ID: 1001144902

View in Genome Browser
Species Human (GRCh38)
Location 5:169175356-169175378
Sequence GTGTACTAGGAGTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001144902_1001144909 -8 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144909 5:169175371-169175393 TAGTACACAGAAAGGTTAATGGG 0: 1
1: 0
2: 0
3: 20
4: 196
1001144902_1001144908 -9 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144908 5:169175370-169175392 CTAGTACACAGAAAGGTTAATGG No data
1001144902_1001144910 -3 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG 0: 1
1: 0
2: 0
3: 22
4: 265
1001144902_1001144911 5 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1001144902_1001144912 6 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001144902 Original CRISPR GTGTACTAGGAGTGGGAAGA GGG (reversed) Intronic
900583444 1:3420806-3420828 TTGAACTGGGAGTGGGGAGAGGG + Intronic
900836075 1:5005158-5005180 GTGAGTGAGGAGTGGGAAGAAGG - Intergenic
902535808 1:17118858-17118880 CTGAACTGGGAGTGGGAAGCAGG + Intronic
902947040 1:19848778-19848800 GTGCATTAAGAGTGGCAAGAAGG + Intergenic
905262515 1:36729763-36729785 GTGTCCAAGCAGTGGGATGAGGG + Intergenic
906502259 1:46349883-46349905 TTGAACTAGGAGGAGGAAGAAGG + Intronic
906652851 1:47525344-47525366 GGTTACAAGGAGTGGGGAGAAGG + Intergenic
907623033 1:56001376-56001398 GTGAAATAGGAGTGGTAGGAAGG + Intergenic
910007902 1:82422289-82422311 GTGAAGTAGGAGGAGGAAGAAGG + Intergenic
910523032 1:88145127-88145149 GTGCAGGAGGAGTAGGAAGAGGG - Intergenic
911162344 1:94693876-94693898 GAGTACTAAGAGTGAAAAGAGGG + Intergenic
911327243 1:96482702-96482724 TTGAACTGGGAGTGGGGAGAAGG + Intergenic
912839524 1:113026593-113026615 GTGTTCTATGTGTTGGAAGAGGG - Intergenic
913502813 1:119487653-119487675 ATGCACCAGGAGTGGCAAGAGGG + Intergenic
913556292 1:119970508-119970530 ATGTACTAGGAGATGGAAAAAGG + Intronic
914955935 1:152162494-152162516 GACTACTAGAAGGGGGAAGAAGG - Intergenic
915734786 1:158077894-158077916 GTGTCCCAGGAGAGGGCAGAGGG + Intronic
916770336 1:167901685-167901707 GAGACCCAGGAGTGGGAAGAAGG - Exonic
917345447 1:174023707-174023729 GTTCCCTAGGAGTGAGAAGAAGG - Intergenic
919453911 1:197801135-197801157 GGGCACTGGGAGTGGGGAGAAGG - Intergenic
920873771 1:209815950-209815972 CTGTCCTGGGGGTGGGAAGAAGG + Intergenic
921969384 1:221129799-221129821 GTTGAATAGGAGTGGAAAGAGGG + Intergenic
922477158 1:225914492-225914514 ATGCACTAGGATTGGGAAGATGG + Intronic
923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG + Intergenic
1064750370 10:18522332-18522354 GTTTGGTAGGAGTGGGGAGATGG - Intronic
1065111331 10:22442971-22442993 GTGTCCTAGGAGTGTGTTGATGG + Intronic
1065506911 10:26438532-26438554 GTGTAGTAGGGGTGGGATGGGGG + Intronic
1065682991 10:28256087-28256109 GTATACTAGGAGTGTGAAAAGGG + Intronic
1067982618 10:51104090-51104112 GTGTAGTAGGAGTGGCAGGAAGG + Intronic
1068768953 10:60798815-60798837 GTGAACAAGGAGTGGAAAGCCGG - Intergenic
1070058038 10:72954108-72954130 GGGTACCTGGGGTGGGAAGAAGG - Intronic
1071310241 10:84336596-84336618 CTGTTCTAGGAGTGGCAAGTAGG + Intronic
1071393832 10:85201887-85201909 GGGGACTAGGAGTGGGAACTGGG + Intergenic
1071555832 10:86600680-86600702 GTGTATTAGCCCTGGGAAGAGGG + Intergenic
1071858243 10:89646878-89646900 GAGTACAAGGAGTAGGAAGAGGG - Intergenic
1072431735 10:95378468-95378490 CTGGACTAGGAATTGGAAGATGG - Intronic
1077402697 11:2367033-2367055 GTATCCTGGGAGTGGGAAGTTGG - Intergenic
1077432403 11:2522317-2522339 TTGGACTCGGAGTGGGAAGCAGG - Intronic
1081794594 11:45810793-45810815 GTGGACCAGGAGGGGGCAGAAGG + Exonic
1082913214 11:58400827-58400849 GTGTACATGGGGTGGGGAGAGGG + Intergenic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088908437 11:114172132-114172154 ATGGACTCGGAGTGGGTAGATGG - Intronic
1089261109 11:117224601-117224623 GTGGAGGTGGAGTGGGAAGATGG + Intronic
1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1092695086 12:11162556-11162578 GTGTTCTATATGTGGGAAGAAGG + Intronic
1092928039 12:13289942-13289964 ACCTACTAGGAATGGGAAGAAGG + Intergenic
1094768801 12:33629025-33629047 GTGAACTAGGAGAGAGACGACGG + Intergenic
1096261651 12:50096266-50096288 ATTTACTATGACTGGGAAGAGGG + Intronic
1097120077 12:56724869-56724891 GGGTACCAGGAGGGGAAAGACGG + Intronic
1097943045 12:65333514-65333536 GTCCAATAGGAGTGGGAAGGTGG + Intronic
1099606447 12:84807897-84807919 GTGTAGTAGGAGTTGGCATATGG + Intergenic
1099610309 12:84859239-84859261 GATTACCAGGAGCGGGAAGAAGG + Intergenic
1099956903 12:89359995-89360017 GAATACAAGGAGGGGGAAGAGGG + Intergenic
1100095625 12:91031526-91031548 GTGGACTAGAATTGGGAAGTAGG + Intergenic
1101201957 12:102445769-102445791 GTTGAATAGGAGTGGGGAGAGGG + Intronic
1101575315 12:105991842-105991864 CTGAACAGGGAGTGGGAAGATGG - Intergenic
1101752656 12:107595399-107595421 GTGTATTCAGAGTGGGAAGCAGG + Intronic
1101817178 12:108154104-108154126 GTGTCCTCAGAGTGGGTAGATGG + Intronic
1102288266 12:111677375-111677397 TTCTAGTAGGAGTGGGATGAAGG - Intronic
1102594694 12:113983515-113983537 GTGTACTAGGATTTGCAAGAAGG - Intergenic
1105818632 13:24059882-24059904 GTTGAATAGGAGTGGTAAGAGGG + Intronic
1106430556 13:29676556-29676578 GTGAACTCGGAGTGGGAAAAGGG + Intergenic
1106576087 13:30976927-30976949 GTGTTCTAGGAACTGGAAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1110171622 13:72507566-72507588 GAGAAGTAGGAGTGGGAAGCTGG - Intergenic
1114368401 14:22056200-22056222 GTTGACTAGGAGTGGTAAGAGGG - Intergenic
1115747937 14:36458045-36458067 GTTTACAAGCAGTGGGGAGAAGG + Intergenic
1117332224 14:54724386-54724408 GTGAAATGGGGGTGGGAAGAGGG + Intronic
1117481092 14:56145520-56145542 TTGTAGAAGGAGTGGAAAGAAGG - Intronic
1117568311 14:57019398-57019420 CTGTACTAGGATTAGAAAGAAGG - Intergenic
1118409591 14:65464394-65464416 GTTGAATAGGAGTGGTAAGAAGG + Intronic
1118625029 14:67650860-67650882 GTGAACTGGGAGTAGGAAGTTGG - Exonic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1120117172 14:80633616-80633638 TTGTCCTAGGTGTGGGAATAGGG - Intronic
1120765723 14:88325072-88325094 CTCTACTAGGACTGGGAGGATGG + Intronic
1121133208 14:91468990-91469012 GTGTACTAGGAAAATGAAGATGG - Intronic
1128638343 15:69317478-69317500 GTGAACTGGCAGAGGGAAGAAGG - Intronic
1130604306 15:85301313-85301335 GTGTACTTGAGGTGGGGAGATGG - Intergenic
1132681661 16:1144904-1144926 GTGTCCTAGCTGTGGGAAGCGGG + Intergenic
1132978432 16:2721609-2721631 GAGGGCGAGGAGTGGGAAGAGGG + Intergenic
1132992530 16:2804290-2804312 GTGTTATAGGGGTGGGGAGAAGG - Intergenic
1135030696 16:19036029-19036051 GTGAACTGGGACTGGGAAGTGGG + Intronic
1138127506 16:54451246-54451268 ATGAACTAAGAGTGAGAAGAGGG + Intergenic
1138641855 16:58393905-58393927 GTGGACTTGGAGGGGGAAGTGGG - Intronic
1141003647 16:80331724-80331746 GAGGACTAGGTTTGGGAAGATGG + Intergenic
1143410781 17:6707196-6707218 GTGTTCTGGGGGTGGGGAGAGGG - Intronic
1143519261 17:7436329-7436351 GGGCACTAGGAGTGTGAAGCCGG - Exonic
1144329323 17:14210186-14210208 GGGTAGTAGGTGTGGCAAGAAGG - Intergenic
1145722626 17:27088183-27088205 GAGCAGTAGGAGTGGGGAGAAGG - Intergenic
1145954077 17:28842638-28842660 GTGGACAACGCGTGGGAAGAGGG - Intronic
1146126297 17:30234174-30234196 ATATACTAGGAGTGGGATGGGGG - Intronic
1146766566 17:35527807-35527829 GTTGACTAGGAGTGGTGAGAGGG - Intronic
1147625098 17:41895087-41895109 GTTTCCTAGGACTGGGAAGTGGG - Intronic
1148455814 17:47810898-47810920 GGGAACTAGGGGTGGGAATAAGG - Intronic
1152336691 17:79703025-79703047 GTGGAGGAGGAGTGGGAGGAAGG - Intergenic
1153195899 18:2596132-2596154 GTGTACATGGTGTGGGGAGATGG + Intronic
1156381978 18:36571018-36571040 GTGCAATAGGGATGGGAAGAGGG + Intronic
1156694142 18:39746782-39746804 CTTGACTAGGAGTGGGAATATGG - Intergenic
1158635269 18:59150600-59150622 GTAGATTAGGAGTGGGGAGAAGG + Intronic
1160280301 18:77484030-77484052 GGGTGCTTGAAGTGGGAAGAAGG + Intergenic
1162695959 19:12475662-12475684 GTTGAGTAGGAGTGGTAAGAGGG - Intronic
1165277427 19:34767161-34767183 GTGTGACAGAAGTGGGAAGACGG + Intronic
1166310940 19:41962284-41962306 GGGTCCTAGGAGTGGGAGGGTGG + Intergenic
926396692 2:12450133-12450155 GTATAGTTGGAGTGGGAAGGAGG - Intergenic
929101653 2:38320755-38320777 GTGAATTAGGAGTGGAGAGATGG + Intronic
929187590 2:39111578-39111600 GTATTCTAGGAGTGGCAGGAAGG - Intronic
929828051 2:45325371-45325393 GTGTGGTAGGAGTGGGAAAATGG + Intergenic
930924279 2:56797593-56797615 GTGTTCTAGGAGGTGGCAGAGGG - Intergenic
934033510 2:88068275-88068297 GTGTGCTGGGAGTGGAAAGGTGG + Intronic
935670206 2:105548958-105548980 GGGTACTAGGATGGGGAAGGAGG - Intergenic
935740191 2:106140548-106140570 GGGCACCAGGAGAGGGAAGATGG - Intronic
936442627 2:112568053-112568075 GTCTACAAGGAGTGGTAAAAAGG - Exonic
937276142 2:120685395-120685417 GTGGGCTGGGAGTGTGAAGAGGG + Intergenic
938662665 2:133503703-133503725 GTATAATAGGAGCAGGAAGATGG - Intronic
940456597 2:153909472-153909494 GTTTAATAGGAGTGGTGAGAGGG + Intronic
943549005 2:189315535-189315557 GTGGAATAGGAGTGGTGAGAGGG - Intergenic
944636316 2:201679085-201679107 GTGTATTGGGGCTGGGAAGATGG - Intronic
945787093 2:214254322-214254344 GTTGAATAGGAGTGGTAAGAGGG + Intronic
945817999 2:214629300-214629322 GAGTACTAGGAGTAGAGAGAAGG + Intergenic
948056286 2:235011190-235011212 GGGTTCTAGGAGAGGGAGGAAGG - Intronic
1172190304 20:33058221-33058243 GGGTACTGGGAGCGGAAAGAAGG + Intronic
1172576332 20:36011600-36011622 GTTGAATAGGAGTGGTAAGAGGG - Intronic
1172873561 20:38150654-38150676 GTATCCTGGGAGGGGGAAGAGGG - Intronic
1173055570 20:39609031-39609053 GTTGAATAGGAGTGGCAAGAGGG - Intergenic
1173887419 20:46472605-46472627 GTGTTCAAGGATTGGTAAGAAGG + Intergenic
1173932955 20:46837066-46837088 GGGTCCTGGGAGTGGTAAGAAGG + Intergenic
1174325623 20:49776449-49776471 TGGTCCTAGGAGTGGGATGAGGG - Intergenic
1175644894 20:60662837-60662859 GTGTTCTGGGGGTGGGGAGAAGG - Intergenic
1178714347 21:34949723-34949745 GTGGAGTGGGAGTGGGAAGGGGG + Intronic
1179645005 21:42770363-42770385 GGGTCCTGGGAGTGGGAAGTGGG - Intronic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1182893981 22:33843795-33843817 GTAAACTAGAAGTGGGAGGAAGG - Intronic
1185273895 22:49941677-49941699 GTGGACTGGGAGTTGGAGGAAGG + Intergenic
949737985 3:7196502-7196524 GTTTGCTAGGACTGGAAAGACGG - Intronic
950898979 3:16479493-16479515 GTGTGCAAGGAATGGGGAGAAGG - Intronic
951141030 3:19160485-19160507 ATGTACTGGAAGTGGGAGGAGGG - Intronic
952308694 3:32168937-32168959 GTATACATGGAGTGGGGAGAAGG - Intergenic
952719881 3:36521538-36521560 GTGGACAAGGAAGGGGAAGAGGG + Intronic
954089709 3:48274457-48274479 GTGTATTAGGAGGGGGACTAGGG - Intronic
954180986 3:48881253-48881275 GTGAACTGGGACTGTGAAGATGG - Intronic
954414346 3:50385681-50385703 GTGTGCCAGGGGTGGGCAGATGG - Intronic
954714979 3:52522481-52522503 GGGTACTGGGAGTGGGCAGGGGG - Intronic
956955595 3:74335510-74335532 GTGGAGTAGCAGTGGGAAAATGG - Intronic
957420521 3:79962958-79962980 GTTTAATAGAAGTGGTAAGATGG - Intergenic
961217439 3:125170975-125170997 GGGGAGTAGGAGTGGGAAAATGG + Intronic
961944437 3:130671319-130671341 GAGAAATATGAGTGGGAAGAGGG + Intronic
962267954 3:133956613-133956635 ATGAACATGGAGTGGGAAGAGGG - Intronic
966776315 3:183545677-183545699 TTGCACTGGGAGTGGGGAGAGGG - Intronic
967044376 3:185723365-185723387 GGGTATTAGGGCTGGGAAGATGG + Intronic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
970874940 4:20858285-20858307 GTGAAGATGGAGTGGGAAGATGG + Intronic
971219699 4:24693504-24693526 GTGTTCTATGAATGGGAAGAAGG - Intergenic
971779910 4:31019871-31019893 GTATGCTAGGAGTGGGGAGCTGG + Intronic
975566875 4:75766406-75766428 ATGTACTAGGAGTGGGGTAAAGG - Intronic
979155586 4:117385060-117385082 ATGTACAAGGAGTGGAGAGAAGG + Intergenic
980620455 4:135294707-135294729 TTGTACTGAGAGAGGGAAGATGG - Intergenic
986003443 5:3648417-3648439 CTGACCAAGGAGTGGGAAGAAGG + Intergenic
990635495 5:57721430-57721452 GTGTAGTAGGAGTTCAAAGAAGG - Intergenic
992369317 5:76126667-76126689 GTGTGCTGGGATTGGGCAGAGGG - Intronic
992681105 5:79153997-79154019 ATTTCTTAGGAGTGGGAAGATGG - Intronic
994750577 5:103732785-103732807 GTGGTCCAGGAGTGAGAAGATGG - Intergenic
996079488 5:119240764-119240786 GTTGAATAGGAGTGGTAAGAGGG - Intronic
996891826 5:128429325-128429347 GGGCAGTAGGAGTGGGAGGAGGG - Intronic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
999247978 5:150165549-150165571 GTGAACTGGGAGTGGGGACAAGG - Intergenic
1001144902 5:169175356-169175378 GTGTACTAGGAGTGGGAAGAGGG - Intronic
1001556416 5:172640721-172640743 GTGTCCAAAGATTGGGAAGAGGG - Intergenic
1002159395 5:177306284-177306306 CTGTACTGGGGGTGGGAGGAGGG + Intronic
1002436491 5:179234875-179234897 GTCTGCTAGGCTTGGGAAGAGGG - Intronic
1003428931 6:6021327-6021349 ATGTATTTGGAGTGTGAAGAGGG + Intergenic
1005665462 6:28049086-28049108 GAGTACTTGCAGTGGGAATATGG - Intergenic
1007414595 6:41684303-41684325 GTGTTCTAGAGGTGAGAAGAGGG - Exonic
1009297446 6:61970857-61970879 GGGGAGTAGCAGTGGGAAGAGGG - Intronic
1010945399 6:81968717-81968739 AAGTACTGGGAATGGGAAGATGG - Intergenic
1013159503 6:107528085-107528107 TTTTACAAGGAATGGGAAGAAGG - Intronic
1013275631 6:108582260-108582282 ATGTGCTAGGTGTGGGAAGCAGG + Intronic
1015107770 6:129556795-129556817 GTGTTCTAGTGATGGGAAGAAGG - Intergenic
1019803329 7:3104704-3104726 GGGTTGGAGGAGTGGGAAGAAGG + Intergenic
1020250346 7:6463236-6463258 GACTTCTAGGAATGGGAAGAAGG - Intronic
1022607209 7:31827266-31827288 GTGAGCTAGGGGTGGGTAGAAGG - Intronic
1023090538 7:36614084-36614106 GTTTTCTGGGAGAGGGAAGAGGG + Intronic
1023127049 7:36965012-36965034 GTATTCAAGGAATGGGAAGATGG - Intronic
1024409244 7:49020285-49020307 GTGGATTAGGAGTGGGGAGCAGG + Intergenic
1028269212 7:88767321-88767343 GAGTAATAGCTGTGGGAAGAAGG - Intronic
1031490612 7:122383320-122383342 GTGGACTAGTAGAGGGGAGAGGG + Intronic
1031963870 7:128013260-128013282 GTGGTCTAAGAGTGGGAAGGTGG - Intronic
1032547328 7:132754819-132754841 GTGGAATAGGGGTGGAAAGATGG - Intergenic
1035050158 7:155994149-155994171 GTGGGGCAGGAGTGGGAAGAGGG - Intergenic
1035054606 7:156026087-156026109 GTGGACTAGCAGTGGGATGTTGG - Intergenic
1037489515 8:19384873-19384895 AGGGACTGGGAGTGGGAAGATGG + Intronic
1037694694 8:21213411-21213433 GTGGAGTAAGAATGGGAAGAGGG - Intergenic
1037701152 8:21274848-21274870 GTGGACATGGATTGGGAAGAAGG - Intergenic
1039626508 8:39059903-39059925 GTGTAGCAGGAGTGGGGAGCAGG + Intronic
1041334288 8:56762767-56762789 GACTACTAGAAGTGGGAGGAAGG - Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1043408924 8:79971523-79971545 GTGACCTAGGGATGGGAAGATGG - Intronic
1043869136 8:85411280-85411302 GTGCAGTGGGAGTGGGGAGAAGG + Intronic
1044305715 8:90638353-90638375 GAGTAAATGGAGTGGGAAGAAGG - Intronic
1045025612 8:98083868-98083890 GTGTTCGAGGGATGGGAAGAGGG - Intronic
1045170912 8:99666763-99666785 GTTGAATAGGAGTGGTAAGAGGG - Intronic
1046722594 8:117637522-117637544 GTTGACTAGGAGTGGTGAGAGGG - Intergenic
1047691657 8:127361232-127361254 GTTGCCAAGGAGTGGGAAGATGG - Intergenic
1048010961 8:130455769-130455791 ATCTACTTGGAGTGGGAAAAGGG - Intergenic
1048318842 8:133382782-133382804 GTGTTCTCAGGGTGGGAAGAAGG + Intergenic
1048512873 8:135078427-135078449 GTGTACAAGAAAGGGGAAGAAGG - Intergenic
1049505766 8:142996651-142996673 TAGTACTGGGAGGGGGAAGAGGG - Intergenic
1050372605 9:4937049-4937071 GTGTTACAGGAGTGGGAAGGGGG - Intergenic
1052479075 9:28998470-28998492 GTGTTCTATGAGGGGGAAAAAGG - Intergenic
1055904722 9:81279430-81279452 GTGTAGTGGGAGTGAGAACAAGG + Intergenic
1057570305 9:96199086-96199108 TTGTCCTGGGAGTGAGAAGATGG - Intergenic
1057588810 9:96353752-96353774 GGGTGTTAGGAGTGGGTAGAAGG - Intronic
1057690610 9:97280807-97280829 CTGGACTAAGAGTTGGAAGAGGG + Intergenic
1058164912 9:101608248-101608270 GAGAACTAGGAATGAGAAGAAGG - Intronic
1058830132 9:108808906-108808928 GTATTCTAAGAGTGGGAAAAAGG - Intergenic
1059676622 9:116546540-116546562 CTGTCCTAGGAGTGTGAAGATGG + Intronic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1061218393 9:129235134-129235156 GTGCAATGGGAGAGGGAAGAAGG - Intergenic
1061359380 9:130131509-130131531 GAGTCCTGGGAGTGCGAAGAGGG - Intronic
1061980817 9:134102464-134102486 GTGTACCCGGGGTGGGGAGACGG + Intergenic
1062120767 9:134832913-134832935 GGGCACCGGGAGTGGGAAGAGGG - Intronic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1187742069 X:22366598-22366620 GTGGAGTAGGGGTGGGAAAAAGG + Intergenic
1187849407 X:23576784-23576806 GGGTAGTAGGAGGGGGAATAGGG - Intergenic
1187926638 X:24256710-24256732 GGTTACTTGTAGTGGGAAGAGGG - Intergenic
1189096700 X:38148152-38148174 GTTCAATAGGGGTGGGAAGAGGG - Intronic
1189377371 X:40476084-40476106 GTGGAGAAGGGGTGGGAAGAGGG - Intergenic
1189702943 X:43730693-43730715 ATGTTCTAAGAATGGGAAGAAGG - Intronic
1189887307 X:45561379-45561401 ATGTACTGGGAGTAAGAAGAGGG + Intergenic
1192277132 X:69644650-69644672 GTTGAATAGGAGTGGTAAGAGGG + Intronic
1192432398 X:71121300-71121322 GGGTACCAGGGGAGGGAAGAGGG - Intronic
1193271333 X:79532635-79532657 GTGTACGAAGTGTAGGAAGAGGG - Intergenic
1193330194 X:80227264-80227286 GACTACTAGAAGTGGGAGGAAGG - Intergenic
1194237631 X:91403888-91403910 GTGTACTACTAGAGGGGAGAGGG + Intergenic
1198096978 X:133389649-133389671 GAGTACAGGGAGTGGGAAGAGGG + Intronic
1201080519 Y:10240207-10240229 GTTGAATAGGAGTGGAAAGAGGG + Intergenic
1201225671 Y:11816651-11816673 CTGTACTAGGAGTTGGATGTGGG - Intergenic
1201542205 Y:15117747-15117769 GTTTAATAGGAGTGGCGAGAGGG - Intergenic