ID: 1001144908

View in Genome Browser
Species Human (GRCh38)
Location 5:169175370-169175392
Sequence CTAGTACACAGAAAGGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001144903_1001144908 -10 Left 1001144903 5:169175357-169175379 CCTCTTCCCACTCCTAGTACACA 0: 1
1: 0
2: 1
3: 36
4: 335
Right 1001144908 5:169175370-169175392 CTAGTACACAGAAAGGTTAATGG No data
1001144901_1001144908 -8 Left 1001144901 5:169175355-169175377 CCCCTCTTCCCACTCCTAGTACA 0: 1
1: 0
2: 0
3: 50
4: 964
Right 1001144908 5:169175370-169175392 CTAGTACACAGAAAGGTTAATGG No data
1001144902_1001144908 -9 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144908 5:169175370-169175392 CTAGTACACAGAAAGGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001144908 Original CRISPR CTAGTACACAGAAAGGTTAA TGG Intronic
No off target data available for this crispr