ID: 1001145432

View in Genome Browser
Species Human (GRCh38)
Location 5:169179880-169179902
Sequence CATGTGCTAGATGCAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001145427_1001145432 1 Left 1001145427 5:169179856-169179878 CCAGAGTGTGTAGCTAGTACCCA 0: 1
1: 0
2: 1
3: 10
4: 85
Right 1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG 0: 1
1: 0
2: 1
3: 27
4: 267
1001145426_1001145432 22 Left 1001145426 5:169179835-169179857 CCTTCTCTCATTTGCTCATTTCC 0: 1
1: 0
2: 8
3: 93
4: 707
Right 1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG 0: 1
1: 0
2: 1
3: 27
4: 267
1001145425_1001145432 29 Left 1001145425 5:169179828-169179850 CCAGGTTCCTTCTCTCATTTGCT 0: 1
1: 0
2: 2
3: 56
4: 495
Right 1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG 0: 1
1: 0
2: 1
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001145432 Original CRISPR CATGTGCTAGATGCAGTGGT AGG Intronic
900463287 1:2811431-2811453 CATGTGCTAGCTGCTGGGGCTGG - Intergenic
900568931 1:3348887-3348909 CATGTCCTAGAGTCCGTGGTGGG + Intronic
902457366 1:16544887-16544909 CTTGTTGTAGAGGCAGTGGTCGG - Intergenic
903937614 1:26907431-26907453 CCTGTACTAGATGCTGGGGTAGG - Intronic
904209530 1:28877588-28877610 CATGTGCCTTATGCAGTGCTTGG + Intergenic
904976893 1:34463503-34463525 CATGTGCTGGATTCTGTGGTGGG - Intergenic
905477557 1:38239560-38239582 CAGGAGCCAGATGCAGGGGTCGG - Intergenic
905769541 1:40628707-40628729 CCTGTGCCAGGTGCTGTGGTAGG - Intronic
908608073 1:65822686-65822708 CATGTGGTAGAAGCAGCGGAAGG - Intronic
909351863 1:74663087-74663109 CCTGAGCTAGATGCAGAGTTGGG - Intronic
910611586 1:89149430-89149452 CATCTGCTGGCTGTAGTGGTTGG + Exonic
910628310 1:89332058-89332080 CATCTGCTGGCTGTAGTGGTTGG - Intergenic
911238215 1:95435265-95435287 CATTTGCTTCATGCAGTGGCTGG + Intergenic
912635877 1:111292186-111292208 CATGTGCTAGGCCCAGTGCTAGG + Intronic
912856372 1:113171721-113171743 CATATGCTGGTGGCAGTGGTTGG - Intergenic
914332711 1:146687176-146687198 CATGTGCTAGGCACAGTGTTGGG + Intergenic
914699814 1:150121902-150121924 TATGTAATAGATGCAGTGGGGGG + Intronic
915333104 1:155125846-155125868 TATGTGCTAGATGCTGTGCCAGG + Intergenic
916783092 1:168057600-168057622 TATGTGCTAGATACTCTGGTGGG + Intronic
916785169 1:168081764-168081786 GATGTGCTAGGTGCTGTGTTAGG - Exonic
917957573 1:180116120-180116142 TATGTGCCAGATACTGTGGTTGG + Intergenic
918414496 1:184292440-184292462 CAAGTGGGAGTTGCAGTGGTGGG - Intergenic
919176478 1:194026005-194026027 CATGTGCTGGATTCTGTGTTGGG - Intergenic
919697463 1:200592656-200592678 AATGTGCTTAATGCAGTGTTTGG - Intronic
919820622 1:201469585-201469607 CATGGGCTTGATGCAGAGGCTGG - Intergenic
920084678 1:203406616-203406638 CATGTGTCAGATGCTGAGGTTGG + Intergenic
920607046 1:207399034-207399056 CATGGGCTGGAGCCAGTGGTGGG + Intergenic
922193063 1:223336811-223336833 AATGTGCCAGATGCTGTGATAGG - Intronic
922354514 1:224763361-224763383 CATGTGCTACATCCTTTGGTAGG + Intergenic
923682380 1:236128559-236128581 CATGTTCTAGATGTAGGGCTAGG + Intergenic
924092176 1:240512944-240512966 TATGTGCCAGGTGCAGTGGTGGG + Intronic
924357046 1:243190143-243190165 CAAGTACTAGATGAAGTGTTAGG + Intronic
1063307018 10:4911840-4911862 CATGTGCTACATCCATTGATAGG - Intergenic
1064970892 10:21065799-21065821 GATGTGCCAGATGGAGTGATAGG - Intronic
1065971154 10:30806862-30806884 CCTGTGTTGGATGCAATGGTTGG - Intergenic
1066482393 10:35809517-35809539 CATGAGCTAGATGCAGGTGGTGG - Intergenic
1066483625 10:35822735-35822757 CATGTGTCAGATGCTGTGCTGGG + Intergenic
1067583288 10:47459244-47459266 CAGGTGTTAGAGGCGGTGGTGGG - Intergenic
1068513069 10:57990736-57990758 CATCTGCTAGCTCCAGTGTTCGG + Intergenic
1069206240 10:65690540-65690562 CCAGTGCTAGCTGGAGTGGTTGG - Intergenic
1069485901 10:68823143-68823165 AATTAGCCAGATGCAGTGGTGGG + Intergenic
1070805524 10:79268573-79268595 CATGTGCTAAACGCCGTGCTGGG + Intronic
1070998605 10:80809109-80809131 AAGGAGTTAGATGCAGTGGTAGG - Intergenic
1071456200 10:85853286-85853308 CATTGGCTAGAAGCAGTGGAGGG - Intronic
1072187460 10:93054253-93054275 CACGTGCTAGATACTGTGCTAGG - Intronic
1074067613 10:110031328-110031350 CATGTGCAAGGTACAGTGCTAGG + Intronic
1074142531 10:110686580-110686602 CCTAGGCTGGATGCAGTGGTGGG - Intronic
1076607406 10:131697960-131697982 CATGTGGTCGAGGCAGTGGTGGG - Intergenic
1077883980 11:6372261-6372283 CATGTGCAAGGTGCTGTGGTGGG - Intergenic
1078592092 11:12650343-12650365 AATGTGCATTATGCAGTGGTTGG + Intergenic
1079377995 11:19911154-19911176 CATGTGCCAGATGCTGTGCTTGG + Intronic
1079640205 11:22795623-22795645 CATTTGAAGGATGCAGTGGTAGG + Intronic
1081125850 11:39320278-39320300 AATTTGCCAGGTGCAGTGGTGGG - Intergenic
1081568725 11:44276440-44276462 CATCTGCCAGACGCAGTGGCTGG - Intronic
1083140618 11:60718316-60718338 CCTGTGCTGGCTGCTGTGGTGGG + Intergenic
1084290639 11:68163869-68163891 CCTGTCCTAGATGCAGAGGCTGG - Intronic
1084903587 11:72328719-72328741 CATGTGGTAGGTTCAGTGGCAGG - Intronic
1086216234 11:84384941-84384963 CATGTGCCAGGTGCAGGGGTTGG + Intronic
1086367877 11:86126131-86126153 CATGTGCCAAATGCAGTGAGCGG + Intergenic
1087577301 11:100005129-100005151 TATGTGCCAGGTGCTGTGGTAGG - Intronic
1087586629 11:100130308-100130330 CATGTGCTAGACGCTATGTTAGG + Intronic
1088801599 11:113312250-113312272 AGTGTGCTAGATGCAGCGGAAGG - Intergenic
1089125671 11:116174806-116174828 CATGTGCTGGAAGCTGTGCTGGG - Intergenic
1090430695 11:126643956-126643978 TATGTGCTAGATGGAGAGTTAGG + Intronic
1090966221 11:131599697-131599719 CATGTGACAGATGCTGTGATAGG + Intronic
1091873897 12:3917884-3917906 CATATGCTAGATGCTGTGCTTGG - Intergenic
1092736490 12:11587803-11587825 CCTGGGCTAGATGGAGTGGATGG - Intergenic
1095325723 12:40889536-40889558 CATGTGATAGGTGTTGTGGTAGG + Intronic
1096099579 12:48961522-48961544 CATGTGCTAGGAGCAGGGATAGG + Intergenic
1096633603 12:52945087-52945109 TATGTGCCAGATGCAGGGCTGGG + Intronic
1096680700 12:53253370-53253392 CATGTGCTGGCTGTAGTGGCAGG + Exonic
1096997538 12:55848182-55848204 TGTGTGCAAGCTGCAGTGGTGGG - Intergenic
1098869855 12:75804483-75804505 CATGTGCCAGATACTGTGTTAGG - Intergenic
1099355768 12:81633354-81633376 CATGTGCTAGGTACAGGGTTGGG + Intronic
1100269647 12:93012468-93012490 AATTAGCCAGATGCAGTGGTGGG + Intergenic
1100348800 12:93758631-93758653 CATGTTTTAAATGCAGTGGAAGG + Intronic
1101438817 12:104687456-104687478 CATCTACTTAATGCAGTGGTTGG - Intronic
1101910799 12:108858844-108858866 CTTGTGCAACATGCAGAGGTTGG - Intergenic
1102120493 12:110437239-110437261 TATCTGCTGAATGCAGTGGTAGG + Intronic
1102553085 12:113706370-113706392 AATGAGCCAGGTGCAGTGGTGGG + Intergenic
1103156333 12:118688259-118688281 CCTGTCCTAGAGGCAGAGGTTGG + Intergenic
1105570681 13:21600455-21600477 AATGTGATAAATGCTGTGGTAGG - Intronic
1106291158 13:28363760-28363782 AATTAGCCAGATGCAGTGGTGGG - Intronic
1107190675 13:37581277-37581299 CATGTGCCAGATTCAGTTCTAGG + Intronic
1107394034 13:39996747-39996769 TACTTGCTGGATGCAGTGGTGGG - Intergenic
1110629737 13:77694580-77694602 CATGTGCTAGACACTGTGCTAGG + Intergenic
1111294901 13:86265673-86265695 AATGGGCCAGGTGCAGTGGTGGG - Intergenic
1112283201 13:98080754-98080776 AATGTGCTAGGTGCAGTGATGGG + Intergenic
1112351627 13:98639738-98639760 TGTTAGCTAGATGCAGTGGTGGG + Intergenic
1115521393 14:34236208-34236230 CATGAGCTATATGCAGTCTTGGG - Intronic
1115924843 14:38420680-38420702 AATGTGATAGATGCAGGGGTTGG + Intergenic
1116424595 14:44775270-44775292 CCTCTACTAGATGCTGTGGTGGG + Intergenic
1117442495 14:55773261-55773283 CATGTGCTAGAACCAGTGCTGGG - Intergenic
1118701553 14:68438618-68438640 GATGTGCTATAAACAGTGGTGGG - Intronic
1120589139 14:86354766-86354788 CATGTGCTAGATTTACTTGTAGG - Intergenic
1121048225 14:90803298-90803320 TATGTTCTAGCTGCAGTGCTTGG + Intronic
1125545243 15:40498550-40498572 CATGCTGGAGATGCAGTGGTAGG - Intergenic
1125608421 15:40955439-40955461 AATGTGCGAGAGGCAGTGCTTGG + Exonic
1127538522 15:59914149-59914171 CATGTGTTAGATTCTTTGGTGGG + Intergenic
1127976025 15:63997952-63997974 CATGTGCTGGATGCCATTGTGGG - Intronic
1128240966 15:66100729-66100751 TATGTGCCAGATGCTGTGCTGGG + Intronic
1128466585 15:67917816-67917838 CATGGGCGGGATGCAGAGGTGGG + Intergenic
1129604352 15:77017558-77017580 CATGTGCCAGATGCTGCGCTGGG - Intronic
1130358650 15:83159494-83159516 CATGTTCTAGTGGCAGGGGTGGG + Intronic
1133440675 16:5818485-5818507 CATGTGCCAGATACTGTGCTAGG + Intergenic
1134566711 16:15257908-15257930 CATATGCTAGACACAGTGCTGGG - Intergenic
1134735782 16:16498791-16498813 CATATGCTAGACACAGTGCTGGG + Intergenic
1134931743 16:18213431-18213453 CATATGCTAGACACAGTGCTGGG - Intergenic
1135015114 16:18918695-18918717 AATTAGCTGGATGCAGTGGTGGG - Intronic
1135123848 16:19790067-19790089 AATGGGCCAGGTGCAGTGGTGGG + Intronic
1135625113 16:23988155-23988177 CAGGTGCCAGATGAAGTAGTTGG - Intronic
1136332211 16:29587640-29587662 AATTAGCTGGATGCAGTGGTGGG - Intergenic
1136446908 16:30327709-30327731 AATTAGCTGGATGCAGTGGTGGG - Intergenic
1138743498 16:59336971-59336993 TATGTGCTAGATGCTGTGCTTGG + Intergenic
1140000903 16:71024065-71024087 CATGTGCTAGGCACAGTGTTGGG - Intronic
1142245986 16:88970242-88970264 GATGTGCTTGATCCAGGGGTCGG + Intronic
1142873715 17:2838165-2838187 AATTAGCTGGATGCAGTGGTGGG - Intronic
1144711939 17:17406952-17406974 CATGAGCCAGATGCGGTGGTTGG - Intergenic
1145970521 17:28953752-28953774 CTTGTGCTAGAGCCAGGGGTAGG + Intronic
1147454111 17:40524466-40524488 GATGTGCTAGGTGCAATGGAGGG + Intergenic
1148937158 17:51172596-51172618 CCTGGGCTAGATGCAGTGAGTGG + Intergenic
1151029971 17:70725490-70725512 AATGTGCTACATGAATTGGTTGG - Intergenic
1153160493 18:2199398-2199420 CATGTGCTGGATGCTGTTCTGGG - Intergenic
1155478156 18:26256109-26256131 CATGTGGTAGATGCAAGGGCTGG - Intronic
1155841367 18:30647875-30647897 CATGTGCCAGGTGTAGGGGTAGG - Intergenic
1156697890 18:39789609-39789631 CATGGGCTAGATGCCATGGAGGG + Intergenic
1156847338 18:41681809-41681831 AATGTGCTAACTGCTGTGGTAGG - Intergenic
1158730462 18:60017193-60017215 CATGTGGTAGATGCAAGGGTTGG - Intergenic
1162239472 19:9337684-9337706 CATGTGCCAGAAACAGTGGTAGG - Intronic
1162275279 19:9648814-9648836 CATGAGCTAGGTGCAGTTCTAGG + Intronic
1164784070 19:30915641-30915663 TGTGTGATAGATGCAGTGGTAGG + Intergenic
1165081471 19:33309505-33309527 CAAATGCTAGATGCAGAGTTTGG - Intergenic
1165824465 19:38697982-38698004 CATGTGCGAGCTCCAGGGGTTGG - Intronic
1166221221 19:41365857-41365879 CATTAGCTAGATATAGTGGTGGG - Intronic
1167461537 19:49627080-49627102 AATTTGCTGGATGTAGTGGTAGG - Intergenic
925132271 2:1502536-1502558 AATGAGCTGGGTGCAGTGGTGGG - Intronic
925358903 2:3263488-3263510 TATGTGCTATTTGTAGTGGTGGG - Intronic
927965313 2:27264373-27264395 CACGTGCCAGATACAGTGGTTGG + Intronic
928320962 2:30282508-30282530 CATGTGTTAGATGCAGTGCCAGG + Intronic
928521518 2:32093682-32093704 CATGTGCTAGACACTGTTGTAGG - Intronic
929092329 2:38231486-38231508 TATGTGCTAGCTGCTGTGCTTGG - Intergenic
929759594 2:44796159-44796181 TATGTGCCAGATGCTGTGGGAGG + Intergenic
930263981 2:49178252-49178274 CATATGCTAAATGCATTTGTAGG + Intergenic
930300284 2:49607040-49607062 TATGTGCCAGATGCTGTGCTAGG - Intergenic
930727073 2:54692877-54692899 CTCCTGCTGGATGCAGTGGTGGG + Intergenic
931263738 2:60642093-60642115 CATGGGCCAGGTGCAGTGGGAGG + Intergenic
932544610 2:72694842-72694864 CATTTGGCAGATGCAGTTGTGGG + Intronic
932891779 2:75603465-75603487 CATGAGCCAGCTGCAGTGGTGGG - Intergenic
933774647 2:85764803-85764825 CCTGTGCTAGGGGCAGTGGAAGG + Intronic
934557473 2:95294969-95294991 CAGGTGCTAGCTGCAGTGGGAGG + Intergenic
934578031 2:95415237-95415259 CCTGTCCTACATGCAGTGCTTGG - Exonic
934601407 2:95661465-95661487 CCTGTCCTACATGCAGTGCTTGG + Intergenic
935565790 2:104605818-104605840 AATTAGCCAGATGCAGTGGTGGG + Intergenic
936518318 2:113196462-113196484 CATGTGCTGGATGCTGTGTGAGG + Intronic
937473867 2:122196886-122196908 CACGTGCCAGATACTGTGGTAGG - Intergenic
938053421 2:128195734-128195756 CTTCTGCTAGATGAAGGGGTTGG - Intergenic
938373182 2:130786729-130786751 AATTAGCTAGGTGCAGTGGTGGG + Intergenic
939290636 2:140190423-140190445 TATGTGCCAGGTGCAGTGTTAGG - Intergenic
940550565 2:155150804-155150826 AATTAGCTGGATGCAGTGGTGGG - Intergenic
941166025 2:162083890-162083912 CATGGGCTAGATGTGGTGGCAGG + Intergenic
941310571 2:163925469-163925491 AATTAGCTGGATGCAGTGGTGGG - Intergenic
943712252 2:191110061-191110083 CCTGTGGAAGGTGCAGTGGTTGG - Intronic
945568870 2:211439043-211439065 CATGTAGGAGATGCTGTGGTGGG + Intronic
945833418 2:214811339-214811361 CATGTGGCACATGCAGTGCTTGG + Intergenic
946845821 2:223858150-223858172 TATGTGCTAGGTGCTGTGCTAGG + Intronic
948209904 2:236185251-236185273 CAGCTGCTGGATGCAGTTGTGGG + Intergenic
948706892 2:239800212-239800234 CATGTTCTAGATGAAGAGGTTGG - Exonic
949074845 2:242048118-242048140 CATATGCTGGATCCACTGGTTGG - Intergenic
1170034261 20:11973429-11973451 CATGAGCTAGATGCTGTGCTGGG - Intergenic
1171097823 20:22349054-22349076 CCTGTGCTAGATGCATTTCTAGG - Intergenic
1174096900 20:48096882-48096904 AATGAGCCAGGTGCAGTGGTGGG + Intergenic
1174206214 20:48841236-48841258 CATATGCTAGATTCAGGGGAAGG + Intergenic
1175302749 20:57954383-57954405 CATGGGCAAGATGCAGTGGGAGG + Intergenic
1177817783 21:25996963-25996985 CAAGGGCTAGGTGCAGTGGAAGG - Intronic
1177827210 21:26097189-26097211 CAAGTGGAGGATGCAGTGGTAGG - Intronic
1178193433 21:30314471-30314493 CTTGTGCTATATTCAGTAGTAGG + Intergenic
1178214116 21:30574195-30574217 TATGTGCCAGATGCTTTGGTAGG - Intergenic
1179643926 21:42763991-42764013 CATGTGCCAGAGGCAGAGGTGGG + Intronic
1182851615 22:33479301-33479323 CAGGTGCCAGATGCTGTGCTAGG - Intronic
1182924470 22:34109338-34109360 CATCTGCTAGATGCCAGGGTTGG + Intergenic
1183358919 22:37373408-37373430 CCGGTGCTCGCTGCAGTGGTAGG + Exonic
1185184275 22:49383333-49383355 AATTAGCTGGATGCAGTGGTGGG + Intergenic
950053729 3:10010014-10010036 CATGTGATGGGTGCAGGGGTGGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
954952940 3:54490918-54490940 CCTGTGCTGGATGCCGTGATAGG + Intronic
955140340 3:56262285-56262307 CATGTGCCAGACACAGTGGTGGG - Intronic
956152892 3:66261718-66261740 CATGTGCCAGTTGCAGTTCTGGG + Intronic
959824342 3:110775400-110775422 CATTTGCTAGATGCATCTGTAGG + Intergenic
960788618 3:121401298-121401320 CAAGTGCTAGTTGCAATAGTAGG - Intronic
961402307 3:126655972-126655994 CATGTGCCAGATACTGTGCTGGG + Intergenic
961785177 3:129343267-129343289 CATGTGATGGGTGCAGGGGTGGG - Intergenic
962990625 3:140574069-140574091 CATGGGCCAGGTGCAGTGCTAGG - Exonic
964662636 3:159137111-159137133 AATTAGCTGGATGCAGTGGTGGG + Intronic
966330584 3:178807809-178807831 CATGTGCCAGGTACAGTGCTAGG - Intronic
967588820 3:191247685-191247707 TATGTGCCAGATGCTGTGCTTGG - Intronic
967884369 3:194323107-194323129 CTTGTGCTGGAGGCAGGGGTTGG - Intergenic
968235328 3:197027759-197027781 GATGAGCTGGACGCAGTGGTCGG + Exonic
968841240 4:3007434-3007456 CATGTGCAAGACACAGTGGAAGG - Intronic
969166915 4:5323748-5323770 TATGTGCTAAATGCAGGGGATGG + Intronic
969323076 4:6424733-6424755 CGTGTGGGAGATGCAGGGGTGGG + Intronic
969997786 4:11332097-11332119 TCTGTGCTAGGTGCAGGGGTTGG + Intergenic
970553433 4:17207592-17207614 CATGTGCCAGATACTGTGCTGGG - Intergenic
970650236 4:18169848-18169870 CCTGGGCTAGATACTGTGGTTGG - Intergenic
971955933 4:33418318-33418340 TGTGTGCTAGATACAGTGCTAGG + Intergenic
972572439 4:40322833-40322855 CATGTCCAAGTTGCAGTGCTGGG - Intergenic
974131723 4:57764874-57764896 AATTTGCTAGATTCAGTGGCTGG + Intergenic
974744382 4:66051841-66051863 CATGTGTTTGAAGAAGTGGTAGG - Intergenic
977051162 4:92129632-92129654 CATGTGCAAGTGCCAGTGGTGGG - Intergenic
979244770 4:118489456-118489478 CAAGTACTAGATGAAGTGTTAGG - Intergenic
981538050 4:145820947-145820969 AATCTGCTAAATGCAGTGCTGGG - Intronic
982925041 4:161326210-161326232 CATATGCTAAATTCAGTGGCAGG - Intergenic
983629592 4:169836570-169836592 CATGTGCTGGAGGCTGAGGTGGG + Intergenic
984616745 4:181907025-181907047 CATGTGCTGGGTGTGGTGGTGGG - Intergenic
984895508 4:184536175-184536197 TGTGTGCTAGATGCTGTGCTGGG + Intergenic
984929692 4:184835680-184835702 TATGTGCTAGCCACAGTGGTAGG + Intergenic
985531745 5:437662-437684 CAGGTGCCAGATTGAGTGGTGGG + Exonic
987934294 5:24443918-24443940 AATGTGCAAGAGGCAGTGGAAGG + Intergenic
988694971 5:33612767-33612789 GAAATGCTAGAGGCAGTGGTAGG + Intronic
989589347 5:43099010-43099032 CATATGCCAGATGCGGTGATGGG + Intronic
990118290 5:52416217-52416239 CATTTTCTGAATGCAGTGGTTGG - Intergenic
992103871 5:73434230-73434252 CATTTTCAAGATGCAGTTGTGGG - Intergenic
992384517 5:76270915-76270937 AATTAGCTGGATGCAGTGGTTGG - Intronic
992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG + Intronic
993259960 5:85645444-85645466 CATCTGCTAGATCCAGGGGATGG - Intergenic
993932398 5:93955850-93955872 CATGCCCAAGAGGCAGTGGTAGG - Intronic
995701022 5:114935425-114935447 TATGTGCTAGATACAGTACTTGG - Intergenic
998929726 5:147167869-147167891 CATGTGCTTGATACTGTGTTAGG - Intergenic
999613774 5:153400112-153400134 CAAGTGATAGCTGCAGAGGTGGG - Intergenic
1000168729 5:158680585-158680607 CATGTGCTAGTGGCAGTGCATGG - Intergenic
1000174912 5:158742505-158742527 CATGTGCTAGAAACAGGGGCAGG + Intronic
1000989937 5:167901251-167901273 CATGTGCTAGGAACCGTGGTAGG - Intronic
1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG + Intronic
1002097317 5:176839204-176839226 CATGTGCTAGGTGCTGTGAGGGG - Intronic
1003488618 6:6601232-6601254 CATTTGGGAGAAGCAGTGGTAGG + Intronic
1003741654 6:8947186-8947208 CATGGGCTAGAGGCATTGGCAGG + Intergenic
1006903971 6:37520971-37520993 AGGGTGCTAGAGGCAGTGGTGGG - Intergenic
1008544261 6:52571893-52571915 CATGTGCCAGGTACAGTGCTGGG + Intronic
1009283645 6:61783444-61783466 TACATGCTAGATGCAGTGCTAGG - Intronic
1009831027 6:68935201-68935223 CCTGTGCTTGATGAAGTAGTTGG - Intronic
1015189257 6:130455451-130455473 TATGTGTAAGATGAAGTGGTGGG + Intergenic
1016804675 6:148201231-148201253 CATGTGCTAGAAACTGTGCTAGG + Intergenic
1018752910 6:166822638-166822660 CATGAGCTGGATGGGGTGGTGGG - Intronic
1020675218 7:11175481-11175503 CATGTGAAAGAAGCAGTTGTAGG - Intergenic
1020714341 7:11650972-11650994 AATGTGCTAGGTGCTGTGATAGG + Intronic
1021865068 7:24947825-24947847 CATGTGCCAGATTCTGTGATCGG + Intronic
1022141460 7:27496609-27496631 CATGTGGTAGATTGAGTTGTAGG - Intergenic
1022839643 7:34150906-34150928 CATGTTGTAAATGCAGTGATGGG + Intronic
1023119591 7:36895855-36895877 TATGTGCCAGATGCTGTGGTAGG + Intronic
1023951721 7:44851242-44851264 TATGTGCTAGGTACAGTGCTAGG - Intergenic
1023998238 7:45175009-45175031 CCTGTGCTACATGCAGGGATGGG + Intronic
1026420617 7:70233236-70233258 CATGTGTTGGATGACGTGGTAGG - Intronic
1029571249 7:101371087-101371109 CATTTCCAAGAGGCAGTGGTGGG - Intronic
1033160573 7:138992598-138992620 CATGTGGTAAATGCAGTGACAGG - Intergenic
1033347028 7:140533553-140533575 CCGGTGCTAGATGCAGAGGCTGG + Intronic
1034011906 7:147537891-147537913 CATGTGCTACATGCATTTTTAGG - Intronic
1038752940 8:30313750-30313772 GATGTGCCAGATACAGTGCTAGG - Intergenic
1042351889 8:67785755-67785777 TCTGTGCTAGATGCTGTGGTTGG + Intergenic
1044945726 8:97387116-97387138 CATGTGAGAGAGACAGTGGTAGG + Intergenic
1046661410 8:116951540-116951562 CATGTGGTAGATGCTGTCATAGG - Intronic
1046661451 8:116951944-116951966 CATGTGGTAGATGCTGTCTTAGG + Intronic
1047228833 8:122978890-122978912 TTTGTGCCAGATGCAGTGCTAGG - Intergenic
1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG + Intergenic
1047450381 8:124960311-124960333 CATGTGCAAGAAACAATGGTAGG + Intergenic
1050413335 9:5388865-5388887 TATGTGCCAGATGCTGTTGTAGG - Intronic
1052148795 9:25085882-25085904 CATGTGCAAAATGCACTGTTAGG + Intergenic
1052784779 9:32818337-32818359 CATGGGGCAGATGCAGTGGACGG - Intergenic
1053151064 9:35743397-35743419 CATGTGCTAGACACTGTGCTAGG - Intronic
1055641498 9:78321984-78322006 AAAGTGCTAGAAACAGTGGTTGG + Intronic
1056233116 9:84566974-84566996 CACGTTCTAGATGAGGTGGTTGG + Intergenic
1059276335 9:113100388-113100410 CATGTGCTTGATACAGTCCTGGG + Intergenic
1059308912 9:113375218-113375240 AATGTGCAAGAAGCAGAGGTAGG + Intronic
1060070863 9:120546190-120546212 CATGTGGTGGATGCAGCAGTGGG + Intronic
1061119265 9:128633228-128633250 CATGTGGGAGACGCAGTAGTCGG - Exonic
1062097414 9:134710505-134710527 CATTTGTTGGGTGCAGTGGTGGG + Intronic
1062097426 9:134710538-134710560 CATTTGTTGGGTGCAGTGGTGGG + Intronic
1062097438 9:134710568-134710590 CATTTGTTGGGTGCAGTGGTGGG + Intronic
1062097449 9:134710597-134710619 CATTTGTTGGGTGCAGTGGTGGG + Intronic
1062097462 9:134710630-134710652 CATTTGTTGGGTGCAGTGGTGGG + Intronic
1062097534 9:134710826-134710848 CATCTGTTGGGTGCAGTGGTGGG + Intronic
1062289605 9:135788634-135788656 CCTGGGCTGGATGCAGGGGTGGG + Intronic
1062295915 9:135826464-135826486 CTTGTGATACAGGCAGTGGTGGG - Intronic
1187128218 X:16474468-16474490 CATGTGGTAGATGCAGGTGGAGG + Intergenic
1187985794 X:24809126-24809148 CATGTGCTAGATGCTGTGCAAGG - Intronic
1188305010 X:28550945-28550967 CATGTGCTGGATATAGTGTTAGG - Intergenic
1190366974 X:49704363-49704385 TATGTGCCAGATCCAGTGCTAGG + Intergenic
1192256684 X:69467092-69467114 CATGTGCCAGGTGCTATGGTTGG + Intergenic
1193822981 X:86188942-86188964 CATGTGCTAGATGCTGTGGAGGG - Intronic
1194463828 X:94206924-94206946 CATGGGAGAGATGCAGTGGGAGG + Intergenic
1195293508 X:103452126-103452148 AATGAGCCAGGTGCAGTGGTGGG - Intergenic
1197232447 X:124019482-124019504 CATGTGCCAAATGTAGTGCTGGG - Intronic
1197304238 X:124820980-124821002 CTTGTGGTAGATGCTGTGGAGGG - Intronic
1198318899 X:135498812-135498834 CCTGTTCTAGATGATGTGGTGGG + Intergenic
1198812415 X:140549153-140549175 CATGTGCCAGGTGCTGTGTTAGG - Intergenic
1199944513 X:152654561-152654583 CAGGTGCTAGAGGATGTGGTGGG - Exonic
1201233428 Y:11888100-11888122 CATTAGCTAGGTGTAGTGGTGGG + Intergenic
1201390183 Y:13489653-13489675 CATGTGCTATATACAGTCTTGGG - Intergenic