ID: 1001162213

View in Genome Browser
Species Human (GRCh38)
Location 5:169330115-169330137
Sequence GGGTCCTTAAAAATGGTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001162213_1001162220 -2 Left 1001162213 5:169330115-169330137 CCCGCTACCATTTTTAAGGACCC No data
Right 1001162220 5:169330136-169330158 CCTTGTAAATGGGCCCACTCAGG No data
1001162213_1001162221 5 Left 1001162213 5:169330115-169330137 CCCGCTACCATTTTTAAGGACCC No data
Right 1001162221 5:169330143-169330165 AATGGGCCCACTCAGGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001162213 Original CRISPR GGGTCCTTAAAAATGGTAGC GGG (reversed) Intergenic
No off target data available for this crispr