ID: 1001144911

View in Genome Browser
Species Human (GRCh38)
Location 5:169175384-169175406
Sequence GGTTAATGGGTTAGGCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001144906_1001144911 -3 Left 1001144906 5:169175364-169175386 CCACTCCTAGTACACAGAAAGGT 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1001144904_1001144911 -2 Left 1001144904 5:169175363-169175385 CCCACTCCTAGTACACAGAAAGG 0: 1
1: 0
2: 3
3: 9
4: 170
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1001144902_1001144911 5 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1001144901_1001144911 6 Left 1001144901 5:169175355-169175377 CCCCTCTTCCCACTCCTAGTACA 0: 1
1: 0
2: 0
3: 50
4: 964
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1001144903_1001144911 4 Left 1001144903 5:169175357-169175379 CCTCTTCCCACTCCTAGTACACA 0: 1
1: 0
2: 1
3: 36
4: 335
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1001144907_1001144911 -8 Left 1001144907 5:169175369-169175391 CCTAGTACACAGAAAGGTTAATG 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001144911 Original CRISPR GGTTAATGGGTTAGGCAATT TGG Intronic
907256264 1:53181335-53181357 GGCTAATGGGCTAGGCAATCTGG - Intergenic
910420413 1:87055399-87055421 GGTTAATGGGTTAGAGGCTTAGG - Intronic
913352672 1:117879273-117879295 GGTTTCTGGCTTAGGCACTTGGG + Intronic
913356073 1:117923522-117923544 GATTAATGGGTTTGGTAAGTTGG + Intronic
914760375 1:150593773-150593795 GGTTATTGTATTTGGCAATTAGG + Intergenic
915494309 1:156270520-156270542 GGTTTATGGGTTAGACATTTGGG - Intronic
918744788 1:188185414-188185436 GGTTAATGAGGTAGGAACTTTGG - Intergenic
919229584 1:194756504-194756526 GGTTAATGGTTAAGATAATTTGG + Intergenic
1064985741 10:21208142-21208164 GGATAAAGGGCTAGGAAATTGGG + Intergenic
1071057947 10:81532359-81532381 TGTTAATGAGTTAGGAAAATTGG - Intergenic
1079193412 11:18302031-18302053 GGTTATTGGGTTTGGCAGTTTGG - Intronic
1079757991 11:24289984-24290006 GGTTAATTGGTTCTGGAATTTGG + Intergenic
1080667030 11:34345163-34345185 GGTTAGTGGGGTAGGCCATTGGG - Intronic
1087456690 11:98395651-98395673 GGTGAAAGGGATAGCCAATTGGG + Intergenic
1087480666 11:98696276-98696298 GGTTTTTGTGTTAGGCAACTAGG + Intergenic
1091268452 11:134288755-134288777 GGTTAAAGAGTGAGGCTATTTGG - Intronic
1091611222 12:2011384-2011406 AGTTAATGGGAAAGGCAATCTGG - Intronic
1094084819 12:26577858-26577880 GTTTTATAGGTTATGCAATTTGG - Intronic
1094763870 12:33569077-33569099 GGCTGAGGGGTTAGGTAATTGGG - Intergenic
1103600096 12:122049358-122049380 GCTCAATGGGATAAGCAATTGGG + Intronic
1104048099 12:125177588-125177610 GGTTAATGGGTTTGTCACCTTGG + Intergenic
1105469790 13:20683206-20683228 GGTTAACAGGTAAGCCAATTTGG - Intronic
1107902558 13:45032123-45032145 GGTTATTGGGTTTAGCAAGTGGG + Intronic
1110723390 13:78791059-78791081 GGTTTTTGGCTTAGGCAATTGGG - Intergenic
1111027859 13:82555950-82555972 TGTTAATTGGTTAGCCAATGTGG + Intergenic
1115804587 14:37036611-37036633 TGATAAAGGGTTAGGCATTTTGG - Intronic
1117089762 14:52237960-52237982 TATTAATGGGTTAGGGAAGTGGG - Intergenic
1120603170 14:86537819-86537841 GGTAAAGGGGTGAGGCAATTGGG + Intergenic
1124657053 15:31517112-31517134 GGGTCATGGGTTAGGCAACCAGG + Intronic
1127745746 15:61970334-61970356 GGTTTGTGGGTTAGGAAGTTTGG - Intronic
1128681717 15:69657328-69657350 GGTTGGTGGCTTAGGCAACTGGG - Intergenic
1130836343 15:87653739-87653761 TGGTGATGGGTTGGGCAATTGGG - Intergenic
1135341823 16:21654870-21654892 GGTTAATGGGTTTGGAAAACTGG - Intronic
1138868965 16:60857707-60857729 GGTTAAAGTGTTAGGAGATTTGG - Intergenic
1146499033 17:33348586-33348608 GGTGAGAGGGTTAGGAAATTGGG + Intronic
1147165814 17:38592731-38592753 CTTTAATGTGTTAGGCAATGTGG + Intronic
1167986596 19:53323868-53323890 GGTCAGTGGGTGAGGCAAGTAGG - Intergenic
928620028 2:33079438-33079460 GCTTAAAGAGCTAGGCAATTTGG + Intronic
929218835 2:39442621-39442643 GGCTTATGGTATAGGCAATTGGG + Intergenic
929286006 2:40135855-40135877 GGTTAAAGGATAAGGCCATTGGG + Intronic
931004784 2:57836445-57836467 CATTAATGGGTCAGGCAATCTGG + Intergenic
938584692 2:132678745-132678767 GGCTAATAAGTTAGGCAATCAGG + Intronic
939820322 2:146949097-146949119 GGTAAATGAGTTAGCCAAGTTGG - Intergenic
940553632 2:155194074-155194096 AGGTAATAGGTTCGGCAATTAGG - Intergenic
940900426 2:159121674-159121696 TGTTAATGGTTTAGGAATTTGGG + Intronic
1175993648 20:62802414-62802436 GGTGACTGGGAAAGGCAATTGGG + Intergenic
1177540233 21:22483377-22483399 GATTAAGGTGCTAGGCAATTTGG - Intergenic
1178951798 21:36991249-36991271 GGTTATTGGTTTAGGGAGTTTGG - Intergenic
1184424284 22:44400152-44400174 AGTTAATGGGATGGGCAGTTAGG - Intergenic
949612698 3:5719128-5719150 GGTTTATGGGTTGGGCAGTGTGG + Intergenic
950058793 3:10051472-10051494 GGCTATTGGCTTTGGCAATTAGG + Intronic
950300436 3:11872739-11872761 GGCTATTGGCTTTGGCAATTAGG + Intergenic
950308816 3:11938163-11938185 GGTTGAGGGGTTGGGAAATTTGG - Intergenic
955144916 3:56307598-56307620 GGTTAATGGTCTTGGCATTTTGG - Intronic
955985587 3:64570800-64570822 GGTTTCTGGTTTGGGCAATTGGG + Intronic
959049317 3:101509382-101509404 GGGTACTGGATTTGGCAATTAGG - Intronic
959824539 3:110777958-110777980 ATTTAATGGGTTAGACAATATGG - Intergenic
959942676 3:112095911-112095933 TATTAATGGGCTTGGCAATTAGG - Intronic
963916304 3:150861754-150861776 TGTTAATGGGTTAGGGAACTGGG + Intergenic
964217626 3:154304647-154304669 GTTTCATGGATTAGACAATTGGG - Intronic
964818394 3:160742057-160742079 GTTTAATGGGTATGGCATTTTGG - Intergenic
969438797 4:7204973-7204995 GGTCAATGAGGTAGTCAATTGGG - Intronic
970443901 4:16108420-16108442 GGTTCATGGGCTTGGCATTTTGG + Intergenic
973623392 4:52749246-52749268 GGTTAATGGCTTTGTCAATTAGG - Intronic
978091122 4:104716409-104716431 GGTTTCTGGGTTGGGCAACTGGG + Intergenic
978173689 4:105704755-105704777 GGTTACTGGCTTGGGCAATAGGG - Intronic
979428922 4:120603280-120603302 GTTTAATGTGTTAGGGAATATGG - Intergenic
979982621 4:127275496-127275518 GGTTAAAGGGTAAGCCGATTTGG - Intergenic
981292236 4:143089598-143089620 GATTTCTGGCTTAGGCAATTGGG + Intergenic
982225902 4:153166371-153166393 GATTGATGGGTTTGGTAATTGGG + Intronic
982374067 4:154668461-154668483 GTTTAATGGGTTATACATTTTGG + Intronic
987834731 5:23146349-23146371 GCTTAGTGTGTTAGGCAGTTGGG + Intergenic
988074524 5:26335905-26335927 GGAAAGAGGGTTAGGCAATTGGG + Intergenic
992428647 5:76685644-76685666 GGGTAATGGGTAAGGCAAACAGG - Intronic
997536268 5:134624519-134624541 GGTTAATAGGTGAGGCAGTGAGG + Intronic
1001144911 5:169175384-169175406 GGTTAATGGGTTAGGCAATTTGG + Intronic
1001548138 5:172583309-172583331 AGTTAATGGGTAAGGAAGTTGGG - Intergenic
1003673331 6:8180266-8180288 GAAAAATGGTTTAGGCAATTTGG - Intergenic
1005745985 6:28838202-28838224 GGTTAATGAGCTCGTCAATTTGG + Intergenic
1005858113 6:29879599-29879621 GGTTAATGGATAAGCCAATTTGG - Intergenic
1007054323 6:38867343-38867365 GGTTAATGGGTTAGGGATTTGGG - Intronic
1009420038 6:63455320-63455342 AGATAATGGGTGAGGCAGTTTGG - Intergenic
1014622712 6:123688899-123688921 GCTTACTTGGTTAGGCCATTTGG - Intergenic
1015909950 6:138160857-138160879 GGTTACTTGTTTAGGAAATTGGG - Intergenic
1016515186 6:144885185-144885207 GTGTATTGGGTTAGGCCATTTGG + Intergenic
1016651322 6:146464160-146464182 GGTTAATGAGTTTGAAAATTTGG - Intergenic
1017226169 6:152023398-152023420 GATTAATGGATTAAGCAATGGGG - Intronic
1017281540 6:152631222-152631244 GGTAAATGGGTTAGTCACTCAGG + Intronic
1020621098 7:10520151-10520173 GATGATTGGATTAGGCAATTAGG - Intergenic
1024867227 7:53917928-53917950 GGCCAATGGGTTTGGCAATTAGG - Intergenic
1026303500 7:69119840-69119862 GGTTTATGGATAAGACAATTTGG + Intergenic
1030538023 7:110793058-110793080 GGTTACTGGGGTGGGCAGTTGGG + Intronic
1031598786 7:123678466-123678488 GGTTAGTGATTTAGACAATTTGG + Intergenic
1033246280 7:139718957-139718979 GGCCATTGGATTAGGCAATTAGG - Intronic
1040855279 8:51942714-51942736 CCTTAATGGGTTTGGCTATTAGG + Intergenic
1041593093 8:59613613-59613635 GGTTAATGAGCTAGCAAATTAGG + Intergenic
1042880094 8:73477770-73477792 GGTTTCTGCATTAGGCAATTGGG + Intronic
1046558426 8:115806577-115806599 GGTTAATGGTTTAGAAAATTAGG + Intronic
1049060789 8:140274469-140274491 GGAGAATGGGTTAGACAATGCGG + Intronic
1053126437 9:35584451-35584473 GGTTAATGAATAAGCCAATTTGG + Intergenic
1056404751 9:86262859-86262881 GGTCATTGTGTTAGGCGATTTGG - Intergenic
1190300757 X:49055682-49055704 GGGTAATGTGTTACTCAATTGGG + Intronic
1192373827 X:70538875-70538897 AGTTCATAGATTAGGCAATTGGG - Intronic
1194679495 X:96835101-96835123 GGTTAATTGGATAGTCAAATTGG + Intronic
1199356861 X:146872674-146872696 GTTTATTGGATTAAGCAATTAGG - Intergenic
1201926776 Y:19295930-19295952 GGTTAATAGATAAGCCAATTTGG + Intergenic