ID: 1001141680

View in Genome Browser
Species Human (GRCh38)
Location 5:169149585-169149607
Sequence TCACCACTGTTCACAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001141680_1001141683 23 Left 1001141680 5:169149585-169149607 CCTACTTTTGTGAACAGTGGTGA 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1001141683 5:169149631-169149653 TTCCACAGCTTGAAAGATCAAGG 0: 1
1: 0
2: 2
3: 8
4: 182
1001141680_1001141684 24 Left 1001141680 5:169149585-169149607 CCTACTTTTGTGAACAGTGGTGA 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1001141684 5:169149632-169149654 TCCACAGCTTGAAAGATCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 419
1001141680_1001141682 -9 Left 1001141680 5:169149585-169149607 CCTACTTTTGTGAACAGTGGTGA 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1001141682 5:169149599-169149621 CAGTGGTGAAAGTGAAGAGGAGG 0: 1
1: 0
2: 4
3: 38
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001141680 Original CRISPR TCACCACTGTTCACAAAAGT AGG (reversed) Intronic
903380383 1:22892689-22892711 TCAACACTGCCCACAAAGGTAGG - Intronic
904389089 1:30169216-30169238 TCACTCCTGTTCACACCAGTGGG + Intergenic
904984685 1:34535295-34535317 TCACCACTGCTGAAAAAAGTTGG - Intergenic
908226747 1:62063528-62063550 ATATCACTTTTCACAAAAGTAGG - Intronic
908605981 1:65797466-65797488 AAACCACTGCCCACAAAAGTAGG - Intronic
912961425 1:114198842-114198864 TCACCAAGGTTTACAAAACTAGG + Intergenic
914365601 1:146975424-146975446 TCCCCTCTGTAAACAAAAGTAGG - Intronic
918285048 1:183044679-183044701 TTACTACTGTCCACAAAAGGGGG - Intronic
921721021 1:218471287-218471309 TTACCACTATTTACAAAACTTGG + Intergenic
923818392 1:237405871-237405893 TGACCACCATTCAGAAAAGTAGG + Intronic
924165578 1:241278667-241278689 TCACCACTGCTCCCAACAATGGG + Intronic
1064307780 10:14183890-14183912 TCAATACTGTTCACAAAGTTTGG - Intronic
1064601921 10:17002507-17002529 TCGCCACTGTTTGAAAAAGTTGG - Intronic
1065279493 10:24120282-24120304 TCACAAATGCTCTCAAAAGTGGG - Intronic
1065508463 10:26453928-26453950 GCAGCACTGTTCACAAGATTTGG + Intronic
1068054320 10:51992237-51992259 ACACTTCTGTTCACAAAATTGGG - Intronic
1070025998 10:72632693-72632715 TCACCACAGTTGTCAAATGTAGG - Intergenic
1074443175 10:113496643-113496665 TCATCACTGTTCAGACAAGGGGG - Intergenic
1076510141 10:131007566-131007588 TCACCACTGTGCACATAAAATGG - Intergenic
1078489097 11:11752815-11752837 CCACCACTGTTTACAAATGCTGG - Intergenic
1078531740 11:12141769-12141791 TCACCCCTGATCACAAGGGTTGG - Intronic
1078929369 11:15901436-15901458 TCCCCACAGTTCCCAGAAGTGGG - Intergenic
1079969059 11:27014116-27014138 TCACCACCATTCAGAAAATTGGG + Intergenic
1080736339 11:35018377-35018399 TGAACACTGTTAAGAAAAGTGGG - Intronic
1087495301 11:98883588-98883610 TCAACAATGTTGACAAAAATAGG + Intergenic
1088427236 11:109717225-109717247 ACACAACTGATTACAAAAGTAGG - Intergenic
1089944452 11:122453847-122453869 TCAACACTGTCTACAAAACTTGG + Intergenic
1098031438 12:66258792-66258814 CCACCCCTCCTCACAAAAGTAGG - Intergenic
1098808076 12:75047220-75047242 ATACCACTTTTGACAAAAGTGGG + Intronic
1099662510 12:85582422-85582444 CCACAACTATTCACAAAGGTTGG - Intergenic
1104075927 12:125389774-125389796 GCACCACTGCTCTCATAAGTAGG + Intronic
1104632653 12:130417300-130417322 GCAGCACTGTTCACAATAGCAGG + Intronic
1106482746 13:30149071-30149093 TCACCACTGGTGACAAATGCTGG - Intergenic
1106606167 13:31231281-31231303 TCATCACTGATCACAAAATTTGG - Intronic
1111583423 13:90253570-90253592 TCACCACTGCTAACTAAAGTAGG - Intergenic
1111812235 13:93105384-93105406 TAACCACTGTTAATAAAAATGGG + Intergenic
1111940113 13:94599408-94599430 CCTCCACTGGTAACAAAAGTAGG - Intergenic
1112109030 13:96274154-96274176 ATACCACTGTGCAAAAAAGTTGG - Intronic
1113290799 13:108903620-108903642 TCATCACTGCTCAAAAAAATAGG + Intronic
1116400264 14:44497635-44497657 GAACCACTGTCCACAAAAGATGG + Intergenic
1120729312 14:87984181-87984203 TCAACACAGTTTTCAAAAGTGGG + Intronic
1121382192 14:93482502-93482524 TTACCTCTGCTCACACAAGTAGG + Intronic
1126959889 15:53979876-53979898 TCAATACTTTTCATAAAAGTGGG + Intergenic
1130303212 15:82695942-82695964 TCACCTCTGGCCACAAAAATGGG - Intronic
1131748335 15:95475136-95475158 TCAGCACTGTGCATAAAATTGGG + Intergenic
1132125464 15:99220242-99220264 TCACCACAGTCCTCAAAGGTGGG - Intronic
1132310986 15:100857994-100858016 TCTCAACTGTTCGCAAAAGGGGG + Intergenic
1134234296 16:12453314-12453336 CCACCACTGTACACTAGAGTAGG + Intronic
1134369867 16:13613221-13613243 TAACTACTGTTTACAAATGTTGG + Intergenic
1137235607 16:46614857-46614879 TCACAAATGTTAACAAAAGTAGG - Intronic
1137909907 16:52367031-52367053 TCACCACTTTTAACCACAGTGGG + Intergenic
1138951192 16:61915584-61915606 ACTCCACTGTTCACAAAACTAGG + Intronic
1150334286 17:64319281-64319303 TCACCACTGGTAACAGAAGTTGG - Intergenic
1150850858 17:68702492-68702514 ACACCTCTGTTGACAAAAGCTGG - Intergenic
1158986687 18:62824891-62824913 TGACCACTGTTAAAAAAAATGGG - Intronic
1159455261 18:68653173-68653195 TCACCACTGTCCTGAAATGTGGG - Intergenic
1160250187 18:77196569-77196591 ACACCTCTGTGCACAAAAGTTGG - Intergenic
1160405027 18:78639539-78639561 CCAGCACTGTTCTCAAAAGAGGG + Intergenic
1162479526 19:10920509-10920531 TCACCACTGTTCGCCAAGGCAGG + Exonic
1164181260 19:22820831-22820853 TTACCTGTGTTCTCAAAAGTGGG - Intergenic
1164551225 19:29213855-29213877 CCACCACTGTTTCCCAAAGTAGG + Intergenic
1165179186 19:33953184-33953206 TCACCACAGCCCACAACAGTGGG + Intergenic
925641693 2:5991610-5991632 TCACCACAGGAGACAAAAGTTGG + Intergenic
926263192 2:11287026-11287048 TTACCACTTTTCAGAGAAGTAGG - Intronic
927019975 2:19006433-19006455 TCAACAGTGTTGACAAAATTCGG - Intergenic
929404170 2:41622465-41622487 TTACCACTGTTGACTCAAGTAGG + Intergenic
940852943 2:158705350-158705372 TCACAACTGCCCAAAAAAGTGGG + Intergenic
942243183 2:173982905-173982927 TCCTCACTATTCCCAAAAGTTGG + Intergenic
942690215 2:178577064-178577086 AAACCACTGTCCACAAAAGTCGG + Exonic
943511553 2:188833290-188833312 TTCACAATGTTCACAAAAGTGGG - Intergenic
943788547 2:191906128-191906150 TCATCAGTGTTCAAAAAAATTGG - Intergenic
945001973 2:205361405-205361427 TCAGCACTGTCCAGAAGAGTAGG - Intronic
945180188 2:207083776-207083798 TCACAACGGTTCTTAAAAGTGGG + Intronic
946020588 2:216637266-216637288 TCACCACTGTTCATGAAAGAAGG + Intronic
1172099836 20:32478563-32478585 GAACCACTTTTCACAAAACTGGG - Intronic
1180137817 21:45872422-45872444 TTCCCACTTTTCACAGAAGTGGG - Intronic
1180944645 22:19685136-19685158 TCACCACTGTTCCAGAAAATAGG + Intergenic
1182018573 22:27061757-27061779 CCACCCCTTTTCACAAAAGCTGG - Intergenic
1182925003 22:34113983-34114005 TCCCCAGTGCTTACAAAAGTTGG + Intergenic
949230271 3:1742909-1742931 TCCCCATTGTTTACAAAAATGGG + Intergenic
954764665 3:52903504-52903526 TCATCAATGTCCACAAAAATAGG + Intergenic
954927582 3:54250183-54250205 TCACCACTGACCACAAAATCAGG - Intronic
960107013 3:113808753-113808775 TCAACAATGTGCACAATAGTGGG - Intronic
960168833 3:114434976-114434998 TCACCAATGCTCACACAACTTGG + Intronic
967050704 3:185781742-185781764 TTAACATTGTTCCCAAAAGTTGG + Intronic
968620750 4:1602442-1602464 TCATCACTCTTCACATAAGCAGG - Intergenic
969904970 4:10385506-10385528 TTACCAGTGGTCACACAAGTTGG + Intergenic
970706115 4:18804730-18804752 TCATCACTCTTCACAAAAGTAGG + Intergenic
972887332 4:43508997-43509019 GCTCCACTGTTCACTAAACTTGG - Intergenic
973792866 4:54394637-54394659 TCACCACTGTTCAGAGAGGGAGG - Intergenic
981239259 4:142455585-142455607 ATAGCACTGTTCACAATAGTTGG - Intronic
985930184 5:3051180-3051202 ACACCACTGTTGACACACGTTGG + Intergenic
997181771 5:131836326-131836348 GCAGCACTGTTCACAATAGCAGG - Intronic
997922231 5:137992629-137992651 CCACTAAAGTTCACAAAAGTAGG + Intronic
1000675500 5:164117642-164117664 TCACCACAGTTCACGTCAGTAGG + Intergenic
1001141680 5:169149585-169149607 TCACCACTGTTCACAAAAGTAGG - Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1004762023 6:18677736-18677758 TCTCCACTGGTCTTAAAAGTAGG + Intergenic
1005700871 6:28399368-28399390 CCACCACTGTCCAGAAATGTCGG + Intronic
1005963833 6:30712452-30712474 TCATCACTGTCCCCAAAAGGAGG + Exonic
1007402784 6:41613768-41613790 TCACCACTTCTCACAATAGGGGG + Intergenic
1009349598 6:62658321-62658343 TCACCACTTATCACAAAATTAGG + Intergenic
1011049634 6:83130581-83130603 TCTCCCCTGCTCACAAAATTGGG - Intronic
1011256265 6:85424505-85424527 TCATCAAAGTTCACAAAAATAGG + Intergenic
1014636703 6:123856395-123856417 TAACTACTGTTCACTAAAATAGG - Intronic
1020450370 7:8314984-8315006 TCACCACTGTAGACACAACTAGG - Intergenic
1027630698 7:80601305-80601327 TAACCACTATCCACAAAAGAAGG - Intronic
1040450681 8:47543099-47543121 CCAGCACTATTCATAAAAGTTGG - Intronic
1041693182 8:60710111-60710133 TCTCTTCTGTTCACAACAGTGGG + Intronic
1044572829 8:93738830-93738852 GTACCACTGTTCCCCAAAGTGGG + Intronic
1045569654 8:103355826-103355848 TCAACAGTGTCCACAAAAATAGG + Intergenic
1048539375 8:135328533-135328555 TCACTTCAGTTCACAACAGTTGG - Intergenic
1051770287 9:20570674-20570696 TTAACAGTGTTCATAAAAGTTGG - Intronic
1052931618 9:34060385-34060407 ATACCACAGTTCCCAAAAGTGGG + Intergenic
1053233931 9:36435087-36435109 CCACCACTGTGGAAAAAAGTGGG + Intronic
1055576969 9:77670316-77670338 TCACCTCTGTTCAGGAATGTGGG - Intergenic
1057328117 9:94085268-94085290 ACACCAAAGTACACAAAAGTAGG + Exonic
1059677790 9:116556269-116556291 TCCTCACTGGTGACAAAAGTTGG + Intronic
1060142512 9:121222650-121222672 TCACCACTGCTAACATACGTTGG - Intronic
1188913915 X:35886985-35887007 TAATCACAGCTCACAAAAGTAGG - Intergenic
1190788342 X:53675788-53675810 TCACCACTGTTAACACATTTGGG - Intronic
1193797668 X:85896437-85896459 TCAGAACTGTTCCCAGAAGTAGG + Intronic
1196258267 X:113548302-113548324 TAACTACAGCTCACAAAAGTAGG - Intergenic
1197274667 X:124464382-124464404 TGCTCACTATTCACAAAAGTGGG + Intronic
1201987283 Y:19983672-19983694 ACAGCACGGTTCACAAAAGATGG - Intergenic