ID: 1001144909

View in Genome Browser
Species Human (GRCh38)
Location 5:169175371-169175393
Sequence TAGTACACAGAAAGGTTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001144901_1001144909 -7 Left 1001144901 5:169175355-169175377 CCCCTCTTCCCACTCCTAGTACA 0: 1
1: 0
2: 0
3: 50
4: 964
Right 1001144909 5:169175371-169175393 TAGTACACAGAAAGGTTAATGGG 0: 1
1: 0
2: 0
3: 20
4: 196
1001144903_1001144909 -9 Left 1001144903 5:169175357-169175379 CCTCTTCCCACTCCTAGTACACA 0: 1
1: 0
2: 1
3: 36
4: 335
Right 1001144909 5:169175371-169175393 TAGTACACAGAAAGGTTAATGGG 0: 1
1: 0
2: 0
3: 20
4: 196
1001144902_1001144909 -8 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144909 5:169175371-169175393 TAGTACACAGAAAGGTTAATGGG 0: 1
1: 0
2: 0
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001144909 Original CRISPR TAGTACACAGAAAGGTTAAT GGG Intronic
902355941 1:15900202-15900224 TTTTACACAATAAGGTTAATAGG - Intronic
903596409 1:24498939-24498961 TAGAACACAGAAAGGGCAAAAGG - Intergenic
907142139 1:52197171-52197193 TTGTAGACAGAAAAGTAAATTGG + Intronic
908022061 1:59908189-59908211 TAGTACAGTGAAAGGAGAATGGG + Intronic
909827787 1:80147344-80147366 ATGTAAACAAAAAGGTTAATAGG + Intergenic
910010755 1:82458533-82458555 TAATACACACAAAAGTTTATTGG - Intergenic
910606245 1:89087941-89087963 TAGAACACTGAAAGCTCAATTGG - Intergenic
911287568 1:96015379-96015401 TAGAAGACAGAAAAGATAATGGG - Intergenic
911439331 1:97905931-97905953 AAGGACATAGAAAGGTTAAATGG - Intronic
911756314 1:101560889-101560911 AAGGACACAGAAAGGAAAATGGG - Intergenic
912168159 1:107064480-107064502 TAGTCAACAGGAAAGTTAATAGG + Intergenic
913269944 1:117083314-117083336 TAGTACACACAAAGGGATATAGG - Intronic
921199348 1:212790620-212790642 CAGTAAAAATAAAGGTTAATAGG + Intronic
924502218 1:244648346-244648368 TAGTATACAGAATTGTAAATTGG - Intergenic
924686371 1:246294898-246294920 TTGTAGGCAGAAAGGCTAATTGG - Intronic
1068223711 10:54078145-54078167 TAGTAAACAGTGAGGATAATAGG - Intronic
1068472797 10:57486537-57486559 TAATACACAGCAAGGCTAAAAGG + Intergenic
1069368814 10:67722253-67722275 TAGTTCAGAGAAAGGCTGATAGG + Intergenic
1069393387 10:67961515-67961537 TATTACAGGGAAAGGATAATAGG - Intronic
1070001212 10:72378859-72378881 TAGCACAAAGAAGGGTTTATTGG + Intronic
1070547538 10:77464357-77464379 TAGTACACAGAGAGGTAGATGGG + Intronic
1070951749 10:80436772-80436794 TTTTACACAGAAAGGGGAATGGG - Exonic
1071253464 10:83844112-83844134 TTGTAGTCAGAAAGGATAATTGG - Intergenic
1071910170 10:90222702-90222724 TAGTACAGAGAACAGCTAATAGG + Intergenic
1072188714 10:93064007-93064029 TAGTACAGGGAAAGGGCAATGGG + Intronic
1073458043 10:103649538-103649560 CAGTGCACAGAAAGGTCATTTGG + Intronic
1073710005 10:106025678-106025700 TGGTACACAGAAATAATAATTGG - Intergenic
1073957057 10:108884563-108884585 TAGTCCAGGAAAAGGTTAATGGG - Intergenic
1075243108 10:120795951-120795973 TAATAGACATATAGGTTAATGGG + Intergenic
1078132496 11:8624421-8624443 TTCTTCACAGAGAGGTTAATTGG + Exonic
1078265559 11:9753879-9753901 TAGTCCACATAATTGTTAATGGG - Intergenic
1078430414 11:11283809-11283831 TAGCACACAGAGAACTTAATTGG + Intronic
1078903093 11:15659932-15659954 TAGGAGTCAGAAAGGATAATAGG + Intergenic
1079829996 11:25252352-25252374 TATTACACAGAAAAATTCATGGG + Intergenic
1080040240 11:27752577-27752599 AAGCACACAGAAAGGTTCATTGG + Intergenic
1080208668 11:29759495-29759517 TAGTCAAAAGAAATGTTAATGGG + Intergenic
1080959541 11:37142283-37142305 TGGTACACAGTAAAGTTATTTGG + Intergenic
1081335455 11:41860184-41860206 TAATACACAGAAAGGTTTAGAGG + Intergenic
1082014958 11:47478375-47478397 TCGTACACAGAAAACTTAAATGG - Intronic
1082818250 11:57525230-57525252 CAGAACACAGCAAGGGTAATGGG - Intergenic
1085903792 11:80735138-80735160 TACTACACAGATAGGTTATATGG + Intergenic
1086775443 11:90825629-90825651 CAGTACAAAGAAAGCTTAAAGGG + Intergenic
1086812919 11:91333536-91333558 TAGTACATAGAAAGATGAATAGG + Intergenic
1088973589 11:114794956-114794978 TAGTTCAGAGAAAGCTCAATGGG + Intergenic
1089924344 11:122241923-122241945 AGGAACAGAGAAAGGTTAATGGG - Intergenic
1091647296 12:2283618-2283640 TATTACACTGAAATGTTTATTGG + Intronic
1096417688 12:51427642-51427664 TAGCACATAGAAGGTTTAATTGG - Intronic
1097780685 12:63700448-63700470 TAATACACAGAGAGCTTAATTGG + Intergenic
1098384169 12:69901072-69901094 CAGTACAGAGAAAGATTAAGTGG + Intronic
1098799036 12:74930278-74930300 TAGTACTCAGAATGTTTACTAGG + Intergenic
1099094145 12:78352296-78352318 TAGTCCTCTGAAAGGTTATTCGG - Intergenic
1099641612 12:85295253-85295275 TAGTAAATAGAAAAGTTAATGGG + Intronic
1100235487 12:92656551-92656573 TAATATACAGTAAGGTAAATTGG + Intergenic
1101397301 12:104359622-104359644 TAGTACACAGAAGCGGTTATAGG - Intergenic
1105532686 13:21234370-21234392 TAGTAAATAAAAAGGCTAATTGG - Intergenic
1106107844 13:26749577-26749599 TGATACACAGAGAGGTTGATTGG - Intergenic
1106983247 13:35315406-35315428 TAAAACAAAGCAAGGTTAATGGG + Intronic
1106996632 13:35491671-35491693 TAGTACACATACAGGATAATGGG - Intronic
1107367676 13:39701744-39701766 TAGTACGTAGAAAAGTTCATGGG + Intronic
1111418782 13:87982972-87982994 TAGAAAACTGGAAGGTTAATTGG - Intergenic
1112030667 13:95453782-95453804 TCATACACAGAAATGTTACTGGG - Intronic
1112256652 13:97839532-97839554 TACTACACAGATAGGTTAAAAGG - Intergenic
1115584905 14:34801266-34801288 TAGTATAAAGAAAGTGTAATTGG - Intronic
1118172470 14:63401540-63401562 AAGTTCAAAGAAAGGTTATTTGG - Intronic
1118667724 14:68088551-68088573 TAGTACACAGAAAGCTTTTCTGG - Intronic
1121397860 14:93642659-93642681 GAGTGCACAGAAAGGCAAATAGG - Intronic
1127625871 15:60779569-60779591 AAGTAAACAGATAGGTTAACAGG + Intronic
1130635476 15:85615405-85615427 TAGTACAAGGAAAGCCTAATTGG + Intronic
1131855837 15:96593160-96593182 TAATAAAAACAAAGGTTAATGGG + Intergenic
1138721884 16:59091716-59091738 TAGTAAATAGAAATGTTAATGGG - Intergenic
1139995019 16:70972860-70972882 TTGTACAAATAAAGGTTAAATGG + Intronic
1145921558 17:28613818-28613840 TAGCACAAAGCAAGGGTAATGGG - Intronic
1147380461 17:40052463-40052485 CAGTACACAGAAAATTTAGTGGG - Intronic
1148290636 17:46445046-46445068 AAGTTCACAGAAACGTGAATAGG - Intergenic
1148312827 17:46662751-46662773 AAGTTCACAGAAACGTGAATAGG - Intronic
1149987825 17:61361239-61361261 GAGTAACCAGAAAAGTTAATGGG + Intronic
1150197670 17:63317747-63317769 TAGTAGAAATAAAAGTTAATAGG - Intronic
1150991741 17:70267602-70267624 TAGTACACAGCAAAGGTGATGGG + Intergenic
1151308345 17:73278380-73278402 TAGGACACAGAAATGTTCTTTGG - Intergenic
1152198675 17:78932731-78932753 GTGTTCACAGAAAGGTTAGTGGG + Intergenic
1153213312 18:2791791-2791813 TAGTTCACAGACAGGTTACTGGG + Intronic
1155595007 18:27475385-27475407 TAGTACATAGATGGGTTGATAGG + Intergenic
1157012211 18:43663984-43664006 TATTACAAAGACAGGTTTATAGG - Intergenic
1157538160 18:48476437-48476459 TAGTACACAGCATGGTCATTTGG + Intergenic
1157624976 18:49043960-49043982 AAGTAGACAGACAGGTTACTTGG - Exonic
1158137439 18:54223722-54223744 TAGTCCACTGAAGGGTTAAAAGG - Intronic
1164288277 19:23841742-23841764 GAGTACACAGACAGGTGAACAGG - Intergenic
1164320526 19:24140214-24140236 GAGTACACAGAAAGGTGGACAGG - Intergenic
1164392027 19:27832287-27832309 GACTACACAGAATGGTAAATTGG - Intergenic
1164887032 19:31787827-31787849 TAGAACACAGAAAAATGAATGGG - Intergenic
1165953374 19:39487196-39487218 TAGCACACAGAGAGGTGATTAGG - Intronic
1166246857 19:41534858-41534880 AAGTACACAAAAACATTAATTGG + Intergenic
925870708 2:8267500-8267522 GAGTACACAGAATGGATTATAGG + Intergenic
931284065 2:60818032-60818054 TTGTGCACAGAAAGTTTATTGGG - Intergenic
935921598 2:108021713-108021735 TAGTAAGCAGTAAGGTTGATAGG - Intergenic
939390349 2:141560929-141560951 TAGTAGAAAGAAAAGTAAATAGG - Intronic
939535264 2:143420195-143420217 TAGAACACAGCAATGATAATGGG + Intronic
939616765 2:144370231-144370253 TAGTACCCTGAAAGAGTAATTGG + Intergenic
939668303 2:144977899-144977921 TAGTACACAGAATGCATCATAGG - Intergenic
947120649 2:226811172-226811194 GAGTCCCCAGAAATGTTAATAGG - Intergenic
1168999818 20:2160417-2160439 AAGAACATAGAAAGGATAATGGG + Intronic
1171074895 20:22112915-22112937 TAGTATATAGAAATGTTAGTGGG - Intergenic
1173310626 20:41893419-41893441 TAGGACAGAGAAAGGCAAATTGG - Intergenic
1175362176 20:58421167-58421189 AAGAACCTAGAAAGGTTAATAGG - Intronic
1176901164 21:14443725-14443747 AAGTAGACAGAAAAGTTAGTGGG + Intergenic
1177247578 21:18549433-18549455 GAGTTAACAGAAAGGTTAATAGG - Intergenic
1179390439 21:40984660-40984682 TAGCAGACAGAAAAATTAATGGG + Intergenic
1182183477 22:28376145-28376167 TAGTAGATAGAAAGGTAGATAGG - Intronic
1184616052 22:45639558-45639580 CAGGGCACAGAAAGGTTAAGTGG - Intergenic
952749897 3:36816648-36816670 TAGGACACAGACAGGTTCAGAGG + Intergenic
953236383 3:41111137-41111159 GGGTGCACAGAAAGGTTAAAAGG - Intergenic
955521041 3:59775991-59776013 TAGCTCACAGAAACATTAATGGG - Intronic
956055971 3:65299419-65299441 TAGTACACGGATTGGTTAATGGG - Intergenic
957225875 3:77445367-77445389 TATTAAACAGAAAGCTTATTTGG + Intronic
957235889 3:77590473-77590495 GATTAAACAGAAAGGTTGATGGG - Intronic
957665927 3:83226893-83226915 TGGTACGCAAAAAGGTTAAAAGG - Intergenic
958005362 3:87802768-87802790 TGGTACACATAAAAGTAAATAGG + Intergenic
958902698 3:99906619-99906641 TGAAACACAGAAAGGTTAAGTGG + Intronic
959576585 3:107940783-107940805 TAGTACACAGAATGGGCAAATGG - Intergenic
960430488 3:117562794-117562816 TAATAAAAAGAAAGGATAATTGG + Intergenic
962461881 3:135621677-135621699 AAGTACACAGCAAGGTTGCTAGG + Intergenic
962622621 3:137195012-137195034 GAGCACACAGAGAAGTTAATTGG - Intergenic
963219361 3:142790260-142790282 TAGTACAAGGAAAGATTAGTAGG + Intronic
966683951 3:182673391-182673413 TAGAACACAGAATCTTTAATTGG - Intergenic
967487362 3:190048696-190048718 TAGTCCACCGAAAAGTTAAAAGG - Intronic
970803112 4:20000060-20000082 AAGTCCACAGAAAGGTTGACAGG - Intergenic
972010852 4:34179695-34179717 TATTACACACAAAATTTAATTGG + Intergenic
972582240 4:40405082-40405104 TAATACACAGAAAGATAATTGGG - Intergenic
974242432 4:59267433-59267455 TAGAACAAAGAAATGTTATTAGG + Intergenic
976252396 4:83065853-83065875 TTGTAGAAAGAAAAGTTAATGGG + Intronic
976986545 4:91307211-91307233 TACTACACAGAGAGGTTATATGG - Intronic
976992694 4:91387646-91387668 TAATACACAGAAAGGTACAGAGG - Intronic
977709372 4:100107071-100107093 GAGGATACAGAAAGGTTAGTTGG + Intergenic
978281877 4:107027119-107027141 GAGTACAGAGCATGGTTAATGGG + Intronic
979745533 4:124208059-124208081 TGCTAAATAGAAAGGTTAATTGG - Intergenic
981155364 4:141428584-141428606 TAGTACACAGATACTTAAATAGG + Intergenic
981891889 4:149747997-149748019 TAGGATTCAGAGAGGTTAATTGG - Intergenic
982168213 4:152635423-152635445 TAGAACTCAGAGAGGTTAAGTGG - Intronic
982536680 4:156615646-156615668 AAGTTCACTGAAAGGTTAAAGGG + Intergenic
983293299 4:165833692-165833714 TATTACACAGCAAGATTAAGTGG - Intergenic
983414134 4:167434486-167434508 AAGTACATAGAAAAGTTATTTGG - Intergenic
986558344 5:9034759-9034781 TTGTAAACAGAAAGCCTAATTGG + Intergenic
986568837 5:9144471-9144493 TACTACACAGAAGGGTTCCTTGG - Intronic
987673260 5:21042016-21042038 AGGTAAACAGAAAGTTTAATAGG - Intergenic
990794980 5:59529617-59529639 TAGTTCAAAGGAAGGTAAATTGG - Intronic
991185888 5:63806681-63806703 TATTTCCTAGAAAGGTTAATTGG - Intergenic
991598456 5:68328423-68328445 TAGGACAGAGAAAGGTAAGTTGG + Intergenic
992009395 5:72511747-72511769 TAATAGACACAAAGGTTCATTGG + Intergenic
996545340 5:124671959-124671981 AAGTACACAGAAAAGGTAACAGG + Intronic
997728985 5:136150885-136150907 TATTTTACAGAAAAGTTAATAGG + Intronic
998745572 5:145255317-145255339 AAATACACAGAAAGGATAAATGG + Intergenic
999097829 5:148996414-148996436 TAGCAAACAGAAAGATTACTTGG - Intronic
1000403737 5:160863282-160863304 TACAACACAGAAAGGTGAAAGGG + Intergenic
1001144909 5:169175371-169175393 TAGTACACAGAAAGGTTAATGGG + Intronic
1001274886 5:170343363-170343385 GAGGACACAGAAAGGTAAAGAGG - Intergenic
1003156841 6:3603903-3603925 TAGTGCACAGAAAGGGTAAGTGG - Intergenic
1003317385 6:5024807-5024829 TAGCATCCAGAAAGGTTAAATGG + Intergenic
1003389575 6:5701762-5701784 TAGTAAATAAAAAGGCTAATTGG + Intronic
1004734588 6:18392471-18392493 TAACCCACAAAAAGGTTAATAGG + Intronic
1007083626 6:39127133-39127155 CAGTACACAGGAAGCTTAAAAGG + Intergenic
1009767690 6:68102361-68102383 TACTTCACAGAGAGGTTGATAGG + Intergenic
1013660028 6:112286068-112286090 TATGACACACTAAGGTTAATTGG + Intergenic
1014424221 6:121284439-121284461 TAGTGCACACAAAGTTTTATTGG - Intronic
1014534955 6:122603805-122603827 TAGTACAAATAAAGCTTATTTGG + Intronic
1015359076 6:132315474-132315496 TAGTAATCAAAAAGGTTACTTGG + Intronic
1015787361 6:136931528-136931550 AACAACACAGAAAGGTGAATGGG + Intergenic
1016221658 6:141678949-141678971 TATTACACTGAAAGGTTTATAGG - Intergenic
1017471585 6:154742190-154742212 TGCTTCACAAAAAGGTTAATTGG + Intronic
1018299701 6:162388476-162388498 TAGCACACAGCAAGGTTGAGGGG + Intronic
1018678444 6:166243028-166243050 TATTACACAGAAGAGTTAAGAGG + Intergenic
1020196180 7:6041236-6041258 TAGTAAACATAAAAGTCAATGGG + Intronic
1020626149 7:10581835-10581857 TATTAGAAAGAAAGGCTAATAGG - Intergenic
1020757973 7:12228316-12228338 GAGTATACATAAATGTTAATAGG - Intronic
1021056751 7:16058330-16058352 TAGGACACAGAAGTGTAAATAGG + Intergenic
1022917206 7:34970007-34970029 GAGAACACAGAAAAGTTAAGTGG + Intronic
1022939271 7:35216500-35216522 TAATACACAGAGAGCTTAATTGG + Intronic
1023771522 7:43560938-43560960 TAGTAGAGAGAAAGGTGGATGGG - Intronic
1024616605 7:51119877-51119899 TAGAACTCAGAAAAGTTGATTGG + Intronic
1027662479 7:81003914-81003936 TAGTATCAATAAAGGTTAATTGG + Intergenic
1027754300 7:82192061-82192083 TAGTACAGAGTAAGGTAAAGAGG - Intronic
1028167729 7:87557704-87557726 TAGTTCACTGAAAGTTTAAAGGG - Intronic
1030497527 7:110318032-110318054 TAGAACACAGATAGGTCAAAAGG + Intergenic
1030849006 7:114459391-114459413 AAGAAAACAGAAAGGTTAAATGG + Intronic
1031526674 7:122830078-122830100 TTGGACACAGAAAGGTTAACTGG + Intronic
1033032076 7:137836979-137837001 TTGCACACAGAGAGGGTAATGGG + Intronic
1033407258 7:141082077-141082099 TAGTACACACCAAGGTTATGTGG - Intronic
1034281481 7:149857924-149857946 ACGTACACAGAAAGGTGAAGGGG - Intronic
1035351580 7:158251083-158251105 TAATGCATAGAAAGGGTAATGGG + Intronic
1036254646 8:7195629-7195651 TAGGAAACAGAAATGTTATTAGG + Intergenic
1039154769 8:34542409-34542431 AAGGACACAGAATGGTAAATTGG + Intergenic
1042752952 8:72178322-72178344 GAGAACACAGAAAGGGTAGTGGG + Intergenic
1043796480 8:84547897-84547919 TATTCCCCAGAAAGGCTAATGGG + Intronic
1044103867 8:88176773-88176795 TAGCACAAAGATAGATTAATAGG - Intronic
1045154508 8:99452157-99452179 AAGAACACAGAAAGGTTACTAGG - Intronic
1045583779 8:103507446-103507468 TAGTACTCAAAAATATTAATCGG + Intronic
1046646571 8:116792367-116792389 TAAAACACAGAAATGTGAATTGG + Intronic
1047904364 8:129457055-129457077 TAGGACCAACAAAGGTTAATAGG - Intergenic
1051222429 9:14863754-14863776 AAGAACACAGAATGGTTACTTGG + Intronic
1052686017 9:31756922-31756944 AAGTACACACAAAAGTAAATAGG + Intergenic
1057614665 9:96578736-96578758 CAGAATAGAGAAAGGTTAATGGG + Intronic
1059953600 9:119493193-119493215 TAGAACAAAGAAAGGGTAAAAGG + Intergenic
1062419832 9:136475070-136475092 AAGGACACAGAAAAGTTAATGGG + Exonic
1186366291 X:8897547-8897569 TGGAACAGAGAAAGATTAATTGG - Intergenic
1188132854 X:26459236-26459258 TAGTATAAAGAAAGGTCAATTGG - Intergenic
1189762903 X:44341263-44341285 TAATGAACAGAAAGGTTCATAGG + Intronic
1191203879 X:57814249-57814271 AAGGACACAGACAGGTAAATTGG - Intergenic
1191203888 X:57814357-57814379 AAGGACACAGACAGGTAAATTGG - Intergenic
1191957751 X:66664560-66664582 TAATAGACAGAAAGTTTTATTGG - Intergenic
1193085224 X:77442907-77442929 TATCACACAGAAAGATTAATAGG + Intergenic
1193092185 X:77506347-77506369 TAATACTTAGAAGGGTTAATTGG - Exonic
1193851277 X:86540235-86540257 AAATACATAAAAAGGTTAATTGG - Intronic
1194421862 X:93685595-93685617 TAGTAAAAAGAAAAATTAATAGG + Intronic
1195610514 X:106862102-106862124 TAGTACACTGTTAGGCTAATGGG + Intronic
1197631119 X:128859493-128859515 TGGAACACAGAAAGGATATTAGG + Intergenic
1198151811 X:133918376-133918398 TAGTATACTGACAGTTTAATTGG + Intronic
1198367713 X:135958960-135958982 TAGAACACAAAAAGGATACTAGG + Intergenic
1198394396 X:136207642-136207664 TAGAACACAGGTAGGTTAGTTGG + Intronic