ID: 1001144902

View in Genome Browser
Species Human (GRCh38)
Location 5:169175356-169175378
Sequence GTGTACTAGGAGTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001144902_1001144910 -3 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC No data
Right 1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG 0: 1
1: 0
2: 0
3: 22
4: 265
1001144902_1001144912 6 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC No data
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1001144902_1001144908 -9 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC No data
Right 1001144908 5:169175370-169175392 CTAGTACACAGAAAGGTTAATGG No data
1001144902_1001144909 -8 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC No data
Right 1001144909 5:169175371-169175393 TAGTACACAGAAAGGTTAATGGG 0: 1
1: 0
2: 0
3: 20
4: 196
1001144902_1001144911 5 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC No data
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001144902 Original CRISPR GTGTACTAGGAGTGGGAAGA GGG (reversed) Intronic
No off target data available for this crispr