ID: 1001149097

View in Genome Browser
Species Human (GRCh38)
Location 5:169211253-169211275
Sequence CTGAGTAATGCAGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001149091_1001149097 15 Left 1001149091 5:169211215-169211237 CCGCTGAGATTCTGAGGTTGTCT 0: 1
1: 2
2: 16
3: 84
4: 436
Right 1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001149097 Original CRISPR CTGAGTAATGCAGAGGAGGA GGG Intronic
No off target data available for this crispr