ID: 1001169400

View in Genome Browser
Species Human (GRCh38)
Location 5:169404468-169404490
Sequence CCTTCCATGAATACAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001169396_1001169400 -6 Left 1001169396 5:169404451-169404473 CCAAGAAGAAAAAGAAGCCTTCC No data
Right 1001169400 5:169404468-169404490 CCTTCCATGAATACAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001169400 Original CRISPR CCTTCCATGAATACAAGGGA AGG Intergenic
No off target data available for this crispr