ID: 1001145917

View in Genome Browser
Species Human (GRCh38)
Location 5:169184578-169184600
Sequence ACACACAACAAAATCACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 2, 2: 13, 3: 44, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001145917 Original CRISPR ACACACAACAAAATCACCTA GGG Intronic
901816606 1:11797282-11797304 AAACAAAACAAACTCACCTATGG - Intronic
903435951 1:23349332-23349354 ACAAACAAACAAATAACCTAGGG + Intergenic
904015058 1:27413347-27413369 ACCCAGAACAAATTCACCCAAGG - Intronic
904191587 1:28748360-28748382 ACACACAAACACTTCACCTAAGG - Intronic
904833788 1:33322069-33322091 ACACACAACAAACTCAGGTGGGG + Intergenic
905984466 1:42266470-42266492 ACACACAACTAAATCACCTTTGG + Intronic
906092616 1:43194931-43194953 ACAGGCAACAAAATTCCCTACGG - Intronic
907665139 1:56427892-56427914 ACACAGGCCAATATCACCTATGG + Intergenic
908156713 1:61360821-61360843 ACACAAAACAAAAACACCTCAGG + Intronic
909010657 1:70331114-70331136 AAACACAACAAAATTTCCCAGGG - Intronic
909600415 1:77455832-77455854 ACACACATTACAATCACCTGGGG - Intronic
910120363 1:83781830-83781852 ACACAAAGCAAAATCAGCAAAGG + Intergenic
910477461 1:87622358-87622380 GAACTCAACACAATCACCTAAGG - Intergenic
912207011 1:107519746-107519768 GCACACAACAAAAATACGTATGG - Intergenic
912208938 1:107537638-107537660 AAACACATCAGAATCACCTGGGG - Intergenic
912240162 1:107898227-107898249 ACACACAACAAATTTAACAATGG + Intronic
912772331 1:112476177-112476199 ACACACTACCAAATAACCCATGG + Intronic
912785223 1:112596330-112596352 ACCCACCACAAAATCACTGAAGG - Intronic
913277373 1:117152146-117152168 ACACACACAAAAGTAACCTATGG - Intronic
914914745 1:151812617-151812639 GCACACATCAGAATCACCTGGGG - Intronic
916298539 1:163247731-163247753 AGATACAACAAAATCACTGAGGG - Intronic
917045202 1:170852028-170852050 AAACACCACAAAATAACATAAGG + Intergenic
917757226 1:178114309-178114331 ACAAACAACAAAAAAACCTAAGG - Intronic
917780854 1:178395130-178395152 CCATACATGAAAATCACCTAAGG + Intronic
918290844 1:183106594-183106616 CTGCACAACAAAATCACCTTTGG - Intronic
918500760 1:185193145-185193167 ACAAACATCTAAATAACCTATGG - Intronic
918573157 1:186022791-186022813 ACACAAAATAAAATAACATAAGG - Intronic
918900467 1:190409894-190409916 AGAGAGGACAAAATCACCTAAGG + Intronic
919581100 1:199374150-199374172 ACACACTTCTAAATAACCTATGG + Intergenic
921232392 1:213086270-213086292 ACTGACAACAAAATTTCCTAGGG - Intronic
921959311 1:221017971-221017993 AAACACAACAAAATCTGCTTAGG - Intergenic
922122819 1:222690135-222690157 TCACACAACAAAATCACCTAAGG + Intronic
923719339 1:236453774-236453796 TCACACAACGAAATCACCTAAGG + Intronic
924349829 1:243104134-243104156 AAACAAAACAAAAACACCTTGGG + Intergenic
1063283454 10:4657368-4657390 CATAACAACAAAATCACCTATGG - Intergenic
1064348957 10:14559071-14559093 TCACACATCAAAATCACCTGTGG + Intronic
1064497691 10:15931182-15931204 ACACACATCAAAATTACCAAGGG - Intergenic
1064767862 10:18693235-18693257 CACAACAACAAAATCACCTAAGG + Intergenic
1064787342 10:18912843-18912865 ACACAGAAGACAATCACTTATGG - Intergenic
1064967201 10:21027095-21027117 ACACAGAGCAAAATCAGCAAAGG - Intronic
1065345550 10:24744803-24744825 ACACACAATAAAAACTCCTGAGG + Intergenic
1066591792 10:37003195-37003217 ACTCAAAACAAAATCAACTATGG - Intergenic
1066637900 10:37524966-37524988 TCACACAAAAAAATCACCTAAGG - Intergenic
1068029979 10:51694270-51694292 ACACAGAACATAATTTCCTATGG - Intronic
1068208481 10:53889064-53889086 ACACACAAAAAAATCCCATATGG + Intronic
1068497218 10:57798078-57798100 GCACACAACAAAAGCACCATAGG + Intergenic
1069639594 10:69946095-69946117 AAAAAAAAAAAAATCACCTAGGG + Intronic
1069888975 10:71641299-71641321 ATACACAACAGAATCACCAGTGG - Intronic
1070333417 10:75433529-75433551 ACAAACAAAAAAACCACCTCCGG - Intronic
1072418548 10:95269893-95269915 AAACACAAAAAAATTAGCTAGGG - Intronic
1074224203 10:111467646-111467668 CTACACAACATAATCACCTAGGG + Intergenic
1075361506 10:121839796-121839818 ACACACAAAAAAATCACTTATGG + Intronic
1077989614 11:7392834-7392856 ACACACACAAAAAATACCTAGGG - Intronic
1078499086 11:11851452-11851474 ACAAACAAAAAAATAAACTAAGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1081468162 11:43344516-43344538 ACACAAAACAAAATTACAAAAGG - Intronic
1082748998 11:56997989-56998011 ACTCTCAACAAAATCACTCAGGG + Intergenic
1085091514 11:73719243-73719265 AAACAAAACAAAAAAACCTAAGG + Intronic
1085896486 11:80645834-80645856 ACTCAAAACAAAATCAACTATGG + Intergenic
1086074202 11:82832845-82832867 ACACAGAACAGACACACCTATGG + Intronic
1086400038 11:86453298-86453320 CCACACAACAAAAACAACTCTGG - Intronic
1086812145 11:91323086-91323108 ACAAACAAAAAAATCAACAAAGG + Intergenic
1087126826 11:94636523-94636545 ACACACACAAAAATCACCTAGGG - Intergenic
1087178816 11:95121633-95121655 ACAAACAAAAAAACTACCTATGG + Intronic
1087306052 11:96490241-96490263 ACACACTAAAAAATGACATATGG + Intronic
1087359531 11:97141031-97141053 AAACAAAACAAAAACACATAAGG - Intergenic
1090089559 11:123682950-123682972 ACACACAAGAAAATATCCTTTGG - Intergenic
1091073719 11:132593688-132593710 ACAGCCAACAGAATCACCTGTGG + Intronic
1091643669 12:2256824-2256846 ACACCCATCAGAATCACCTGTGG - Intronic
1091728184 12:2859710-2859732 ACGCACAAAAATATCACATACGG + Intronic
1093814295 12:23525958-23525980 ACAAACCACAAAATCTCTTAGGG + Intergenic
1094233347 12:28134537-28134559 ACACACAATAAAAGCACTTTTGG + Intronic
1095179109 12:39126733-39126755 ACACACAAAAATATCACGTGTGG + Intergenic
1097357022 12:58613349-58613371 ACAAACAACTATATGACCTAGGG - Intronic
1097585685 12:61513293-61513315 AACCAAAACAAAATCACATAGGG + Intergenic
1097731932 12:63138227-63138249 ACACAAAACAAAATTAACTAAGG - Intergenic
1097886203 12:64731933-64731955 ACAAACAAAAAAATCATTTACGG + Intronic
1098278827 12:68841555-68841577 ACACACAAAAAAATCCTTTATGG + Exonic
1099170664 12:79359947-79359969 AACCCCATCAAAATCACCTAGGG + Intronic
1100709995 12:97245497-97245519 CCACCCAACACAATCACCTGGGG - Intergenic
1100793499 12:98155892-98155914 ACACACACAAATATCACCAACGG + Intergenic
1101238902 12:102818339-102818361 AGACACGTCAAAATCACCCAAGG - Intergenic
1102982692 12:117254670-117254692 ATGCACATCAGAATCACCTAGGG - Intronic
1104484051 12:129134056-129134078 ACACACAACACAATACTCTATGG - Intronic
1104675923 12:130712380-130712402 ACAAACAAAAAAATCAAATAGGG - Intronic
1106679063 13:31991179-31991201 ACAGACAACGACATCACCTAGGG + Intergenic
1107994771 13:45849258-45849280 GCACACAAAAAAACCACTTATGG - Intronic
1108118074 13:47151995-47152017 GCACAAAACAAAATCAACAAAGG - Intergenic
1108242974 13:48486240-48486262 GCACACAACAGAATAATCTATGG - Intergenic
1108822280 13:54368105-54368127 ACACAGACCAAAATCAGCAAAGG - Intergenic
1108880066 13:55101893-55101915 ACATGCATCAGAATCACCTAGGG + Intergenic
1109332996 13:60954266-60954288 AGAAATAAGAAAATCACCTATGG - Intergenic
1110229183 13:73150940-73150962 ACAAACAACAAAAACAAATAAGG + Intergenic
1110588783 13:77228676-77228698 ACACACAACATATTCATCTTAGG - Intronic
1111315907 13:86559178-86559200 TCACACAGTGAAATCACCTAAGG + Intergenic
1111854380 13:93618866-93618888 ACACAAGACAAAATCACCTGAGG - Intronic
1112188354 13:97149952-97149974 ACACACCACAAAATCACCTGAGG + Intergenic
1112402623 13:99088610-99088632 AACAACAACAAAAGCACCTAAGG + Intergenic
1113668976 13:112162764-112162786 AAAGACAACAAAATAACCAAGGG + Intergenic
1114809083 14:25874637-25874659 ACACAGAACAATAGCATCTATGG + Intergenic
1115277524 14:31624512-31624534 CTACACATCAAAATCACCTCTGG - Intronic
1116110529 14:40574885-40574907 ACACCCAACAAAATCAGAAATGG + Intergenic
1116436576 14:44901284-44901306 ACACACTATGAAATCATCTAAGG + Intronic
1117484708 14:56182836-56182858 ACATCCTACAAAATCAGCTAGGG - Intronic
1119625429 14:76170548-76170570 ACAAATAACATAATCCCCTAAGG - Intronic
1120365754 14:83566231-83566253 CACAACAACAAAATCACCTAAGG + Intergenic
1124238457 15:28009846-28009868 ACACACATCTAAATAATCTATGG + Intronic
1125496481 15:40199256-40199278 ACACACAAGAAAATCAGTTTAGG - Intronic
1125799681 15:42434339-42434361 ACAAACAAAAAAAACACCTCTGG + Intronic
1126271119 15:46817975-46817997 ACACACAAAAAAATTAACCAGGG - Intergenic
1126642722 15:50843994-50844016 ACACAAAACAAAAAAACCTTAGG + Intergenic
1127944223 15:63733858-63733880 AAAAATAAAAAAATCACCTATGG + Intronic
1129155746 15:73716444-73716466 TCAATCTACAAAATCACCTAAGG - Intergenic
1130685475 15:86033383-86033405 ACACACAAAAAAATGATCTGTGG - Intergenic
1130901311 15:88208765-88208787 CTGCACATCAAAATCACCTAGGG + Intronic
1131341324 15:91604207-91604229 CCACACATCAAAGTCACATATGG - Intergenic
1131546764 15:93322196-93322218 ACACACAAGCAAAGCACCCAAGG - Intergenic
1132362010 15:101224166-101224188 TTATACAACAAAATCACCTGAGG + Intronic
1132422242 15:101680433-101680455 AAACAAAACAAAAACACCTAAGG + Intronic
1133079942 16:3310639-3310661 ACAAACAAAAAAAACAACTAGGG + Intronic
1134385914 16:13772268-13772290 TCCCACAACAAAATCACCTAGGG + Intergenic
1136510442 16:30735076-30735098 ACACATAATAAAATCACATTTGG - Intronic
1137981219 16:53071738-53071760 ACAGACAACAAAATCCCCGCAGG - Intronic
1138223683 16:55274650-55274672 ACAAGCATCAAAATCACCTGGGG - Intergenic
1139382139 16:66539293-66539315 ACACAAAACAAGATCAGCAAAGG + Intronic
1139415009 16:66801200-66801222 CCACACATCAAAGTCACCTGGGG + Intronic
1141244347 16:82292379-82292401 ATACACAGCAAAATCAGCAAAGG + Intergenic
1141971444 16:87486513-87486535 TCACACAACAAGATCAGCTGAGG + Intronic
1143276820 17:5717704-5717726 ACACAGAACACAATCACCAAGGG - Intergenic
1144744124 17:17601956-17601978 AAACAAAACAAAAACACCCATGG + Intergenic
1145744906 17:27310283-27310305 AGACACAACAAAATCTCCCAGGG - Intronic
1146475046 17:33156106-33156128 ATACACATCAAAATCACCTAGGG + Intronic
1147639574 17:41987510-41987532 ACACAAAATAAAATCTCCAAAGG + Intronic
1148377747 17:47164273-47164295 ACAAATGACAAAATCACCTAAGG + Intronic
1149834458 17:59900232-59900254 ATACACAACAAAAACACATAGGG - Intronic
1150206154 17:63409587-63409609 ACAAATGACAAAATCACCTAAGG - Intronic
1150840655 17:68602442-68602464 ACACACAGGAAAATTGCCTAAGG - Intergenic
1150996512 17:70324129-70324151 AAACAAAACAAAATCTCCAAAGG - Intergenic
1152291066 17:79440615-79440637 ATCCACAACTAAATCACCTCTGG + Intronic
1152872748 17:82766766-82766788 ATACACAGCAAAATCAGCAAAGG + Intronic
1153416670 18:4853318-4853340 ATATACTACAAAATAACCTATGG - Intergenic
1154999879 18:21675565-21675587 AAACAAAACAAAACCACCTCAGG - Intronic
1155933434 18:31729808-31729830 AAACAGAACAAAAGCAGCTATGG - Intergenic
1156061840 18:33087008-33087030 ACACACAACAAAATAGCCATTGG + Intronic
1157032667 18:43931580-43931602 ATACACAACAAAATCAGCAAGGG + Intergenic
1157266167 18:46224528-46224550 ACATACATTAAAATCACCTGGGG + Intronic
1157416266 18:47505735-47505757 ACACAAAGCAAAATCAGCAAAGG - Intergenic
1158129274 18:54134708-54134730 ACAAACAAAAAAATTAGCTAAGG + Intergenic
1160511895 18:79457504-79457526 ATACACGACAAAGTCACCCATGG + Intronic
1160955071 19:1687502-1687524 ACACACAAGAAAACCACGGAGGG + Intergenic
1161542569 19:4860981-4861003 ACATAAAATAAAATCACCTGAGG + Intronic
1163181509 19:15607477-15607499 CCACACAAATAAATCACTTAAGG + Intergenic
1164982374 19:32623912-32623934 ACACAGAACAACATCAGCAAAGG - Intronic
1165972562 19:39644530-39644552 ACCCACAAAAAAATCAGCCAGGG + Intergenic
1166953244 19:46444555-46444577 ACAAACAAAAAAAACACCAAAGG - Intergenic
925801727 2:7608510-7608532 ACACATAACTATATCAACTATGG + Intergenic
926612864 2:14963795-14963817 ACACAAAGCAAAATCATCAAGGG - Intergenic
926726489 2:16002411-16002433 TCCCAGAACAAAATCATCTAAGG + Intergenic
926771531 2:16381199-16381221 AAACACAAAAAAATTACATATGG - Intergenic
926940408 2:18130017-18130039 AGACAAAGCAAAATCAGCTATGG - Intronic
927064263 2:19454792-19454814 ATACAAAACAAAATCAGCAAAGG + Intergenic
928006742 2:27569171-27569193 ACACACAACAAAAGAATCTCTGG + Intergenic
929067148 2:37989581-37989603 TTACAAAACAAAATCAACTATGG + Exonic
929730410 2:44485503-44485525 TCGCACAACAAAATTGCCTAAGG - Intronic
929817610 2:45247488-45247510 AAACAAAACAAAATAATCTAGGG - Intergenic
930401838 2:50900009-50900031 ACACACAAAAAAATCCCTTTTGG - Intronic
930565383 2:53012668-53012690 ACAAACACCTAAAACACCTAGGG - Intergenic
931673768 2:64672888-64672910 ACAGGCCACTAAATCACCTAAGG + Intronic
932519305 2:72392627-72392649 ACACAAAACAAAATTTTCTAAGG - Intronic
933993410 2:87649888-87649910 AAACAAAACAAAAAAACCTAAGG + Intergenic
934319166 2:91956928-91956950 ACATTTAACACAATCACCTATGG - Intergenic
934984997 2:98878509-98878531 TCACACGATGAAATCACCTAAGG + Intronic
935562721 2:104575447-104575469 ACGGACATCAAAATCACCTGAGG + Intergenic
936280273 2:111133486-111133508 ACACACTTCTAAATAACCTAGGG - Intronic
936300449 2:111300995-111301017 AAACAAAACAAAAAAACCTAAGG - Intergenic
936672798 2:114678370-114678392 CCACAGAACAAAAACTCCTATGG - Intronic
937940496 2:127281790-127281812 ACAGAAAACAAAATCAGCTCAGG + Intronic
939551598 2:143622600-143622622 ATACACAACAAAATCAGCAGAGG - Intronic
939595356 2:144116270-144116292 ACACACATAAAAATCTCATATGG - Intronic
939724071 2:145692771-145692793 ACACACAGCAAAAACACAGATGG + Intergenic
939971660 2:148669106-148669128 ACACACTTCTAAATAACCTATGG - Intronic
940066024 2:149630586-149630608 TCAAACAATGAAATCACCTAAGG - Intergenic
940669930 2:156655083-156655105 CCACACATAAAAATCACCTGGGG - Intergenic
940804785 2:158174556-158174578 TCACACAACAAAATTGCCTAAGG - Intronic
941174670 2:162181695-162181717 ACAGACAACAAAATAAGCAATGG - Intronic
942027794 2:171927745-171927767 AAACACAAAAAAATTACCCAGGG - Intronic
942851855 2:180496345-180496367 ACACACATAAAAGTCACTTAAGG + Intergenic
945067688 2:205960929-205960951 GCACACAGCAGAATCACCGAGGG + Intergenic
947798984 2:232915335-232915357 ACACACAACAAACACTCCTAAGG - Intronic
947977922 2:234383922-234383944 AAACACAACAGAATTCCCTAGGG + Intergenic
1169093911 20:2879100-2879122 ACAGACATTAAAATCACCTATGG + Intronic
1169373201 20:5044359-5044381 GCACACAATGAAATTACCTAAGG - Intergenic
1170722518 20:18896276-18896298 AAACAAAACAAAATCAGCCAAGG + Intergenic
1171468789 20:25353237-25353259 ACAAACAAAAAAAACACCTATGG - Intronic
1172058631 20:32173118-32173140 ACAGACAACATGATCATCTATGG - Intergenic
1172184753 20:33024404-33024426 ACACAGAACAAGATGACCTAGGG + Intergenic
1172287506 20:33751373-33751395 ACACACAGCAAGATCAGCAAGGG + Intronic
1172549812 20:35790012-35790034 ACACAAAAAAAAATCAGCTGGGG - Intronic
1173524719 20:43722952-43722974 ACACACAAAAAAAGCACGTGAGG - Intergenic
1173623814 20:44456757-44456779 AAACAAAACAAAAGGACCTAAGG + Intronic
1173654034 20:44686765-44686787 ATACAAAACAAAATTAACTACGG - Intergenic
1174620350 20:51869578-51869600 GCACACAAAAAAATCAGCTGGGG + Intergenic
1174712062 20:52717313-52717335 AAACAAAACAAAATCAACCATGG + Intergenic
1174737270 20:52976394-52976416 ACACACAACACAAACCCCTGGGG - Intronic
1175361708 20:58416445-58416467 ACACACACCTCAACCACCTACGG - Intronic
1177308374 21:19352106-19352128 AAACACAGAAAAATCTCCTAAGG + Intergenic
1178271452 21:31193590-31193612 ACACAAAGCAAAATCAGCAAAGG - Intronic
1179374263 21:40835601-40835623 AATCACAATAAAATCACCAAAGG + Intronic
1181949442 22:26543460-26543482 ACACACAAAAAAATCAGCCAAGG - Intronic
1183456753 22:37927121-37927143 ACCCACAGCAAAACCACCTTGGG - Intronic
1184882032 22:47313118-47313140 ATACACATCAAAATAACCCATGG - Intergenic
949226541 3:1701318-1701340 ACAGACAACAAAATTAACTTAGG - Intergenic
949537751 3:5008891-5008913 AAACAAAACAAAATCAACAAAGG - Intergenic
949720205 3:6980389-6980411 ACAAAGAACAAATTCACCCATGG - Intronic
949887055 3:8703990-8704012 ACACACATCTCAATCACCTGAGG + Intronic
950384760 3:12649705-12649727 AAACACAAAAATATAACCTAGGG + Intronic
951671694 3:25190309-25190331 ACACGCAACAAAAACACTCAAGG + Intronic
951697692 3:25462862-25462884 AGACAGAACAAAAGCACATAAGG + Intronic
952263488 3:31763062-31763084 ACACACAGCAAACTCCTCTAGGG + Intronic
952503051 3:33981898-33981920 ACAAACAACCAAATCAACAAAGG - Intergenic
953465668 3:43117259-43117281 GCACACAACAAAATCCACTCTGG + Intergenic
953896457 3:46806937-46806959 ACAAACAACAAAATTCCCTATGG - Intronic
956608766 3:71100635-71100657 ACACACAATTTAATCACCAAAGG + Intronic
958623421 3:96593384-96593406 AGACAAAACAGAAACACCTAGGG - Intergenic
959015323 3:101127533-101127555 ACCCTCAATAAAATCAACTAAGG + Intergenic
959061180 3:101617922-101617944 ATACACAACAAAATCAGTGAAGG - Intergenic
959092346 3:101917360-101917382 ACACAGAAAAAAATCAACTTAGG + Intergenic
959931820 3:111993306-111993328 ATACAAAACAAAATCAGCAAAGG - Exonic
961150526 3:124633993-124634015 ACAAAAAACAAAATCACGCACGG - Intronic
961768486 3:129230502-129230524 GCACACAACAGAATTGCCTAAGG - Intergenic
964132497 3:153305727-153305749 ACACACAAAAAAATCACCTGTGG + Intergenic
964260927 3:154835809-154835831 ACAAACAAAAAAAACACTTATGG + Intergenic
965868910 3:173242405-173242427 ACAAACAAACAAAACACCTAGGG - Intergenic
966395754 3:179501201-179501223 ATACAAAATAAGATCACCTAGGG - Intergenic
967278018 3:187795494-187795516 AAAGAGAACAAAATCAGCTAGGG + Intergenic
967537905 3:190627901-190627923 AAACAAAACACAATTACCTAAGG - Intronic
968208200 3:196823563-196823585 ACAAACAAAAAAAACACCTTGGG + Intronic
968683282 4:1936935-1936957 TCACTCAACAACCTCACCTATGG - Intronic
970034086 4:11712225-11712247 ACACAAAACAAAATAACCTTAGG + Intergenic
970545803 4:17128927-17128949 ATACAGATCAAAATCACCAAAGG + Intergenic
970880665 4:20925787-20925809 ACACAAAACAAAATCAGCAAAGG + Intronic
971269018 4:25120632-25120654 AAACATAACAAAATCATTTAAGG + Exonic
971610413 4:28717967-28717989 ACACACAAAAAAATTATATAAGG + Intergenic
972689616 4:41383775-41383797 TCACACACCAGAATCACCTATGG - Intronic
973064434 4:45770737-45770759 GCAAACAACAAAATGACTTAAGG + Intergenic
973374900 4:49279885-49279907 CCACACTCCAGAATCACCTACGG - Intergenic
973375803 4:49285907-49285929 CCACACTCCAGAATCACCTACGG - Intergenic
973376703 4:49291926-49291948 CCACACTCCAGAATCACCTACGG - Intergenic
973377623 4:49298078-49298100 CCACACTCCAGAATCACCTACGG - Intergenic
973378543 4:49304214-49304236 CCACACTCCAGAATCACCTACGG - Intergenic
973379620 4:49311149-49311171 CCACACTCCAGAATCACCTACGG + Intergenic
973380518 4:49317289-49317311 CCACACTCCAGAATCACCTACGG + Intergenic
973381607 4:49324334-49324356 CCACACTCCAGAATCACCTACGG + Intergenic
973382511 4:49330356-49330378 CCACACTCCAGAATCACCTACGG + Intergenic
973386127 4:49515406-49515428 CCACACTACAGAATCACCTACGG + Intergenic
974431870 4:61808703-61808725 ACAAACAACACATTGACCTATGG + Intronic
974800203 4:66807520-66807542 TCACATGACAAAATCACCTAAGG - Intergenic
975126947 4:70793693-70793715 ACACAAAATAAAATAACCCAAGG - Intronic
975446470 4:74471448-74471470 ACACACAACAAAAGCTCTTTAGG + Intergenic
976180624 4:82395561-82395583 ATACAAAGCAAAATCAACTAAGG + Intergenic
977080826 4:92525398-92525420 ACATACCCTAAAATCACCTAGGG + Intronic
978023641 4:103845610-103845632 AGACAGTACAAAAGCACCTAAGG - Intergenic
978233485 4:106429385-106429407 ATACACAAGAAAATAACATAAGG - Intergenic
978282990 4:107039212-107039234 ACACACAGGAAAAACACATATGG - Intronic
979252111 4:118576406-118576428 AAACAAAACAAAAACACCTTGGG - Intergenic
979497562 4:121400855-121400877 ACACACATTAGAATCACCTGGGG - Intergenic
981014857 4:139963282-139963304 ACACACAGACAAATCTCCTAGGG + Intronic
981416654 4:144501201-144501223 ACAAACAAAAAAAAAACCTAGGG + Intergenic
981820968 4:148887405-148887427 ACACACAACAAGATCATTTTAGG + Intergenic
981823298 4:148911172-148911194 ATATACAAGAAAAACACCTAGGG + Intergenic
983388395 4:167096512-167096534 ACACACTTCTAAATCACATATGG - Intronic
983949153 4:173619379-173619401 ACAGACAAAAAAATTACCAAGGG - Intergenic
984276982 4:177622794-177622816 ACACACAAAAAAATGATCTATGG - Intergenic
984565626 4:181326889-181326911 TCCCACGACAAAATCACCTAAGG + Intergenic
986047604 5:4054640-4054662 AAATAAAACAAAATAACCTATGG - Intergenic
986332755 5:6729756-6729778 ACACACAAAAAAACCACCAAGGG - Intronic
986886931 5:12250306-12250328 ACACAGATCAAAATCATCAAAGG + Intergenic
987100310 5:14585332-14585354 AACAACAACAAAATCAACTATGG - Intronic
988855790 5:35227147-35227169 AGCAACAACAAGATCACCTATGG - Intronic
989329859 5:40244144-40244166 AAACAAAACAAAATACCCTATGG + Intergenic
990362837 5:55038800-55038822 ACACACACAAAAAACACCAACGG - Intergenic
990422629 5:55651978-55652000 ACACACAACAAAACCAAAAATGG + Intronic
990615083 5:57499638-57499660 ACAAACAAAAAAAACACCTATGG + Intergenic
990855120 5:60257285-60257307 AAACACAACAAAATCATATTTGG + Intronic
991185522 5:63802091-63802113 ACACACGACTAAATCATTTAGGG + Intergenic
992038097 5:72801710-72801732 ACACACTTCCAAATAACCTATGG - Intergenic
993625375 5:90218221-90218243 ACAGACAACAAAAACAACAATGG + Intergenic
993880977 5:93360590-93360612 TCACGTGACAAAATCACCTAAGG + Intergenic
993963349 5:94329628-94329650 AAACAAAACAAAATTACTTAAGG + Intronic
994068337 5:95569045-95569067 ATACACAGCAAAATCAGCAAAGG - Intronic
994944947 5:106375497-106375519 CCACACATCAGAATCACCTGGGG + Intergenic
995721678 5:115141483-115141505 AAACATAATAAAATCAACTATGG + Intronic
996333238 5:122355173-122355195 ACACATAACAAATTCAACTTAGG + Intronic
996885834 5:128352730-128352752 ACTCACATCAGAATCACCTGAGG - Intronic
996951255 5:129128537-129128559 CTGCACAACAAAATCATCTAGGG + Intergenic
999438482 5:151582534-151582556 AGTCACACCAAAATCACCCAGGG - Intergenic
999693793 5:154170742-154170764 CCACACATCAGAACCACCTAAGG + Intronic
1000289713 5:159859127-159859149 ACATACAACTTAATCATCTAGGG + Intergenic
1001145917 5:169184578-169184600 ACACACAACAAAATCACCTAGGG + Intronic
1002952242 6:1825505-1825527 GGGCCCAACAAAATCACCTAAGG - Intronic
1003128264 6:3373359-3373381 ACACAGAGCAAAATCAGCAAAGG - Intronic
1003465802 6:6378669-6378691 AAACAAAACAAAAACACCCAAGG + Intergenic
1004345125 6:14842296-14842318 ACAGAAAAAAAAATCTCCTATGG - Intergenic
1005172397 6:23003363-23003385 ACTGAAAAGAAAATCACCTATGG - Intergenic
1006063872 6:31446727-31446749 ACACATGACAAAATCACCTAAGG - Intergenic
1006441049 6:34053855-34053877 ACACACATTAAAATCACCTAGGG + Intronic
1006614161 6:35313729-35313751 TCACTTAACAAAATGACCTATGG + Intronic
1007459778 6:42009645-42009667 ACACACAAAAAAATTAGCTGGGG + Intronic
1007990795 6:46253986-46254008 TCACACAACGAAATCACCTAAGG + Intronic
1008335671 6:50301930-50301952 AAACCCTACAAAATAACCTATGG - Intergenic
1008728564 6:54452314-54452336 ACACTTACAAAAATCACCTATGG - Intergenic
1009161783 6:60291776-60291798 ACACACAAAAAAATCATTTTTGG + Intergenic
1011675228 6:89726581-89726603 ACACTGAACAAAATCTCCAACGG + Intronic
1012087258 6:94844204-94844226 ACACATATCAAATTCATCTAGGG + Intergenic
1012139465 6:95604799-95604821 ACAAACAATAAAATCAGTTAGGG - Intronic
1013236924 6:108205287-108205309 AAAAATAACAAAAACACCTAGGG - Intergenic
1013238432 6:108220585-108220607 ACAAACAATGAAATCACCTAAGG + Intronic
1014333201 6:120096882-120096904 ACACACAAAAATATCACTTAGGG + Intergenic
1015044764 6:128763824-128763846 ACACATAAAAAAACCACTTAAGG + Intergenic
1015058864 6:128938035-128938057 ACACACTCCAAAATGACCAATGG - Intronic
1015146625 6:129994616-129994638 TTACTCAACAAAATCACTTAGGG + Intergenic
1015795093 6:137003564-137003586 AGAAACAAGAAAAGCACCTAGGG - Intronic
1016191690 6:141276239-141276261 ACAAACAACAAAATTGGCTAAGG + Intergenic
1016475234 6:144419992-144420014 ACACACAATAAAAACAGATAAGG + Intronic
1018619803 6:165719198-165719220 TAACACAGGAAAATCACCTAGGG + Intronic
1020848158 7:13314005-13314027 ACACACTACTAAATAACCCATGG - Intergenic
1020856544 7:13433455-13433477 ATATACAAAAAAATCACCTCAGG - Intergenic
1021540024 7:21747210-21747232 CCACACAACAAAACAACCTTGGG - Intronic
1022644010 7:32214395-32214417 ACACACATTGGAATCACCTAGGG + Intronic
1022830659 7:34062618-34062640 CACAACAACAAAATCACCTAAGG - Intronic
1026261957 7:68763157-68763179 ATACACAGCAAAATCATCAAAGG - Intergenic
1027700349 7:81462411-81462433 ACACACACAAAAATCACACATGG - Intergenic
1028049991 7:86173909-86173931 ACACACAAAAAAAGCACCTTTGG + Intergenic
1028920430 7:96304744-96304766 CCATGCAACACAATCACCTATGG + Intronic
1028968588 7:96830530-96830552 ACACACAAGAAACTCACATCTGG + Intergenic
1028982204 7:96979672-96979694 ACACACAAAAAAATTCCCCAGGG + Intergenic
1029892487 7:103944992-103945014 ACAAACAAAAAAAACACCTACGG + Intronic
1031636635 7:124108880-124108902 ATACAGAACAAAATCAGCAAAGG + Intergenic
1032305322 7:130728592-130728614 ACACACAAGAAATTCAGCTGAGG + Intergenic
1034214009 7:149389569-149389591 ACACACAGCAACATTACATAAGG + Intergenic
1034816660 7:154177860-154177882 AAAGACAACAACATCGCCTATGG - Intronic
1035915296 8:3613985-3614007 GTAGATAACAAAATCACCTAGGG + Intronic
1037796202 8:21997302-21997324 ACACACAATAAAAACAAGTATGG + Intronic
1038117548 8:24574441-24574463 ACACAAAACAAAATCTTCTGGGG - Intergenic
1038382404 8:27108597-27108619 ACACAGAAAAAAATCATCTGTGG + Intergenic
1039037607 8:33376806-33376828 GAACAGAACAAAATCACGTAAGG + Intronic
1039599400 8:38821795-38821817 TCACACAACAAAATCACCTAAGG - Intronic
1041668492 8:60468864-60468886 ATACACAATAAAATCAGCCAAGG + Intergenic
1042189475 8:66171055-66171077 CATAACAACAAAATCACCTAAGG + Intronic
1042654031 8:71075728-71075750 ACACACACAAAAAGTACCTATGG - Intergenic
1042742107 8:72061405-72061427 TCACAAAATAAAATCACCTGTGG - Intronic
1043859430 8:85298741-85298763 ACCCACAACTGAATCACCTATGG + Intergenic
1043991562 8:86762175-86762197 ATACACCACAAAATCAGCAAAGG + Intergenic
1044191310 8:89320944-89320966 ACATACAAACAAATCACTTAAGG - Intergenic
1044267024 8:90193954-90193976 ACAGACTACAAAATGACCTCAGG - Intergenic
1044372698 8:91431843-91431865 ACCCACAACAATGTCATCTATGG + Intergenic
1046681043 8:117170319-117170341 ACAAACAACACAAACACCTGGGG - Intronic
1046915108 8:119671544-119671566 AGACACAACAGAATCACCCTAGG - Intronic
1047966991 8:130052509-130052531 AAACTCAACAAGATCACCAAAGG + Intronic
1048134502 8:131735596-131735618 ACAAACAAAAAAATGCCCTAAGG + Intergenic
1048261929 8:132952500-132952522 ACACCCAACAGAGGCACCTATGG + Intronic
1048787407 8:138064598-138064620 TCTTACAACAAAATCACTTAAGG + Intergenic
1048946684 8:139455297-139455319 ACACAAAGCAAAATCAGCAAAGG + Intergenic
1049227053 8:141459421-141459443 ACACAGAAGAACATCACCTAAGG + Intergenic
1050373320 9:4945230-4945252 ACACTGAAGAACATCACCTAAGG - Intergenic
1050908194 9:11031490-11031512 ACACACATCTAAATAACCAATGG - Intergenic
1052621021 9:30910535-30910557 ACACAAAATCAAATCACCAATGG + Intergenic
1052716297 9:32121795-32121817 TCATACAATAAAATAACCTACGG - Intergenic
1053402740 9:37841052-37841074 CACAACAACAAAATCACCTAAGG + Intronic
1053452660 9:38206091-38206113 CACAACAACAAAATCACCTAAGG + Intergenic
1054859976 9:69940711-69940733 ACACACACCTAAATGACCAATGG + Intergenic
1054871604 9:70052112-70052134 ACACATATCACAATCACCTAGGG - Intronic
1057366065 9:94422285-94422307 ACACAAAGCAAAATCAGCAAAGG - Intronic
1057657267 9:96965780-96965802 ACACAAAGCAAAATCAGCAAAGG + Intronic
1057723252 9:97549603-97549625 ACACACAACAGAATCATTTGGGG - Intronic
1058401873 9:104628824-104628846 ACACACAATTAAAGCACCAATGG + Intergenic
1058585539 9:106502778-106502800 ACACACCAGAAATTCACCTGGGG - Intergenic
1060850056 9:126867492-126867514 ATACACAAAAAAAACCCCTATGG - Intronic
1061622587 9:131821209-131821231 ACACAAAATAAAATCAGCAAAGG - Intergenic
1203548718 Un_KI270743v1:151384-151406 CCACACTCCAGAATCACCTACGG - Intergenic
1203549699 Un_KI270743v1:157021-157043 CCACACTCCAGAATCACCTACGG + Intergenic
1203550642 Un_KI270743v1:163186-163208 CCACACTCCAGAATCACCTACGG + Intergenic
1185655469 X:1680835-1680857 ACACAGAACAAAATGAACAAAGG - Intergenic
1185692150 X:2164219-2164241 ACATACAACAAGCTCATCTATGG - Intergenic
1186542014 X:10410446-10410468 ATACACAGCAAAATCAGCAAAGG - Intergenic
1187004340 X:15217146-15217168 TCTCACAACAGAGTCACCTAGGG - Intergenic
1188169577 X:26907768-26907790 ACACACATTTAAATGACCTATGG + Intergenic
1188862861 X:35277891-35277913 ACACAAAATAAAATCAACCAGGG - Intergenic
1189063310 X:37777967-37777989 CACAACAACAAAATCACCTAAGG - Intronic
1189570224 X:42287054-42287076 ACACACATCTAAATAACCTATGG - Intergenic
1189808856 X:44762608-44762630 AGACTCATCAAAATCACCTGGGG + Intergenic
1190024159 X:46907447-46907469 ACACAGAACAAAATCTTCAAAGG + Intergenic
1190262437 X:48805846-48805868 ACACACATCAAACTCTCCTGAGG - Intronic
1190788611 X:53678776-53678798 AAAAATAACTAAATCACCTAAGG + Intronic
1190874839 X:54452444-54452466 ACACACATTAAAATCACCTAGGG + Intronic
1190969778 X:55337267-55337289 GGATACATCAAAATCACCTAGGG + Intergenic
1192670436 X:73134843-73134865 ACACAAAGCAAAATCAGCAAAGG + Intergenic
1193107715 X:77696811-77696833 AAGCACATCAGAATCACCTAGGG + Intronic
1193890270 X:87035339-87035361 ACACACAAAAAAACCACTTCAGG - Intergenic
1194376491 X:93140061-93140083 ACACACTACTAAATAACCAATGG - Intergenic
1194494232 X:94591178-94591200 ACAAACAAAAAAATGAACTAAGG - Intergenic
1195199499 X:102533768-102533790 ACACGCATCAACATCATCTAGGG + Intergenic
1195281388 X:103337843-103337865 AAACACAATAAAATCACACAAGG + Intergenic
1196023202 X:111011777-111011799 ACAAACAGCAAAATCCCCTATGG - Intronic
1197961933 X:132016546-132016568 GTACACAACATAATCACCTGGGG + Intergenic
1198640856 X:138754974-138754996 ACACACAGCAAAATTAACAAAGG - Intronic
1198965280 X:142221867-142221889 ACAAACACCAAAATGACCCATGG + Intergenic
1200783920 Y:7242271-7242293 ACACAAAACAAAAGCACACATGG - Intergenic
1201464371 Y:14264238-14264260 ACAAACAGAAAAATCACCTGGGG + Intergenic
1202263199 Y:22991342-22991364 AAACATCACCAAATCACCTATGG - Intronic
1202416189 Y:24625083-24625105 AAACATCACCAAATCACCTATGG - Intronic
1202454598 Y:25045003-25045025 AAACATCACCAAATCACCTATGG + Intronic