ID: 1001158819

View in Genome Browser
Species Human (GRCh38)
Location 5:169296557-169296579
Sequence TGTCCTCTAAGCTGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001158813_1001158819 10 Left 1001158813 5:169296524-169296546 CCAGAGAGACCCCATGATTCACT No data
Right 1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 169
1001158811_1001158819 21 Left 1001158811 5:169296513-169296535 CCGTGGTTGACCCAGAGAGACCC 0: 1
1: 0
2: 3
3: 40
4: 506
Right 1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 169
1001158815_1001158819 0 Left 1001158815 5:169296534-169296556 CCCATGATTCACTAGCTTGTTCC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 169
1001158812_1001158819 11 Left 1001158812 5:169296523-169296545 CCCAGAGAGACCCCATGATTCAC No data
Right 1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 169
1001158814_1001158819 1 Left 1001158814 5:169296533-169296555 CCCCATGATTCACTAGCTTGTTC 0: 1
1: 0
2: 2
3: 9
4: 110
Right 1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 169
1001158810_1001158819 29 Left 1001158810 5:169296505-169296527 CCACATCACCGTGGTTGACCCAG 0: 1
1: 0
2: 1
3: 3
4: 89
Right 1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 169
1001158816_1001158819 -1 Left 1001158816 5:169296535-169296557 CCATGATTCACTAGCTTGTTCCT 0: 1
1: 0
2: 3
3: 12
4: 145
Right 1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001158819 Original CRISPR TGTCCTCTAAGCTGGCCCTG AGG Intronic