ID: 1001144910

View in Genome Browser
Species Human (GRCh38)
Location 5:169175376-169175398
Sequence CACAGAAAGGTTAATGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001144901_1001144910 -2 Left 1001144901 5:169175355-169175377 CCCCTCTTCCCACTCCTAGTACA 0: 1
1: 0
2: 0
3: 50
4: 964
Right 1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG 0: 1
1: 0
2: 0
3: 22
4: 265
1001144904_1001144910 -10 Left 1001144904 5:169175363-169175385 CCCACTCCTAGTACACAGAAAGG 0: 1
1: 0
2: 3
3: 9
4: 170
Right 1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG 0: 1
1: 0
2: 0
3: 22
4: 265
1001144902_1001144910 -3 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG 0: 1
1: 0
2: 0
3: 22
4: 265
1001144903_1001144910 -4 Left 1001144903 5:169175357-169175379 CCTCTTCCCACTCCTAGTACACA 0: 1
1: 0
2: 1
3: 36
4: 335
Right 1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG 0: 1
1: 0
2: 0
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001144910 Original CRISPR CACAGAAAGGTTAATGGGTT AGG Intronic
900847694 1:5116702-5116724 CACAGAAAGGCTACAGGGTGCGG - Intergenic
902076931 1:13794566-13794588 CACAGAAAGGAAAACGGGCTCGG - Intronic
902359550 1:15934975-15934997 CACCGAGAGGTGAATGGGCTCGG - Exonic
902554506 1:17239013-17239035 CTCAGAAAGGTGAATTGGCTTGG + Intronic
905499991 1:38428648-38428670 GACAGAAAGGTTACAGGGTGCGG - Intergenic
906750890 1:48258675-48258697 CACATAAAGTTTAATGGCTTTGG - Intergenic
907862228 1:58364474-58364496 CACAGAAAGGATGGTTGGTTTGG + Intronic
908403748 1:63794169-63794191 CACAGTTAGTTGAATGGGTTTGG - Intronic
908572964 1:65428374-65428396 CACAGAGAGGGGAAGGGGTTTGG - Intronic
908995824 1:70152677-70152699 CACAGGAACATTAATGAGTTTGG + Intronic
909347330 1:74606383-74606405 CCCAGAAAGGTTAAAGGTTCTGG - Intronic
909788060 1:79640864-79640886 CACAGAAAGGCTACAGGGTGAGG + Intergenic
910618868 1:89230722-89230744 CCCAGAAAGGACAAGGGGTTAGG - Intergenic
912555077 1:110510119-110510141 CACACACACGTTTATGGGTTGGG - Intergenic
913119586 1:115727571-115727593 CAAAGACAGGCTAATGGGTTGGG - Intronic
914572258 1:148929345-148929367 CACAGATAGGTTAAGGAATTTGG - Intronic
914600580 1:149200920-149200942 CACAGATAGGTTAAGGAATTTGG + Intergenic
916352492 1:163867072-163867094 CACAGAAAAGTTATTGGGTGGGG - Intergenic
917042227 1:170818048-170818070 CACAGGAGGGGGAATGGGTTTGG + Intergenic
917809889 1:178648022-178648044 CACTGAAAGATTAAAGGGTAAGG - Intergenic
918444893 1:184608071-184608093 CACAGCAATGTTCATGGGTTTGG - Intronic
922049326 1:221975236-221975258 CACAGAAAGGCTACAGGGTGTGG + Intergenic
922153852 1:223026538-223026560 CACAGAAAGGCTACAGGGTGTGG + Intergenic
922543417 1:226435900-226435922 CACAGAAAGGGCAAAGGCTTTGG - Intergenic
1064886787 10:20121297-20121319 CACAGAAAGGCTACAGGGTGTGG + Intronic
1065340053 10:24696203-24696225 CACAGAAAGTTTCAGGGCTTTGG + Intronic
1066266093 10:33776830-33776852 GACAGACAGGTGGATGGGTTTGG + Intergenic
1067023544 10:42823433-42823455 CACAGAACTGTTACTGGGTGTGG - Intronic
1068010721 10:51447114-51447136 TGCAGAAAGGTTAATGTGTTTGG - Intronic
1073358522 10:102877018-102877040 CACACAAAGTTTTATGGGGTAGG + Exonic
1073474779 10:103745766-103745788 CACAGATGTGTTTATGGGTTGGG - Intronic
1074329092 10:112485718-112485740 CACAGAAAGGTTAAATTGTGAGG - Intronic
1075591931 10:123698234-123698256 CACAGAAAGGGGAATGTGCTAGG - Intergenic
1076928981 10:133515131-133515153 CAAAGACAAGTTAATGGGTCAGG + Intergenic
1080135233 11:28846229-28846251 CACAGAAAGGTTAAGTGTCTTGG + Intergenic
1081418131 11:42840196-42840218 CACAGAAGGGGTAATGAGTGAGG + Intergenic
1081691181 11:45079776-45079798 CACAGAAAGGGGAATGGCTGAGG + Intergenic
1081830947 11:46113527-46113549 CACAAAAAGTTTAATTGTTTTGG + Intronic
1087128025 11:94645182-94645204 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1087204782 11:95382713-95382735 CACAGAAAAGTTTATAGGTAAGG + Intergenic
1088582916 11:111332504-111332526 CACAGAATGTTAAAGGGGTTCGG + Intergenic
1089470853 11:118719144-118719166 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1089660378 11:119981680-119981702 CACAGAAAGTGGAATGGGTAAGG - Intergenic
1089973214 11:122711012-122711034 CCCAGCAAAGTCAATGGGTTAGG + Intronic
1092626542 12:10335064-10335086 CACAGAAAGGCTACAGGGTGTGG + Intergenic
1092654243 12:10668004-10668026 TACAGAAAGGATAATGGGGATGG - Intronic
1092725735 12:11483924-11483946 CTCAGAGAGGTTAAGGGGATAGG + Intronic
1092789917 12:12061962-12061984 CATAGAAAGGTTACAGGGTGCGG - Intronic
1093668698 12:21846310-21846332 GACACAAAGGATAATGGGCTAGG + Intronic
1095574156 12:43715495-43715517 AAATGAAATGTTAATGGGTTAGG - Intergenic
1096895744 12:54819352-54819374 CACAGGAAGCATAAGGGGTTGGG - Intergenic
1097233623 12:57526182-57526204 CACAGAAGGGAGAATTGGTTGGG - Exonic
1097237359 12:57549580-57549602 CCCAGAAAGCTGAGTGGGTTGGG + Intergenic
1097426610 12:59453598-59453620 CAGAGACAGGTTAATGGGTATGG - Intergenic
1097814155 12:64053645-64053667 CAAAGGAAGTTTAATTGGTTGGG + Intronic
1099188930 12:79543440-79543462 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1099705356 12:86145655-86145677 CACAGAAAAGTTAGTGAGGTGGG + Intronic
1101086927 12:101245537-101245559 CACAGAAAGGAGACTGGCTTAGG - Intergenic
1101470745 12:104994851-104994873 CAAAGAATGATTAATGAGTTAGG + Exonic
1103659870 12:122505565-122505587 CACACAAAGAGGAATGGGTTTGG - Exonic
1105021522 12:132819737-132819759 CAGATAAAAGTTACTGGGTTAGG + Intronic
1107635479 13:42388191-42388213 CACTGAAAAATTAATGTGTTTGG + Intergenic
1108145775 13:47475050-47475072 AACAGAAAGGTTATTGGAATAGG - Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1109709454 13:66143464-66143486 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1109716528 13:66228517-66228539 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1109849216 13:68038430-68038452 CATAGTAAGGTAAATGTGTTAGG - Intergenic
1110765693 13:79277708-79277730 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1110978695 13:81869758-81869780 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1111794643 13:92902552-92902574 AACAGAAAGGTTATTGGAGTCGG + Intergenic
1111858089 13:93665688-93665710 GACAGAAGAGATAATGGGTTAGG + Intronic
1113113238 13:106847025-106847047 AACTGAAAGGTCATTGGGTTGGG - Intergenic
1114292448 14:21299675-21299697 CACAGAAAGGTTAAGTGGCATGG + Intronic
1114586388 14:23817572-23817594 CCCAGAAAGGGGAATGGGTAAGG + Intergenic
1116322213 14:43482596-43482618 AACTGAAAAATTAATGGGTTGGG + Intergenic
1119848002 14:77845259-77845281 CTCAGAAAGGTTAAATGGCTTGG - Intronic
1123424683 15:20160477-20160499 CACAGAACTGTTACTGGGTGTGG - Intergenic
1123533907 15:21167008-21167030 CACAGAACTGTTACTGGGTGTGG - Intergenic
1123787039 15:23684520-23684542 CACAGAAAAGTTTCTGGCTTTGG + Intergenic
1124334617 15:28847959-28847981 CACTGATGGGATAATGGGTTTGG - Intergenic
1125131305 15:36287773-36287795 CACAGAAAGGCTATAGGGTGCGG + Intergenic
1126692409 15:51297887-51297909 CACTGTAAGGTTACTGTGTTAGG - Intronic
1128346982 15:66860498-66860520 CACAGAGAGGTTAAGTGGTGGGG - Intergenic
1128443055 15:67731354-67731376 AACATAAAGGTTAAAGGGCTGGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1132078028 15:98839242-98839264 CACAGAAAGGTTAAGTAATTTGG + Intronic
1133749004 16:8710106-8710128 CACACAAAGGTTAACTGGCTGGG - Intronic
1134666046 16:16019527-16019549 CAGAGGAAGCTTGATGGGTTGGG - Intronic
1134818751 16:17228468-17228490 CACAGAACGGTGATGGGGTTGGG + Intronic
1135251576 16:20904774-20904796 CACTTAAAGGTTATTGGATTGGG + Intronic
1136860171 16:33695268-33695290 CACAGAACTGTTACTGGGTGTGG + Intergenic
1139915778 16:70427635-70427657 TACAGAAAGAATACTGGGTTTGG - Intronic
1139942845 16:70618615-70618637 GACAGAAAGGTTACAGGGTGTGG + Intronic
1140194976 16:72848255-72848277 CCGAGAAAGGTTAATGATTTAGG - Intronic
1140684222 16:77417522-77417544 CAGAGAAAGGTTAAATGATTAGG + Intronic
1203121677 16_KI270728v1_random:1543426-1543448 CACAGAACTGTTACTGGGTGTGG + Intergenic
1142699470 17:1650260-1650282 CACAGAAAGCTTAAAGGGCTGGG + Intergenic
1143958668 17:10696684-10696706 TACGGGAAGGTTAATGAGTTAGG - Intronic
1144344575 17:14338417-14338439 CAAAGAAAGGTATATGGGCTGGG - Intronic
1144694052 17:17289333-17289355 CTCAGAAAGATTAAGGGATTTGG + Intergenic
1144811937 17:18006245-18006267 CACAGAAAGGATATAGGCTTTGG - Exonic
1144863734 17:18321880-18321902 CTCAGAGAGGTTAATGAATTTGG + Intronic
1146680108 17:34801049-34801071 GACAGGAAGGTTAATGTGTCAGG + Intergenic
1150850722 17:68701433-68701455 TACAGAGAGGTTAAAGGGCTTGG + Intergenic
1150997648 17:70337544-70337566 AACAGAAATATTAATGGATTGGG - Intergenic
1153005334 18:493228-493250 CACAGAAAATTTAATGGGTGCGG - Intronic
1155639792 18:27999471-27999493 AACAGAAAGATTATTAGGTTTGG + Intronic
1157717306 18:49896877-49896899 CACAGAAAGGTTGGTTGATTAGG - Intronic
1158096192 18:53774215-53774237 GCCAGAAAAGTTAAGGGGTTTGG - Intergenic
1158381940 18:56941416-56941438 CACAGAAGAGTTGATGGGGTGGG + Intronic
1159403223 18:67964265-67964287 CCCAGGAAAGTCAATGGGTTGGG + Intergenic
1162028026 19:7905141-7905163 CACAAAAAGGATCATGGGTCAGG - Intronic
1162115529 19:8426985-8427007 CAGGGAGAGGTTAATGGGTCTGG - Intronic
1162237220 19:9318849-9318871 GACAGCATGGTAAATGGGTTGGG + Intergenic
1163784318 19:19266798-19266820 CAGAGAAAGGTTAGTAGGTTTGG - Intronic
1165496791 19:36157556-36157578 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1167089712 19:47335470-47335492 CACAGAAAGTTTCCTGGATTGGG + Intronic
925870709 2:8267505-8267527 CACAGAATGGATTATAGGTTTGG + Intergenic
925967046 2:9075836-9075858 CACAGAAAGGCAAAGGGGTTAGG - Intergenic
927615344 2:24588238-24588260 AACAGAAAAATTAATGGGTATGG - Intronic
927638056 2:24830332-24830354 CTCAAAAAGGGTAATTGGTTGGG - Intronic
929383813 2:41381885-41381907 GACAGAAAGGCTACTGGGTGTGG - Intergenic
931750241 2:65323893-65323915 CCCAGAAGGGTTTCTGGGTTTGG + Intronic
934458534 2:94196382-94196404 CACAGAACTGTTACTGGGTGTGG + Intergenic
935265252 2:101387818-101387840 CACAGAGAGGTTAAGTGGCTTGG - Intergenic
938477832 2:131632584-131632606 CACAGAAATGTTCTTGTGTTAGG - Intergenic
939535265 2:143420200-143420222 CACAGCAATGATAATGGGCTAGG + Intronic
940231328 2:151456247-151456269 CAAAGAAAAGTTCATGGATTTGG - Intronic
940339268 2:152562582-152562604 GAAAAAAATGTTAATGGGTTTGG + Intronic
940474158 2:154139417-154139439 CTCAGTAAGATTAATGTGTTAGG + Intronic
941285208 2:163603406-163603428 CACAGAAATTTTAATTAGTTAGG + Exonic
942234853 2:173893829-173893851 TACAGAATGGCTAATGGGTCTGG - Intergenic
944135841 2:196398237-196398259 ATCAGAAAGGTTAATGGTTAAGG + Intronic
944301859 2:198132626-198132648 CTCACAAAGTTGAATGGGTTTGG + Intronic
944394349 2:199250507-199250529 CACAGAAAGGCTACAGGGTGCGG - Intergenic
945938533 2:215925955-215925977 CACAGAAAGGCTACAGGGTGTGG - Intergenic
946005064 2:216517917-216517939 CACAGCAAGGTGCATGTGTTAGG - Intronic
946119263 2:217495018-217495040 CTCATAAAGGATAATGGATTAGG + Intronic
946520366 2:220457904-220457926 CACAGAAATGGGAGTGGGTTTGG - Intergenic
1169603241 20:7286420-7286442 CACAGTAACTTTAATGGTTTAGG + Intergenic
1169660614 20:7974618-7974640 CATAAAAAGGCTAATGGGGTCGG - Intergenic
1173102118 20:40096905-40096927 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1173196586 20:40919059-40919081 CACAGAGATGTTTATGGGATAGG + Intergenic
1173781926 20:45763237-45763259 CACAGAAAGGCTACAGGGTGCGG - Intronic
1175453367 20:59089791-59089813 CACAGACAGGGTAAGGAGTTGGG + Intergenic
1178348702 21:31854356-31854378 CACAGCAGGGTGACTGGGTTTGG + Intergenic
1178970515 21:37172051-37172073 AACAGAATGGTTTCTGGGTTTGG + Intronic
1179387772 21:40958526-40958548 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1179479530 21:41668714-41668736 CACAGAAGGGGTAAAAGGTTGGG - Intergenic
1179564321 21:42237088-42237110 CAGAGAAAGGCTGCTGGGTTTGG - Intronic
1181357670 22:22310052-22310074 CACAGAACTGTTACTGGGTGTGG - Intergenic
1184253362 22:43273413-43273435 CACAGAAAGCTCTATGGGTTGGG + Intronic
1184446273 22:44548901-44548923 CACAGAGAGGTTAATGAACTTGG + Intergenic
949133429 3:533796-533818 CACAGAGTGTTTAATGGGTATGG + Intergenic
949683485 3:6541740-6541762 CACAGGAAGCTCAAGGGGTTGGG - Intergenic
949764024 3:7505772-7505794 GGCAGAATGGTTAAGGGGTTGGG - Intronic
949827651 3:8180587-8180609 CACAGAAAGGCTACAGGGTATGG - Intergenic
949989339 3:9565403-9565425 CACAGAAAGGTTAAAGGTGAAGG - Intergenic
950002527 3:9668242-9668264 CACATAGAGGTCAGTGGGTTTGG + Intronic
951298605 3:20969644-20969666 CACAGAAAGGCTACCGGGTGAGG + Intergenic
953161373 3:40423221-40423243 AATAGAAAGGTTTATGGGTGAGG - Intronic
953664978 3:44918830-44918852 CACAGAAAGGGTGTTGGGGTGGG + Intronic
953759258 3:45673965-45673987 CACAAGAAGGGTACTGGGTTGGG - Intronic
955449395 3:59050636-59050658 CTCAGAAAGGTTAAATGGCTTGG + Intergenic
955466267 3:59240484-59240506 GAAAGAAAGAGTAATGGGTTTGG + Intergenic
956403717 3:68906508-68906530 GACAGAAAGGTTAATAATTTGGG + Intronic
957268252 3:77995632-77995654 CACGGAAAGGTAAATGTGGTTGG - Intergenic
958084408 3:88787848-88787870 CACACACAGTTTAATGAGTTTGG - Intergenic
958740261 3:98060593-98060615 CACTGAAAGATTACTGGGTTTGG + Intergenic
959054926 3:101558125-101558147 GAAAGAAAGGATAATGGGATGGG - Intergenic
961019208 3:123489997-123490019 CAGAGAAATGTTAATAGGTATGG + Intergenic
962240269 3:133746180-133746202 CACAGAAATGTTGATGGGAAGGG - Exonic
963663558 3:148155227-148155249 CACAGAAAGGCTACAGGGTGTGG - Intergenic
963765214 3:149327526-149327548 CCAAGAAAGGTTATTTGGTTTGG + Intronic
963855196 3:150246229-150246251 CACGGATAGCTTCATGGGTTTGG - Intergenic
964661334 3:159123573-159123595 CACAGAATGGGTTATGGGGTGGG + Intronic
965410583 3:168325857-168325879 CCCAGAAAGCTTAATTGATTTGG + Intergenic
965616449 3:170597726-170597748 AACAGAAAGATTATTGGATTCGG + Intronic
965617449 3:170609732-170609754 CACTGAAATGTTAAGAGGTTAGG - Intronic
965636023 3:170781761-170781783 CACAGAAAGGATACTGGATTAGG - Intronic
965661455 3:171046292-171046314 CACAGCAAGGGTAAGGGGGTAGG + Intergenic
965723979 3:171694007-171694029 TACAGAAATGTTTATGTGTTTGG - Intronic
966232643 3:177667985-177668007 GACAGAAAGGTTACAGGGTGTGG + Intergenic
967643611 3:191897474-191897496 CACAGAAAGGCTACAGGGTGCGG + Intergenic
968177055 3:196559724-196559746 CACAGAAAAGTTTCTTGGTTTGG - Intronic
968293880 3:197558586-197558608 CACAGAAAAGTGAAAGTGTTCGG - Intronic
971592131 4:28481613-28481635 AACAGAAAGGATAATGTGTCAGG + Intergenic
974115465 4:57573848-57573870 CACAGAAAAGTCAATGGAGTTGG + Intergenic
974875407 4:67698254-67698276 AACTGACAGGTTAATGAGTTAGG - Intronic
975677109 4:76837875-76837897 CACAGAAAAGTTAAGGAATTTGG + Intergenic
975803728 4:78090599-78090621 CACAGATGAGTTAATGGTTTGGG - Intronic
977171675 4:93769518-93769540 CCCAGGGAGGATAATGGGTTGGG + Intronic
979682786 4:123480113-123480135 CTCAGAGAGGTGAAGGGGTTTGG + Intergenic
979854657 4:125616828-125616850 ATCAGAAATGTTAATGAGTTTGG - Intergenic
980106026 4:128589169-128589191 CACAGAAGGGGTAACAGGTTAGG - Intergenic
981889485 4:149718044-149718066 GACAGAGAGGTTCATGGCTTTGG + Intergenic
982126411 4:152187750-152187772 CCCAGAAGGGTGAATGTGTTCGG + Intergenic
982541574 4:156678723-156678745 CACTGAAAGATTAATGTGATTGG - Intergenic
983024087 4:162712675-162712697 CACAGAAAGGCTACAGGGTGCGG - Intergenic
984247935 4:177297730-177297752 CACTGAAAGGCTACAGGGTTAGG + Intergenic
986220812 5:5767163-5767185 CACAGAAAGGTAAAGGATTTCGG - Intergenic
986393471 5:7305970-7305992 CACTGATGGGATAATGGGTTTGG - Intergenic
986981665 5:13455016-13455038 TAGAGAAAAGTTAAAGGGTTTGG + Intergenic
987487700 5:18541887-18541909 CACAGAAAGGCTACAGGGTGTGG - Intergenic
987756032 5:22098416-22098438 GACAGAAAGGCTAAAGGGTGGGG - Intronic
988685740 5:33523521-33523543 CACAGAAACATCAATGAGTTTGG + Exonic
989228027 5:39053162-39053184 CAGAGAAAGTTTTATTGGTTAGG - Intronic
990673959 5:58162580-58162602 CCCAGGAAGCTTAAGGGGTTGGG - Intergenic
991287656 5:64996604-64996626 CACAGAAAGGTTAAGTAATTTGG + Intronic
992360143 5:76029370-76029392 AACAGAGAGGTTAGGGGGTTGGG - Intergenic
992569783 5:78043502-78043524 CAAAGAAAGGGTAATGGGATAGG + Intronic
995848819 5:116523065-116523087 CCCAGAAAGGGTACTGGGATGGG - Intronic
996553172 5:124751053-124751075 CTCAGAAAGGTTTAAGGTTTGGG - Intergenic
997137385 5:131341225-131341247 CACAGAGATGTTACTTGGTTTGG - Intronic
997770422 5:136548463-136548485 CACAGAAAGGCTACAGGGTGCGG + Intergenic
999618665 5:153451842-153451864 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1001144910 5:169175376-169175398 CACAGAAAGGTTAATGGGTTAGG + Intronic
1002511361 5:179720699-179720721 GAAAGAGAGCTTAATGGGTTAGG + Intronic
1003675399 6:8199740-8199762 AATAGAATGGTTACTGGGTTTGG + Intergenic
1004507790 6:16261126-16261148 CACAGAAAGGCTACAGGGTGCGG + Intronic
1004575427 6:16889522-16889544 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1005070705 6:21859866-21859888 TATAGAAAGGTTAATGATTTGGG + Intergenic
1006253724 6:32812924-32812946 CACAGAAAAGTAAATGATTTGGG + Exonic
1008747467 6:54690197-54690219 CACGGAAAGGTTTCTGGGTTGGG + Intergenic
1010027630 6:71238250-71238272 CACAGATAGGGTAATGGATCAGG + Intergenic
1012526842 6:100188032-100188054 CTAAGAAAGGTTAGTGGGGTAGG - Intergenic
1013891916 6:115035455-115035477 CACAGAAAGGCTACAGGGTGTGG - Intergenic
1014454661 6:121622571-121622593 GACAGAAAGGCTAAAGGGTGTGG + Intergenic
1015066110 6:129030667-129030689 CAAAGAAAGGCTTATGGTTTTGG + Intronic
1015337633 6:132058847-132058869 CACAGAAAGCAGAATGGGTCTGG + Intergenic
1016853482 6:148643377-148643399 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1017016198 6:150101525-150101547 CACAAAGATGTTAATGGGGTTGG - Intergenic
1017205987 6:151805088-151805110 CATGGAAAGGTTTGTGGGTTTGG + Intronic
1017389713 6:153925062-153925084 GACAGAAAGGTTACAGGGTGCGG - Intergenic
1020628866 7:10616266-10616288 CACAGACAGGTTTATGGTCTAGG - Intergenic
1020773320 7:12423282-12423304 CACAGAAGGATTATTGGGTATGG - Intergenic
1022373082 7:29788413-29788435 GACAGAAAGGTTACAGGGTGCGG - Intergenic
1023190296 7:37573362-37573384 GACAGAAAGATTCATGGGTTAGG - Intergenic
1023559422 7:41458435-41458457 TACAGAAAGATAAATGTGTTGGG - Intergenic
1026570420 7:71524772-71524794 CACAGAAAGGTTAAAAAGATGGG - Intronic
1031789230 7:126079265-126079287 CAAAGAAAGGATACTGGCTTGGG + Intergenic
1033032077 7:137836984-137837006 CACAGAGAGGGTAATGGGAAAGG + Intronic
1033548696 7:142425686-142425708 CCCAGCAAGGTTAGTGTGTTGGG - Intergenic
1036118791 8:5991484-5991506 AACAGAAAGGTTAATGCATTAGG + Intergenic
1038189520 8:25307036-25307058 CATAGAAAAGGTAATGAGTTGGG + Intronic
1040807764 8:51412676-51412698 CACAGAGAAGTTAATGGGATTGG + Intronic
1041437821 8:57861771-57861793 TACAGAAAGGAATATGGGTTTGG + Intergenic
1041788271 8:61660256-61660278 TACAGAGAGGTGAATGGGATGGG - Intronic
1042416345 8:68524582-68524604 AACAGAGAGGTGAATGTGTTGGG + Intronic
1042752954 8:72178327-72178349 CACAGAAAGGGTAGTGGGGCAGG + Intergenic
1043207025 8:77457374-77457396 CACAGAAAGGAAAGTAGGTTTGG + Intergenic
1043690351 8:83143320-83143342 CACAGAATGTATCATGGGTTAGG + Intergenic
1043717695 8:83507288-83507310 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1044148312 8:88744348-88744370 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1045154506 8:99452152-99452174 CACAGAAAGGTTACTAGGGCTGG - Intronic
1045341006 8:101254474-101254496 CACAGAAAGGTGAAGGGCTGGGG - Intergenic
1045752740 8:105505058-105505080 CACAGAAAATTACATGGGTTTGG + Intronic
1046443457 8:114285562-114285584 CACAGAAAGGCTACAGGGTGCGG - Intergenic
1046611185 8:116427299-116427321 CACAGAAAGGATAATCACTTAGG - Intergenic
1046673660 8:117085071-117085093 CAGAGAAAGATAAATGGCTTTGG + Intronic
1046843249 8:118885136-118885158 CCCAGAAAAGTTAAGGTGTTGGG - Intergenic
1047139020 8:122114787-122114809 CAAAGAAAGGTGAGTGGTTTAGG - Intergenic
1047928696 8:129704985-129705007 CACAGAGAGGTAAATGGTTTAGG - Intergenic
1048585220 8:135769286-135769308 CACAGAAAGGCTACAGGGTGCGG + Intergenic
1048981439 8:139704875-139704897 AACAGAGAGGTTACTGGGTCGGG - Intergenic
1049676596 8:143891981-143892003 CACAGAAAGGGTCAGGGGTCAGG + Intergenic
1049952116 9:655425-655447 CAGATAAAAGGTAATGGGTTAGG + Intronic
1052735746 9:32340706-32340728 CACAGAAAGGTGAATGTGGAGGG - Intergenic
1053009594 9:34625536-34625558 CACTGGCAGGTTAATGAGTTTGG - Intronic
1053689037 9:40572198-40572220 CACAGAACTGTTACTGGGTGTGG + Intergenic
1054274997 9:63058868-63058890 CACAGAACTGTTACTGGGTGTGG - Intergenic
1054300281 9:63373130-63373152 CACAGAACTGTTACTGGGTGTGG + Intergenic
1054953537 9:70881809-70881831 AACAGAAAAGTTGATGAGTTTGG - Intronic
1056204455 9:84306594-84306616 TTCACTAAGGTTAATGGGTTGGG - Intronic
1058163116 9:101592074-101592096 CACAAAAAGTTAAATAGGTTGGG + Exonic
1058176855 9:101745697-101745719 CACAGATAGGTGTATGGGATGGG + Intergenic
1061414030 9:130436239-130436261 GACAGAAAGGTCAAGGGGGTGGG + Intergenic
1187255883 X:17641684-17641706 CACAGAATGCTGAATGGGTTGGG - Intronic
1191957750 X:66664555-66664577 GACAGAAAGTTTTATTGGTTTGG - Intergenic
1193085225 X:77442912-77442934 CACAGAAAGATTAATAGGATTGG + Intergenic
1193451184 X:81669939-81669961 CACAGAAACCTGAATGGGATTGG - Intergenic
1194706629 X:97182747-97182769 CAGAGAAAGGTTCCTGGCTTGGG + Intronic
1195122064 X:101764784-101764806 CACTGAAAGGCTCAGGGGTTGGG + Intergenic
1196061542 X:111412844-111412866 CATAGAAAGGTCTTTGGGTTGGG - Intergenic
1196109974 X:111936266-111936288 TACAGAAAGGTTAATGACTTTGG + Intronic
1197261755 X:124327361-124327383 CACAGCAAGGTATATGGCTTGGG + Intronic
1197351847 X:125390986-125391008 CACAGAAAGGCTACAGGGTGTGG + Intergenic
1197821349 X:130543963-130543985 GAGAGAAAGGTCAAAGGGTTTGG + Intergenic