ID: 1001149057

View in Genome Browser
Species Human (GRCh38)
Location 5:169210897-169210919
Sequence CACCCAACATCAATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001149057_1001149062 9 Left 1001149057 5:169210897-169210919 CCATGTTCCATTGATGTTGGGTG 0: 1
1: 0
2: 0
3: 19
4: 118
Right 1001149062 5:169210929-169210951 AACTTGATTTGGTTAACAGAAGG 0: 1
1: 0
2: 2
3: 24
4: 170
1001149057_1001149060 -2 Left 1001149057 5:169210897-169210919 CCATGTTCCATTGATGTTGGGTG 0: 1
1: 0
2: 0
3: 19
4: 118
Right 1001149060 5:169210918-169210940 TGTGGCCATGTAACTTGATTTGG 0: 1
1: 6
2: 16
3: 115
4: 415
1001149057_1001149063 13 Left 1001149057 5:169210897-169210919 CCATGTTCCATTGATGTTGGGTG 0: 1
1: 0
2: 0
3: 19
4: 118
Right 1001149063 5:169210933-169210955 TGATTTGGTTAACAGAAGGTTGG 0: 1
1: 0
2: 1
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001149057 Original CRISPR CACCCAACATCAATGGAACA TGG (reversed) Intronic
900639913 1:3683798-3683820 CCTCCACCATCAGTGGAACAGGG + Intronic
900763624 1:4488933-4488955 CACCCAACATCTGGGCAACATGG + Intergenic
901761747 1:11476557-11476579 CACCAGACAGCACTGGAACAAGG + Intergenic
904338782 1:29818182-29818204 CATATTACATCAATGGAACAGGG - Intergenic
904422720 1:30404534-30404556 CACCCAACATCAGAGGGACAGGG - Intergenic
906683298 1:47745698-47745720 AAGCCAACATCAATGGAAGGAGG - Intergenic
916844752 1:168638361-168638383 CACCCAACAGTAATGCTACATGG - Intergenic
917206419 1:172576715-172576737 CTCCCACCATAAAAGGAACAAGG - Intronic
923323730 1:232861665-232861687 CACCAATCATCATTAGAACAAGG - Intergenic
924275209 1:242379156-242379178 CACTCAACTTAAATGTAACAGGG + Intronic
924906363 1:248456921-248456943 CATCCAACAGCAAATGAACATGG - Intergenic
924921527 1:248635116-248635138 CATCCAACAGCAAATGAACATGG + Intergenic
1063874479 10:10458699-10458721 GACCCAGCATCAATGGTACAGGG + Intergenic
1065354154 10:24822792-24822814 CACACAACAGAAATGGATCACGG + Intergenic
1065640237 10:27774685-27774707 CTCCCAACATCAATCTAGCATGG + Intergenic
1070985285 10:80684390-80684412 CACCCAACTGCAAGGGAAGATGG - Intergenic
1072826300 10:98610161-98610183 AATCCAGCATCAATGGAACATGG + Intronic
1078613968 11:12847535-12847557 CACCCAACATGACAGGAATAAGG + Intronic
1079472875 11:20796912-20796934 CAGCCAAGATGAATGGAAGAGGG + Intronic
1081884371 11:46482553-46482575 CACCCCACTTCACAGGAACAAGG + Intronic
1082989513 11:59195261-59195283 CACCCAACCTCCAGGGAAGATGG + Exonic
1085201448 11:74704617-74704639 CTCCCAGCATCACTGGAACATGG + Exonic
1086756407 11:90568981-90569003 CACCCAAACACAATGGAACAAGG - Intergenic
1086876761 11:92105938-92105960 CACCCAACAGGAGTGGAAGAGGG + Intergenic
1091174783 11:133548143-133548165 CACCCAACATATATGCAATAGGG + Intergenic
1097973174 12:65656917-65656939 CCCCCAACATCATTTGCACAGGG - Intergenic
1099190502 12:79556950-79556972 AAGCCAACATCAATGGAAGATGG + Intergenic
1099410347 12:82318144-82318166 CACCCAACTGCAATGGAGCTAGG + Intronic
1099456807 12:82873197-82873219 CACACAACATCTTTGAAACAGGG - Intronic
1099549722 12:84028327-84028349 AACCTAACATCAATGGAATAAGG - Intergenic
1100010844 12:89951523-89951545 CATCTAACTTCAAGGGAACATGG + Intergenic
1105331012 13:19415273-19415295 CACTTAACATCAAAGGGACAGGG - Intergenic
1105919049 13:24943580-24943602 CACTTAACATCAAAGGGACAGGG - Intergenic
1107483910 13:40808439-40808461 CACTTAACATCAAAGGTACAGGG - Exonic
1109845705 13:67987698-67987720 AACCAAAGATCACTGGAACAGGG + Intergenic
1116387881 14:44354903-44354925 AACACAACATCCATGGACCAAGG - Intergenic
1116473592 14:45313981-45314003 CACCCCACTTCCAGGGAACAAGG - Intergenic
1120482172 14:85064107-85064129 CAGCCAATTTCAATGGAAGAAGG + Intergenic
1122270252 14:100565786-100565808 CACCCAACATCCCTGCAACCTGG + Intronic
1122967765 14:105139217-105139239 CACCCACCCACAAGGGAACAAGG + Intergenic
1125178441 15:36852789-36852811 GAACCATCATCAATGGTACATGG - Intergenic
1127531258 15:59845802-59845824 CCCCCAAAATCAAAGGAAAATGG + Intergenic
1128710304 15:69866716-69866738 CACCAAACATCAGAGGAACAGGG - Intergenic
1131885898 15:96912444-96912466 CACACAACATCACTGAAACTTGG + Intergenic
1138160862 16:54752926-54752948 CACACAACTTTAATGGAAAAAGG + Intergenic
1140939826 16:79711153-79711175 GAACCAACATAAATGGAGCAGGG - Intergenic
1141304812 16:82852260-82852282 CACTAAACATCCATGGAACAAGG - Intronic
1144738383 17:17567548-17567570 GACCCAACATCAAGGGGCCAGGG + Intronic
1145360353 17:22207046-22207068 CACCCAACATGACTATAACAAGG - Intergenic
1148825023 17:50386607-50386629 CACCCAGCCTCTAGGGAACATGG + Intronic
1148961420 17:51396414-51396436 CACCCAACAATAATGGGAGATGG - Intergenic
1151591178 17:75046045-75046067 CCCGCAACATCAGTGGAAAATGG + Intronic
1153483992 18:5576720-5576742 CACGCAACTTCATTGAAACATGG - Intronic
1154048790 18:10933546-10933568 CATCCCAAATCAATGGAAAATGG - Intronic
1155556254 18:27022168-27022190 CACCCATGAACAATGCAACATGG - Intronic
1161188390 19:2938584-2938606 ATCCCAACACCCATGGAACATGG - Intronic
1165409592 19:35651152-35651174 TACCCAGGATCAATGGAAGAGGG - Intronic
1166870821 19:45869527-45869549 CATCCTAGGTCAATGGAACACGG - Intronic
926214728 2:10897869-10897891 CTCCTAACATCCAGGGAACAGGG - Intergenic
929371499 2:41229387-41229409 CACCTAAAATCAATGGTAAAGGG + Intergenic
930677588 2:54220957-54220979 AACCCAACATCAGTGGGATAGGG - Intronic
930807251 2:55503351-55503373 CACCCAAATGCAATGGATCATGG + Intergenic
932863103 2:75314814-75314836 CACCCCACATGAAGGGAAGATGG - Intergenic
933595461 2:84278603-84278625 CAGACAAGATCAAAGGAACAGGG + Intergenic
935057756 2:99582324-99582346 CACCCGAGATCACTGGAAAAGGG + Intronic
936271679 2:111054018-111054040 CACTCAACATCACTAGAGCAGGG - Intronic
938985466 2:136571131-136571153 AACCCATGATAAATGGAACAGGG - Intergenic
940921716 2:159315124-159315146 CTCCTACCATCAATGGAAGAGGG - Intergenic
940986102 2:160053686-160053708 CCCCCAACTTCAATGCAACCTGG + Intronic
944484429 2:200190022-200190044 AGCCCAACATCAATGGCATAAGG - Intergenic
946509677 2:220341419-220341441 CACCCTACTTCATTGGAACATGG - Intergenic
948073595 2:235147642-235147664 CACCCAACAGCAATGCAAAGAGG + Intergenic
1169583967 20:7059158-7059180 CAGCCAAGATGCATGGAACAGGG + Intergenic
1170162507 20:13328340-13328362 CTCCCACCAACAATGTAACAGGG - Intergenic
1173841845 20:46162620-46162642 CACCCAAGATCCAGGCAACAAGG - Intergenic
1176741990 21:10613352-10613374 CACTTAACATCAAAGGGACAGGG + Intergenic
1178640591 21:34342359-34342381 CACCCAACTTGGATGGCACAGGG + Intergenic
1179411260 21:41165459-41165481 CAACAAACATCAGTGGAACATGG + Intergenic
1179590418 21:42404322-42404344 CAGCCAACACAAATTGAACAGGG - Intronic
1180563873 22:16646587-16646609 CACTTAACATCAAAGGGACAGGG + Intergenic
1184997701 22:48222583-48222605 CAACCCACAGCAATGGGACATGG - Intergenic
950157426 3:10733169-10733191 CATCCATCAGCTATGGAACAAGG + Intergenic
950451011 3:13065739-13065761 CACCCAACAGAAATGGAACCAGG + Intronic
952021596 3:29028631-29028653 CAACCAAATTTAATGGAACAGGG - Intergenic
956465676 3:69518681-69518703 AACCCAACATGTTTGGAACAAGG + Intronic
957342994 3:78925570-78925592 CAACCAACATCAATGAAAAAAGG - Intronic
957977977 3:87472011-87472033 CACCCCACATTAATTGAAAATGG - Intergenic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
962394211 3:135000819-135000841 CACAAAAAATCAATGGAACTGGG - Intronic
963960658 3:151305409-151305431 CAACCAACAACAAAGAAACATGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966072414 3:175895160-175895182 CAACCATCCTCATTGGAACAGGG + Intergenic
970455944 4:16224585-16224607 CACACAAAATCAATGGAACTGGG + Intronic
974882700 4:67779184-67779206 GACCCAAAATGAATGGAAAATGG - Intergenic
976222078 4:82763967-82763989 CACGCAACATCAATCAAAGAAGG - Intronic
982528941 4:156513914-156513936 CACCTAACTTCAAAGGAGCAAGG + Intergenic
985179027 4:187236587-187236609 CACCCATAAACAATGGAAAAAGG - Intergenic
985552261 5:539742-539764 CGCCAAACATCAATAGAAAACGG + Intergenic
985977221 5:3429803-3429825 CCCCCAAAAGCAATGGAAAATGG + Intergenic
987044142 5:14090760-14090782 CACCCAACAAATATGGAATAGGG - Intergenic
990291644 5:54358008-54358030 CACCCAACTTCAAGGGAGTAGGG + Intergenic
990963158 5:61416029-61416051 CACCCAACACAAATGTAAGAAGG - Intronic
994059020 5:95453343-95453365 CACCCGACATCAAGGGAAGTGGG + Intergenic
999505082 5:152186191-152186213 CTCCCAGCAGCAATGGAACAGGG - Intergenic
999913892 5:156236780-156236802 CTCCCAACACCAAAGGAACAAGG + Intronic
1001149057 5:169210897-169210919 CACCCAACATCAATGGAACATGG - Intronic
1001597955 5:172910206-172910228 CACCCAATAGCAATGGGACCAGG + Intronic
1002309862 5:178307743-178307765 CACCCAACTTCACTGAAACAGGG - Intronic
1008717904 6:54311294-54311316 CACCCACCATGGAGGGAACAGGG - Intronic
1009434858 6:63605662-63605684 CACCCAACTGCAAGGGAACCTGG + Intergenic
1015117364 6:129664341-129664363 CACCTACCCTCAATGGATCATGG + Intronic
1015721203 6:136244264-136244286 CACCTACCATGAATGGAAGATGG - Intronic
1018222859 6:161598778-161598800 CACCCAACATCCAAAGAAAAAGG - Intronic
1019531528 7:1505978-1506000 CACCCAACTTCAGGGGCACAGGG - Intergenic
1025932349 7:66006007-66006029 CTCTGAACATCAATGGGACATGG - Intergenic
1029804897 7:102985988-102986010 CACCCCACATCCCTGGAACCTGG + Intronic
1030285664 7:107824360-107824382 CACCCAACTGCAATGGGACTTGG - Intergenic
1034335820 7:150323070-150323092 CACCCAACATGTATTGAACAAGG + Intronic
1035309800 7:157959506-157959528 CACCCAACAACAAAGAAGCAAGG + Intronic
1041531893 8:58878258-58878280 AAACCAACATCAAAAGAACAGGG + Intronic
1041702456 8:60806473-60806495 CCAGCAACATAAATGGAACATGG - Intronic
1046206470 8:111004937-111004959 CAACTAATATCAATGGACCATGG - Intergenic
1047250717 8:123180352-123180374 CAACCATCTTCAATGGCACATGG + Intronic
1047812644 8:128427404-128427426 CAGCCAACCTCTATGGAAGAAGG + Intergenic
1048081400 8:131132002-131132024 CACCCAGTATCAATGGGACTTGG + Intergenic
1048364640 8:133728095-133728117 AGCCTAACATCAATGGAACAGGG + Intergenic
1048702032 8:137102178-137102200 CTCCCAACATCATTGGGATAAGG + Intergenic
1051466327 9:17381985-17382007 AACTCAACATTAATGGAGCAGGG + Intronic
1052243680 9:26307003-26307025 CACCCAACTTCAAGTCAACACGG - Intergenic
1052797474 9:32936682-32936704 ATCCCAACATCAATAGGACAGGG + Intergenic
1054971155 9:71088797-71088819 CATCCAAAACCAATGGATCATGG - Intronic
1059658283 9:116376492-116376514 CACCAAACAGCTATGGAGCATGG + Intronic
1188895539 X:35663886-35663908 CACCTACCTTCAATGGTACAGGG - Intergenic
1189946145 X:46180994-46181016 GACACAAGATCAATGGGACAGGG - Intergenic
1191255681 X:58278591-58278613 CACCCAACCTGAGTGGATCATGG - Intergenic
1194737728 X:97533277-97533299 CAGTTAACATCATTGGAACATGG - Intronic
1201628306 Y:16039607-16039629 TGGCCAACATCAAGGGAACAAGG + Intergenic
1202600315 Y:26587537-26587559 CACTTAACATCAAAGGGACAGGG + Intergenic