ID: 1001144912

View in Genome Browser
Species Human (GRCh38)
Location 5:169175385-169175407
Sequence GTTAATGGGTTAGGCAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001144904_1001144912 -1 Left 1001144904 5:169175363-169175385 CCCACTCCTAGTACACAGAAAGG 0: 1
1: 0
2: 3
3: 9
4: 170
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1001144901_1001144912 7 Left 1001144901 5:169175355-169175377 CCCCTCTTCCCACTCCTAGTACA 0: 1
1: 0
2: 0
3: 50
4: 964
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1001144906_1001144912 -2 Left 1001144906 5:169175364-169175386 CCACTCCTAGTACACAGAAAGGT 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1001144902_1001144912 6 Left 1001144902 5:169175356-169175378 CCCTCTTCCCACTCCTAGTACAC 0: 1
1: 0
2: 1
3: 12
4: 225
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1001144907_1001144912 -7 Left 1001144907 5:169175369-169175391 CCTAGTACACAGAAAGGTTAATG 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1001144903_1001144912 5 Left 1001144903 5:169175357-169175379 CCTCTTCCCACTCCTAGTACACA 0: 1
1: 0
2: 1
3: 36
4: 335
Right 1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001144912 Original CRISPR GTTAATGGGTTAGGCAATTT GGG Intronic
903437423 1:23361529-23361551 GTGAATAGGTGTGGCAATTTAGG + Exonic
903621401 1:24700898-24700920 GTGATTGGTTTAGGCAATTCTGG - Intergenic
904754315 1:32759732-32759754 GTTAATGGGTAAGGGCAGTTGGG - Intronic
905084545 1:35360117-35360139 GTTTATGAGTTAGGCATTGTTGG - Intronic
907256263 1:53181334-53181356 GCTAATGGGCTAGGCAATCTGGG - Intergenic
907829240 1:58048542-58048564 TATAATGGGTTTGGCAATTATGG - Intronic
912033948 1:105287123-105287145 ATTAATTGGTGAGGCATTTTGGG + Intergenic
914953105 1:152135962-152135984 TTTAATGTGTTAGCAAATTTGGG - Intergenic
915786730 1:158621770-158621792 GTCAAGGAGTTAGGGAATTTAGG - Intronic
917543790 1:175941089-175941111 GTTAATGTATTAGGCATTTCTGG - Intergenic
917944331 1:179953921-179953943 GTTACTGTGCTAGGCCATTTTGG + Intergenic
918957427 1:191227598-191227620 GTTTGTAGGTTATGCAATTTAGG + Intergenic
920397583 1:205658387-205658409 GGTCCTGGGTTAGGCATTTTGGG + Exonic
1065363956 10:24916839-24916861 GTGAATGGGCTATGCAATTTAGG + Intronic
1068839372 10:61592823-61592845 GTAAATGCATTAGGCTATTTTGG + Intergenic
1071057946 10:81532358-81532380 GTTAATGAGTTAGGAAAATTGGG - Intergenic
1075739241 10:124683763-124683785 GTTTATGGGTCAGGCAAGATGGG + Intronic
1077833299 11:5899618-5899640 GTTATTGGGTTAGTCAGATTCGG - Intronic
1079193411 11:18302030-18302052 GTTATTGGGTTTGGCAGTTTGGG - Intronic
1080033960 11:27691952-27691974 GTTAATTTCTTAAGCAATTTGGG + Intronic
1081419192 11:42852806-42852828 GTTAATTGGTAAGTCAGTTTAGG + Intergenic
1086848058 11:91776285-91776307 GTTAATGTGTTAGGCAAAAATGG + Intergenic
1089973217 11:122711021-122711043 GTCAATGGGTTAGGAAGTGTGGG + Intronic
1091268451 11:134288754-134288776 GTTAAAGAGTGAGGCTATTTGGG - Intronic
1091888356 12:4032448-4032470 GTTAATAGCTTAGGCACTCTTGG + Intergenic
1096329136 12:50693990-50694012 GTTGAGGGGTCATGCAATTTAGG - Intronic
1099943059 12:89213005-89213027 TTTCATGGGTTAGGAAATTGAGG + Intergenic
1104320437 12:127745739-127745761 GTTAATGGATTAAGCATGTTTGG + Intergenic
1110723389 13:78791058-78791080 GTTTTTGGCTTAGGCAATTGGGG - Intergenic
1119169006 14:72518584-72518606 GTTAATAGGTCAGGCAATGAAGG - Intronic
1124796469 15:32785825-32785847 GTTAATGGCTTTGGAAATATTGG + Intronic
1124970154 15:34480913-34480935 GTTCATGGGTTATGAAATTGAGG + Intergenic
1132189196 15:99835081-99835103 GTTCATGGGTTATGAAATTGAGG - Intergenic
1136542484 16:30935832-30935854 GTGAATGGGTTAGGGGACTTTGG + Intronic
1138224370 16:55279936-55279958 TTTCATGGGTGGGGCAATTTAGG - Intergenic
1141268091 16:82515036-82515058 TGAAATGGGTTAGGAAATTTAGG + Intergenic
1144481262 17:15631067-15631089 GTCAATGAGTTATGCAATTCTGG + Intronic
1144917051 17:18732664-18732686 GTCAATGAGTTATGCAATTCTGG - Intronic
1147162471 17:38576234-38576256 TTTCATGGGTTAGGGAGTTTGGG - Intronic
1147165815 17:38592732-38592754 TTTAATGTGTTAGGCAATGTGGG + Intronic
1147178821 17:38672794-38672816 TTTAATGGGTGAGGGAACTTGGG - Exonic
1157334772 18:46729691-46729713 GTTAATGGGTAAGATACTTTAGG - Intronic
928775879 2:34763004-34763026 GATAATGGGTGAGGCCATCTCGG - Intergenic
929361856 2:41101447-41101469 GTAAATTGGCTAGGCACTTTAGG - Intergenic
931114181 2:59146893-59146915 TTTAATGAGTTATACAATTTAGG + Intergenic
931254847 2:60561449-60561471 GTTATGGGGTTAGGCAATTATGG - Intergenic
937249803 2:120516210-120516232 GAAAATGAATTAGGCAATTTTGG - Intergenic
939908049 2:147942994-147943016 GTAAATGGGTTTTGAAATTTTGG - Intronic
943459461 2:188153501-188153523 GTAAATGTGTTAGGAAATTGAGG + Intergenic
1169732186 20:8798402-8798424 GTAATTGGCTTATGCAATTTTGG + Intronic
1169774036 20:9232278-9232300 CTTAATAAGTTTGGCAATTTGGG + Intronic
1172902911 20:38347879-38347901 TTTAATAGGTAAGGCAATTGAGG - Intronic
1174738887 20:52992705-52992727 GTTTATGTGTTTGGCAAGTTTGG - Intronic
1177000173 21:15602824-15602846 TTTAATGTATTATGCAATTTTGG - Intergenic
1177008246 21:15700187-15700209 GTTCATAGGTTAGACAATATAGG + Intergenic
1178033125 21:28551058-28551080 ATTAATGTCTTAGGCCATTTGGG + Intergenic
1180296080 22:10937350-10937372 GTTAATGTTTTAGGTAATCTTGG + Intergenic
1183054758 22:35298222-35298244 GTTACTGGGTTAGACAATAGTGG + Intergenic
1184424283 22:44400151-44400173 GTTAATGGGATGGGCAGTTAGGG - Intergenic
949676308 3:6457843-6457865 TTTACTGCATTAGGCAATTTTGG + Intergenic
950308815 3:11938162-11938184 GTTGAGGGGTTGGGAAATTTGGG - Intergenic
952148895 3:30564948-30564970 GTTAATTGGTTTGGTAAGTTAGG - Intergenic
954542656 3:51405060-51405082 GTTAGTGGATTAGCTAATTTTGG - Intronic
954946194 3:54426401-54426423 TTTAATGGGTTGGGATATTTTGG + Intronic
955262985 3:57413053-57413075 GTTAATGGATTAGTTAATTGTGG + Intronic
955608767 3:60734768-60734790 GTTAATGGGTAAGGTAAGTCTGG - Intronic
957410899 3:79838414-79838436 ATTAATGGATTAAGGAATTTTGG + Intergenic
957524018 3:81357090-81357112 ATTACTGAGTTAGCCAATTTTGG + Intergenic
961768204 3:129228734-129228756 TTTTATGGGTGAGGAAATTTAGG - Intergenic
963287400 3:143446462-143446484 GTAAATGGGTTAGGGCACTTCGG + Intronic
963916305 3:150861755-150861777 GTTAATGGGTTAGGGAACTGGGG + Intergenic
963967857 3:151393365-151393387 GTTAAAGGTTTAGTCAATTACGG + Intronic
964632939 3:158832639-158832661 GTTGATGGGTTGGGCAAGCTGGG + Intergenic
965820527 3:172680231-172680253 GGTAATGGGTGAGGCATCTTGGG + Intronic
972164330 4:36264321-36264343 GTTGAAGGAATAGGCAATTTAGG - Intergenic
980460890 4:133111036-133111058 GTTAATGGTATAGGAACTTTAGG - Intergenic
983052553 4:163065747-163065769 GTTACTGTGTTAGTCAGTTTGGG - Intergenic
984322342 4:178210263-178210285 GTAAATGGGTTTGGCACTATGGG - Intergenic
984504701 4:180602459-180602481 GTTAAAGGGATAGGAAATGTTGG + Intergenic
988407005 5:30836743-30836765 GTGAATGAGGTAGGAAATTTAGG + Intergenic
993653756 5:90553528-90553550 TTGAATGAGTTAGTCAATTTAGG + Intronic
996902784 5:128562562-128562584 TTTAATGTGATGGGCAATTTTGG + Intronic
999662576 5:153881128-153881150 GGTACTGGGTTTGGCCATTTAGG + Intergenic
1001144912 5:169175385-169175407 GTTAATGGGTTAGGCAATTTGGG + Intronic
1001548137 5:172583308-172583330 GTTAATGGGTAAGGAAGTTGGGG - Intergenic
1003163890 6:3659650-3659672 GTTAATGGGGTTGGAAAATTTGG - Intergenic
1004001528 6:11601177-11601199 GTGACTGGGATAGGCCATTTTGG - Intergenic
1010668792 6:78661347-78661369 TTTATTGGCTTTGGCAATTTAGG + Intergenic
1011986777 6:93457164-93457186 GTTGATGGCTCAGGAAATTTAGG - Intergenic
1012893197 6:104920187-104920209 GCTATTGTGTTAGGAAATTTTGG - Intergenic
1014238062 6:118983396-118983418 TTAAAAGGTTTAGGCAATTTTGG + Intronic
1014477318 6:121889510-121889532 CTCAATGGGTGAGGAAATTTTGG + Intergenic
1015734413 6:136382556-136382578 ATTGATGGTTTAGGCAAATTAGG + Intronic
1020719061 7:11718307-11718329 GTAGACAGGTTAGGCAATTTGGG - Intronic
1022831609 7:34073011-34073033 GTTAATCGATTAGGCGATTTTGG + Intronic
1030858438 7:114591223-114591245 CTTAATGAGTTAGATAATTTGGG - Intronic
1031144298 7:117980689-117980711 CTTAATGTGTTAGGGGATTTTGG + Intergenic
1037209202 8:16364591-16364613 ATTATTAGGTTAAGCAATTTTGG + Intronic
1043002243 8:74773177-74773199 GTTAATAATTAAGGCAATTTTGG - Intronic
1048193984 8:132316869-132316891 GTTTATGAGTTAGGAAATTTTGG + Intronic
1048272468 8:133040530-133040552 GTTAATGGATTGGGCATTTGCGG - Intronic
1048910506 8:139130288-139130310 GGGAATGGGTAAGACAATTTGGG - Intergenic
1050177330 9:2881888-2881910 GTTAATGAGTCAGGCACTGTGGG + Intergenic
1057414314 9:94847647-94847669 ATTAATGGGTTGGGAGATTTAGG + Intronic
1185861109 X:3580470-3580492 GTTAATGGCTGAGGCAGTGTGGG + Intergenic
1186393843 X:9188110-9188132 GTTAATGCTTTAGGCACCTTGGG - Intergenic
1187167670 X:16819938-16819960 GTGAATGAGTTAAGAAATTTGGG + Intronic
1188576305 X:31655081-31655103 ATAAATGGGTTAAGCAGTTTAGG - Intronic
1193678734 X:84489895-84489917 ATTAATGAGTAAAGCAATTTGGG + Intronic
1196006352 X:110841651-110841673 GCTAATGGGTATGGGAATTTTGG - Intergenic
1200803888 Y:7412216-7412238 GTTAATGGCTGAGGCAGTGTGGG - Intergenic