ID: 1001171150

View in Genome Browser
Species Human (GRCh38)
Location 5:169420031-169420053
Sequence CCTGGTGACCTGTAATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001171150_1001171158 29 Left 1001171150 5:169420031-169420053 CCTCTTCATTACAGGTCACCAGG No data
Right 1001171158 5:169420083-169420105 GAAAGAGCCCACTCAGAGTGAGG No data
1001171150_1001171155 6 Left 1001171150 5:169420031-169420053 CCTCTTCATTACAGGTCACCAGG No data
Right 1001171155 5:169420060-169420082 GGCCAAAAAAGAATTGAGTGAGG No data
1001171150_1001171156 7 Left 1001171150 5:169420031-169420053 CCTCTTCATTACAGGTCACCAGG No data
Right 1001171156 5:169420061-169420083 GCCAAAAAAGAATTGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001171150 Original CRISPR CCTGGTGACCTGTAATGAAG AGG (reversed) Intergenic
No off target data available for this crispr