ID: 1001168975

View in Genome Browser
Species Human (GRCh38)
Location 5:169399348-169399370
Sequence AAATCACTTGTGTCTTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001168975_1001168981 4 Left 1001168975 5:169399348-169399370 CCTACCCAAGACACAAGTGATTT No data
Right 1001168981 5:169399375-169399397 AGGTAGCTACTGGACATGTGTGG No data
1001168975_1001168980 -6 Left 1001168975 5:169399348-169399370 CCTACCCAAGACACAAGTGATTT No data
Right 1001168980 5:169399365-169399387 TGATTTGGATAGGTAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001168975 Original CRISPR AAATCACTTGTGTCTTGGGT AGG (reversed) Intergenic
No off target data available for this crispr