140663834 CCATTTGTTCAGTTTTGCCTTGG - Intergenic
972900251 4:43673216-43673238 CCAGCTGCTCTGGTGGGCCTTGG + Intergenic
975736097 4:77382690-77382712 CCAGTGGGCAAGTTGGGCCCTGG - Intronic
983188307 4:164726253-164726275 CCAGTGGATCACTTGAGCCTAGG + Intergenic
999672616 5:153970965-153970987 CAAGAAGGTCAGCTGGGCCTTGG + Intergenic
1000098269 5:157990050-157990072 TCAGTTGGTCAGGTGGTCTTTGG - Intergenic
1001132168 5:169073302-169073324 CCAGTTGGTCAGTTGGGCCTTGG + Intronic
1006021198 6:31118606-31118628 CCACGGGGTAAGTTGGGCCTGGG - Intronic
1006816006 6:36850429-36850451 CCAGCCAGTCAGTTTGGCCTGGG + Intergenic
1006887125 6:37391232-37391254 TCAGTTGCTCAGCTGGGCTTTGG + Exonic
1007795357 6:44342754-44342776 CCAGTTGGTTCGTTGGTCCGTGG + Exonic
1010658186 6:78537304-78537326 TCAATTGGTCAATTGGGCATGGG + Intergenic
1010832982 6:80553593-80553615 CCAGATGGGAGGTTGGGCCTAGG + Intergenic
1013046274 6:106488763-106488785 CCAGTTGTTCCTTTGGGCCTAGG + Intergenic
1013141017 6:107334922-107334944 CAAGGTGGTCAGATGAGCCTAGG + Intronic
1016144128 6:140648187-140648209 ACAGTGGGTCAGTGGGTCCTTGG + Intergenic
1017107813 6:150904644-150904666 TCAGTTGCTCAGTAGGGCCTGGG + Intronic
1019528018 7:1489507-1489529 GCAGTTTGTCTGTTGGGACTTGG - Intronic
1023644338 7:42293574-42293596 CCACTTGGTCAGCTGGGATTGGG + Intergenic
1023790100 7:43747170-43747192 CCAGAGGATCACTTGGGCCTGGG - Intergenic
1026163116 7:67888268-67888290 GCAGTTGGGCAGTTGGGCAGAGG - Intergenic
1027387523 7:77673216-77673238 GTAGATGGTCACTTGGGCCTAGG + Intergenic
1034444943 7:151109098-151109120 CCAGTTGATCACTTGAGCCCAGG + Intronic
1035788024 8:2278007-2278029 GCACTTGTTCAGTTTGGCCTAGG + Intergenic
1035804783 8:2443706-2443728 GCACTTGTTCAGTTTGGCCTAGG - Intergenic
1044187168 8:89267624-89267646 GCAGTTGGTCAAATGGGCTTAGG + Intergenic
1046677922 8:117132646-117132668 CCAGTTAGGCCGTTGGCCCTTGG + Intronic
1049675040 8:143885575-143885597 CCAGTGGGCCAGACGGGCCTTGG - Intergenic
1049792167 8:144477194-144477216 CCAGTGGGTCACTTGAGCCCGGG - Intergenic
1051112199 9:13651629-13651651 CCAGTTGGTCAGTCCAGCCAGGG + Intergenic
1057045123 9:91879628-91879650 GCAGGAGGTCAGCTGGGCCTTGG + Intronic
1057879398 9:98781811-98781833 CCAGTGGGTCAGAAGGGCCTCGG + Intronic
1061117801 9:128625652-128625674 CCAGGTGGACAGTTTGGCTTGGG + Intronic
1061417649 9:130455877-130455899 CCAGTAGGTGACTTGGGACTGGG - Intronic
1185842111 X:3401517-3401539 TAATTTGGTCAGCTGGGCCTTGG + Intergenic
1189112327 X:38304739-38304761 CAATTTGGTCAGCTGGGTCTTGG - Exonic
1189162156 X:38820380-38820402 CTAGTTGTTCTGCTGGGCCTGGG + Intergenic
1191615750 X:63167804-63167826 CCAGTTGGTCAGTTGGGCCCTGG - Intergenic
1191620548 X:63211119-63211141 CCAGTTGGTCAGTTGGGCCCTGG + Intergenic
1193888236 X:87009526-87009548 CCAGTCATTCATTTGGGCCTGGG - Intergenic
1194819838 X:98491779-98491801 TCAGTTGGTCAGTTCGTCATTGG + Intergenic
1195647585 X:107249921-107249943 CCACTTTGCCAGTGGGGCCTAGG + Intergenic
1196847736 X:119909928-119909950 CCAGTGGATCACTTGAGCCTAGG + Intronic
1200118939 X:153781421-153781443 CCAGATGGTCAATGGGGCCGAGG + Intronic
1200235612 X:154466501-154466523 CCAGTTTGTAAGGTGGGCCGGGG + Exonic